Starting /dee2/code/volunteer_pipeline.sh SRR22283132 current disk space = 1550789320704 free memory = 1599716900 SRR22283132 SRAfilesize 99e620e144fd96852d77174248ad9072 SRR22283132.sra SRR22283132.sra file validated SRR22283132 is single end SRR22283132 is conventional basespace SRR22283132 read1 length is 120 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22283132_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 120 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5425 38.0 38.0 38.0 32.0 38.0 2 36.72475 38.0 38.0 38.0 32.0 38.0 3 36.89125 38.0 38.0 38.0 32.0 38.0 4 36.68375 38.0 38.0 38.0 32.0 38.0 5 36.8085 38.0 38.0 38.0 32.0 38.0 6 38.917 40.0 38.0 40.0 38.0 40.0 7 38.8235 40.0 38.0 40.0 38.0 40.0 8 38.88875 40.0 38.0 40.0 38.0 40.0 9 38.9025 40.0 38.0 40.0 38.0 40.0 10-11 38.852875 40.0 38.0 40.0 38.0 40.0 12-13 38.783874999999995 40.0 38.0 40.0 38.0 40.0 14-15 38.582125 40.0 38.0 40.0 38.0 40.0 16-17 38.752875 40.0 38.0 40.0 38.0 40.0 18-19 38.741875 40.0 38.0 40.0 38.0 40.0 20-21 38.76325 40.0 38.0 40.0 38.0 40.0 22-23 38.7685 40.0 38.0 40.0 38.0 40.0 24-25 38.537875 40.0 38.0 40.0 38.0 40.0 26-27 38.599625 40.0 38.0 40.0 38.0 40.0 28-29 38.654625 40.0 38.0 40.0 38.0 40.0 30-31 38.614625000000004 40.0 38.0 40.0 38.0 40.0 32-33 38.552875 40.0 38.0 40.0 38.0 40.0 34-35 38.595875 40.0 38.0 40.0 38.0 40.0 36-37 38.578875 40.0 38.0 40.0 38.0 40.0 38-39 38.484125 40.0 38.0 40.0 38.0 40.0 40-41 38.50325 40.0 38.0 40.0 38.0 40.0 42-43 38.49125 40.0 38.0 40.0 38.0 40.0 44-45 38.366 40.0 38.0 40.0 38.0 40.0 46-47 38.495374999999996 40.0 38.0 40.0 38.0 40.0 48-49 38.102125 40.0 38.0 40.0 38.0 40.0 50-51 38.233000000000004 40.0 38.0 40.0 38.0 40.0 52-53 38.285875 40.0 38.0 40.0 38.0 40.0 54-55 38.2565 40.0 38.0 40.0 38.0 40.0 56-57 38.298875 40.0 38.0 40.0 38.0 40.0 58-59 38.211124999999996 40.0 38.0 40.0 38.0 40.0 60-61 37.49125 39.0 38.0 40.0 32.0 40.0 62-63 38.0715 40.0 38.0 40.0 38.0 40.0 64-65 38.078500000000005 40.0 38.0 40.0 38.0 40.0 66-67 38.13675 40.0 38.0 40.0 38.0 40.0 68-69 38.176249999999996 40.0 38.0 40.0 38.0 40.0 70-71 38.071875 40.0 38.0 40.0 38.0 40.0 72-73 37.918375 40.0 38.0 40.0 38.0 40.0 74-75 37.89975 40.0 38.0 40.0 38.0 40.0 76-77 37.1005 39.0 38.0 40.0 32.0 40.0 78-79 37.41625 38.0 38.0 40.0 32.0 40.0 80-81 37.811625 38.0 38.0 40.0 35.0 40.0 82-83 37.77775 38.0 38.0 40.0 35.0 40.0 84-85 37.781499999999994 38.0 38.0 40.0 35.0 40.0 86-87 37.7065 38.0 38.0 40.0 32.0 40.0 88-89 37.58725 38.0 38.0 40.0 32.0 40.0 90-91 37.61325 38.0 38.0 40.0 32.0 40.0 92-93 37.544250000000005 38.0 38.0 40.0 32.0 40.0 94-95 37.488625 38.0 38.0 40.0 32.0 40.0 96-97 37.272999999999996 38.0 38.0 40.0 32.0 40.0 98-99 37.304375 38.0 38.0 40.0 32.0 40.0 100-101 37.256 38.0 38.0 40.0 32.0 40.0 102-103 35.61325 38.0 35.0 38.0 29.5 38.0 104-105 37.3645 38.0 38.0 40.0 32.0 40.0 106-107 37.896375 39.0 38.0 40.0 38.0 40.0 108-109 37.953 40.0 38.0 40.0 38.0 40.0 110-111 37.976375 40.0 38.0 40.0 38.0 40.0 112-113 37.799 40.0 38.0 40.0 38.0 40.0 114-115 37.335499999999996 38.0 38.0 40.0 32.0 40.0 116-117 37.7525 40.0 38.0 40.0 38.0 40.0 118-119 37.407875000000004 