Starting /dee2/code/volunteer_pipeline.sh SRR21853550 current disk space = 1550645305344 free memory = 1595194992 SRR21853550 SRAfilesize cd0fd2bc3d14b92a3314388f5f760107 SRR21853550.sra SRR21853550.sra file validated SRR21853550 is single end SRR21853550 is conventional basespace SRR21853550 read1 length is 78-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR21853550_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 78-101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.2275 37.0 37.0 37.0 37.0 37.0 2 34.94875 37.0 37.0 37.0 25.0 37.0 3 35.703 37.0 37.0 37.0 37.0 37.0 4 35.713 37.0 37.0 37.0 37.0 37.0 5 35.76 37.0 37.0 37.0 37.0 37.0 6 35.877 37.0 37.0 37.0 37.0 37.0 7 35.532 37.0 37.0 37.0 37.0 37.0 8 35.795 37.0 37.0 37.0 37.0 37.0 9 35.829 37.0 37.0 37.0 37.0 37.0 10-11 35.948499999999996 37.0 37.0 37.0 37.0 37.0 12-13 35.89575 37.0 37.0 37.0 37.0 37.0 14-15 35.885999999999996 37.0 37.0 37.0 37.0 37.0 16-17 35.8595 37.0 37.0 37.0 37.0 37.0 18-19 35.836 37.0 37.0 37.0 37.0 37.0 20-21 35.88675 37.0 37.0 37.0 37.0 37.0 22-23 35.81375 37.0 37.0 37.0 37.0 37.0 24-25 35.684 37.0 37.0 37.0 37.0 37.0 26-27 35.803250000000006 37.0 37.0 37.0 37.0 37.0 28-29 35.61425 37.0 37.0 37.0 37.0 37.0 30-31 35.61175 37.0 37.0 37.0 37.0 37.0 32-33 35.621 37.0 37.0 37.0 37.0 37.0 34-35 35.6215 37.0 37.0 37.0 37.0 37.0 36-37 35.57725 37.0 37.0 37.0 37.0 37.0 38-39 35.565 37.0 37.0 37.0 37.0 37.0 40-41 35.5445 37.0 37.0 37.0 37.0 37.0 42-43 35.571 37.0 37.0 37.0 37.0 37.0 44-45 35.56375 37.0 37.0 37.0 37.0 37.0 46-47 35.53875 37.0 37.0 37.0 37.0 37.0 48-49 35.454750000000004 37.0 37.0 37.0 37.0 37.0 50-51 35.51475000000001 37.0 37.0 37.0 37.0 37.0 52-53 35.502250000000004 37.0 37.0 37.0 37.0 37.0 54-55 35.423 37.0 37.0 37.0 37.0 37.0 56-57 35.54575 37.0 37.0 37.0 37.0 37.0 58-59 35.52175 37.0 37.0 37.0 37.0 37.0 60-61 35.3855 37.0 37.0 37.0 37.0 37.0 62-63 35.37175 37.0 37.0 37.0 37.0 37.0 64-65 35.377 37.0 37.0 37.0 37.0 37.0 66-67 35.3405 37.0 37.0 37.0 37.0 37.0 68-69 35.33925 37.0 37.0 37.0 37.0 37.0 70-71 35.30575 37.0 37.0 37.0 37.0 37.0 72-73 35.399 37.0 37.0 37.0 37.0 37.0 74-75 35.4065 37.0 37.0 37.0 37.0 37.0 76-77 35.21925 37.0 37.0 37.0 25.0 37.0 78-79 35.208775068767196 37.0 37.0 37.0 25.0 37.0 80-81 35.452613153288326 37.0 37.0 37.0 37.0 37.0 82-83 35.30432608152039 37.0 37.0 37.0 31.0 37.0 84-85 35.22005501375344 37.0 37.0 37.0 25.0 37.0 86-87 35.28482120530133 37.0 37.0 37.0 31.0 37.0 88-89 35.307326831707925 37.0 37.0 37.0 31.0 37.0 90-91 35.266816704176044 37.0 37.0 37.0 31.0 37.0 92-93 35.20555138784696 37.0 37.0 37.0 31.0 37.0 94-95 35.149574787393696 37.0 37.0 37.0 25.0 37.0 96-97 35.230796312862 37.0 37.0 37.0 31.0 37.0 98-99 35.26420541714654 37.0 37.0 37.0 31.0 37.0 100-101 35.27867086733185 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 1.0 21 1.0 22 1.0 23 3.0 24 2.0 25 14.0 26 8.0 27 25.0 28 39.0 29 55.0 30 71.0 31 111.0 32 127.0 33 193.0 34 251.0 35 551.0 36 2092.0 37 453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.224999999999998 14.899999999999999 13.725000000000001 47.15 2 24.271598682543704 20.445908284773246 36.83810488978971 18.444388142893338 3 22.95 25.7 24.875 26.474999999999998 4 24.45 30.2 19.8 25.55 5 26.674999999999997 32.824999999999996 19.85 20.65 6 20.075000000000003 33.825 22.8 23.3 7 18.575 17.1 40.300000000000004 24.025 8 21.85 20.8 27.325 30.025000000000002 9 19.125 21.4 32.375 27.1 10-11 25.124999999999996 28.812500000000004 21.325 24.7375 12-13 23.3125 23.0125 26.85 26.825 14-15 23.1375 24.9875 26.8125 25.0625 16-17 24.9125 25.662499999999998 24.5125 24.9125 18-19 24.0 25.724999999999998 24.95 25.324999999999996 20-21 23.8875 25.025 26.224999999999998 24.8625 22-23 23.125 26.400000000000002 25.95 24.525 24-25 23.8125 26.137500000000003 25.5375 24.5125 26-27 23.8125 25.324999999999996 26.625 24.2375 28-29 23.75 25.637500000000003 26.05 24.5625 30-31 23.5625 25.7625 25.687500000000004 24.9875 32-33 24.05 27.437499999999996 25.45 23.0625 34-35 23.325000000000003 26.400000000000002 24.712500000000002 25.5625 36-37 23.474999999999998 25.275 26.424999999999997 24.825 38-39 24.462500000000002 25.0 25.924999999999997 24.6125 40-41 23.425 26.087500000000002 24.95 25.5375 42-43 23.7375 25.624999999999996 25.224999999999998 25.412499999999998 44-45 24.2375 25.9875 26.237500000000004 23.5375 46-47 23.8875 26.2875 24.837500000000002 24.9875 48-49 23.5125 25.587500000000002 25.7875 25.112499999999997 50-51 24.474999999999998 25.1 26.2625 24.1625 52-53 23.75 26.2875 24.925 25.0375 54-55 23.6375 25.5 25.4 25.4625 56-57 24.637500000000003 24.4 26.337500000000002 24.625 58-59 22.775000000000002 25.837500000000002 25.662499999999998 25.724999999999998 60-61 23.2875 26.337500000000002 25.3 25.074999999999996 62-63 24.6125 26.0125 24.55 24.825 64-65 23.799999999999997 25.575 25.85 24.775 66-67 24.4375 25.087500000000002 26.0125 24.462500000000002 68-69 23.6375 25.837500000000002 24.8625 25.662499999999998 70-71 24.887500000000003 25.174999999999997 25.0 24.9375 72-73 23.7875 26.200000000000003 24.575 25.4375 74-75 23.575 25.2625 26.0625 25.1 76-77 24.3 24.3875 26.4625 24.85 78-79 23.590448806100763 25.453181647705964 26.290786348293537 24.66558319789974 80-81 24.281070267566893 25.84396099024756 25.1937984496124 24.681170292573142 82-83 24.90622655663916 25.431357839459867 24.8062015503876 24.85621405351338 84-85 23.918479619904975 25.64391097774444 24.793698424606152 25.64391097774444 86-87 23.58089522380595 25.418854713678417 25.78144536134033 25.218804701175294 88-89 23.95598899724931 25.84396099024756 25.568892223055762 24.63115778944736 90-91 24.356089022255563 25.71892973243311 25.343835958989747 24.58114528632158 92-93 24.193548387096776 25.543885971492873 25.6064016004001 24.656164041010253 94-95 24.96248124062031 25.72536268134067 24.937468734367183 24.374687343671837 96-97 24.4180225281602 25.494367959949937 24.793491864831037 25.294117647058822 98-99 24.079969438431174 24.831274672099834 25.697185788870495 25.3915701005985 100-101 25.614591593973035 11.245043616177638 31.70499603489294 31.435368754956382 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 2.5 27 2.0 28 8.0 29 10.0 30 6.5 31 10.5 32 14.5 33 23.0 34 34.5 35 39.0 36 45.5 37 62.0 38 85.5 39 99.0 40 110.5 41 156.5 42 201.0 43 213.0 44 208.5 45 210.0 46 218.0 47 200.5 48 186.5 49 178.5 50 154.0 51 140.0 52 130.0 53 120.0 54 112.0 55 93.5 56 84.5 57 87.0 58 78.5 59 69.0 60 64.5 61 55.0 62 52.0 63 45.0 64 41.0 65 38.5 66 34.5 67 39.0 68 33.0 69 32.5 70 29.0 71 22.0 72 20.5 73 20.5 74 21.5 75 14.0 76 10.5 77 8.5 78 7.5 79 7.0 80 3.0 81 0.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 1.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 1.0 94 0.0 95 1.0 96 4.0 97 22.0 98 89.0 99 260.0 100 939.0 101 2683.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.20674993356364 88.625 2 5.341482859420675 10.05 3 0.3986181238373638 1.125 4 0.05314908317831517 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945405 spots for SRR21853550.sra Written 945405 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra Read 945404 spots for SRR21853550.sra Written 945404 spots for SRR21853550.sra SRR ids: ['SRR21853550.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cttva71f SRR21853550.sra spots: 18908081 blocks: [[1, 945404], [945405, 1890808], [1890809, 2836212], [2836213, 3781616], [3781617, 4727020], [4727021, 5672424], [5672425, 6617828], [6617829, 7563232], [7563233, 8508636], [8508637, 9454040], [9454041, 10399444], [10399445, 11344848], [11344849, 12290252], [12290253, 13235656], [13235657, 14181060], [14181061, 15126464], [15126465, 16071868], [16071869, 17017272], [17017273, 17962676], [17962677, 18908081]] SRR21853550 file size 5092456 SRR21853550 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR21853550 SRR21853550_1.fastq Input file: SRR21853550_1.fastq trimmed: SRR21853550-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 17:40:20 2024 >> started Fri Dec 6 17:40:30 2024 >> done (10.067s) 18908081 reads processed; of these: 13 ( 0.00%) short reads filtered out after trimming by size control 29150 ( 0.15%) empty reads filtered out after trimming by size control 18878918 (99.85%) reads available; of these: 467 ( 0.00%) trimmed reads available after processing 18878451 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 4 0.00% 22 1 0.00% 23 1 0.00% 24 5 0.00% 25 3 0.00% 26 3 0.00% 27 2 0.00% 28 4 0.00% 29 5 0.00% 30 7 0.00% 31 6 0.00% 32 7 0.00% 33 6 0.00% 34 10 0.00% 35 80 0.00% 36 116 0.00% 37 120 0.00% 38 138 0.00% 39 103 0.00% 40 113 0.00% 41 135 0.00% 42 123 0.00% 43 107 0.00% 44 130 0.00% 45 122 0.00% 46 111 0.00% 47 144 0.00% 48 131 0.00% 49 140 0.00% 50 154 0.00% 51 156 0.00% 52 165 0.00% 53 183 0.00% 54 150 0.00% 55 187 0.00% 56 173 0.00% 57 213 0.00% 58 189 0.00% 59 224 0.00% 60 196 0.00% 61 213 0.00% 62 207 0.00% 63 229 0.00% 64 216 0.00% 65 233 0.00% 66 265 0.00% 67 228 0.00% 68 265 0.00% 69 261 0.00% 70 253 0.00% 71 290 0.00% 72 259 0.00% 73 289 0.00% 74 314 0.00% 75 271 0.00% 76 306 0.00% 77 339 0.00% 78 314 0.00% 79 402 0.00% 80 421 0.00% 81 442 0.00% 82 441 0.00% 83 495 0.00% 84 443 0.00% 85 482 0.00% 86 499 0.00% 87 535 0.00% 88 609 0.00% 89 665 0.00% 90 683 0.00% 91 1210 0.01% 92 725 0.00% 93 827 0.00% 94 1431 0.01% 95 4874 0.03% 96 25615 0.14% 97 96486 0.51% 98 362850 1.92% 99 1282711 6.79% 100 4502360 23.85% 101 12585091 66.66% 18878918 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=11 prefix-density=0.32 prefix-fanout=2.0 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGGCCTCCCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=160.16 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=21.3 sequence=CGCCGCCGCCGC Started job on | Dec 06 17:40:48 Started mapping on | Dec 06 17:40:48 Finished on | Dec 06 17:41:09 Mapping speed, Million of reads per hour | 3236.39 Number of input reads | 18878918 Average input read length | 100 UNIQUE READS: Uniquely mapped reads number | 17698510 Uniquely mapped reads % | 93.75% Average mapped length | 100.28 Number of splices: Total | 6788513 Number of splices: Annotated (sjdb) | 6452924 Number of splices: GT/AG | 6698707 Number of splices: GC/AG | 80358 Number of splices: AT/AC | 4050 Number of splices: Non-canonical | 5398 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 576775 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 390393 % of reads mapped to too many loci | 2.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.77% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 603633 603633 603633 N_multimapping 576775 576775 576775 N_noFeature 819303 9335682 8946350 N_ambiguous 268408 15831 18908 UnstrandedReadsAssigned:16610799 PositiveStrandReadsAssigned:8346997 NegativeStrandReadsAssigned:8733252 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=100 echo kmer=95 SRR21853550 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR21853550-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,878,918 reads, 17,148,867 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,308 rounds 52973 SRR21853550.ke.tsv 35125 SRR21853550.se.tsv 88098 total ==> SRR21853550.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 67.0813 7.74625 PNS24249 1928 1829 62.0091 3.69967 PNS24246 1044 945 67.0813 7.74625 PNS24248 1044 945 67.0813 7.74625 PNS24244 1471 1372 43.7471 3.4795 PNS24243 293 194 16 8.99995 KQK14069 1603 1504 1449.24 105.151 KQK14071 474 375 124.972 36.3667 ==> SRR21853550.se.tsv <== BRADI_1g14170v3 1756 BRADI_1g53295v3 121 BRADI_1g59795v3 254 BRADI_1g07683v3 0 BRADI_1g00485v3 97 BRADI_1g20270v3 2402 BRADI_1g74790v3 76 BRADI_1g09890v3 13 BRADI_1g77505v3 249 BRADI_1g48960v3 0 SRR21853550 completed mapping pipeline successfully