39.0 38.0 40.0 35.0 40.0 120 33.99525 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 1.0 21 3.0 22 6.0 23 2.0 24 3.0 25 10.0 26 11.0 27 12.0 28 19.0 29 41.0 30 36.0 31 56.0 32 51.0 33 83.0 34 113.0 35 136.0 36 174.0 37 289.0 38 767.0 39 2183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.41095890410959 9.74124809741248 4.743784880771182 45.10400811770675 2 21.2 12.975 37.974999999999994 27.85 3 20.75 14.475 24.025 40.75 4 26.474999999999998 23.35 20.424999999999997 29.75 5 25.275 27.250000000000004 24.0 23.474999999999998 6 21.625 30.5 24.725 23.150000000000002 7 17.224999999999998 21.8 39.574999999999996 21.4 8 19.425 20.025000000000002 31.724999999999998 28.825 9 20.775 20.625 31.5 27.1 10-11 24.1125 28.849999999999998 21.3 25.7375 12-13 24.15 21.9 26.3 27.650000000000002 14-15 22.287499999999998 23.6625 26.25 27.800000000000004 16-17 23.6875 23.925 25.85 26.5375 18-19 23.849999999999998 23.2625 25.074999999999996 27.8125 20-21 24.9375 23.425 25.75 25.887500000000003 22-23 24.212500000000002 24.5625 24.875 26.35 24-25 24.2625 23.6625 25.2625 26.8125 26-27 23.724999999999998 24.087500000000002 24.775 27.4125 28-29 23.9125 23.275000000000002 25.7375 27.075 30-31 22.95 22.8875 25.4 28.762500000000003 32-33 24.375 22.75 25.6 27.275 34-35 23.7 23.75 25.662499999999998 26.887499999999996 36-37 23.9375 24.1625 25.025 26.875 38-39 23.0875 23.525 25.900000000000002 27.487499999999997 40-41 24.75 24.425 25.324999999999996 25.5 42-43 24.625 23.35 25.05 26.974999999999998 44-45 24.125 23.9 25.8125 26.1625 46-47 23.6625 23.35 25.650000000000002 27.3375 48-49 23.525 23.5625 24.975 27.9375 50-51 23.5875 23.0125 25.662499999999998 27.737499999999997 52-53 24.7375 24.1375 24.65 26.474999999999998 54-55 23.4625 23.5375 26.0375 26.9625 56-57 23.425 23.4875 25.4 27.6875 58-59 23.4375 23.9125 25.575 27.075 60-61 23.6375 23.7125 25.224999999999998 27.425 62-63 22.85 24.0125 26.174999999999997 26.9625 64-65 24.337500000000002 23.5375 25.4625 26.6625 66-67 23.7 23.5 25.3 27.500000000000004 68-69 24.075 24.3125 25.174999999999997 26.437500000000004 70-71 24.6 24.075 24.8 26.525 72-73 23.9875 23.6875 24.337500000000002 27.987499999999997 74-75 24.425 23.8625 25.2125 26.5 76-77 24.762500000000003 23.974999999999998 25.0125 26.25 78-79 24.45 23.3 24.5625 27.6875 80-81 23.6875 24.325 24.9375 27.05 82-83 24.337500000000002 23.925 25.337500000000002 26.400000000000002 84-85 23.575 23.1 24.2875 29.037499999999998 86-87 24.6875 23.4625 24.5125 27.3375 88-89 24.6125 23.7 24.8125 26.875 90-91 24.099999999999998 23.3375 24.9 27.6625 92-93 24.462500000000002 23.9 24.6125 27.025 94-95 24.4125 23.962500000000002 24.975 26.650000000000002 96-97 24.4375 24.1125 23.6375 27.8125 98-99 23.6375 23.6375 25.6125 27.1125 100-101 23.9875 23.2625 25.4 27.35 102-103 24.025 23.674999999999997 23.775 28.525 104-105 24.0375 23.724999999999998 25.05 27.187499999999996 106-107 25.124999999999996 23.962500000000002 23.849999999999998 27.0625 108-109 24.725 23.075000000000003 25.3125 26.887499999999996 110-111 23.8625 24.1625 24.925 27.05 112-113 23.5 25.025 25.137500000000003 26.337500000000002 114-115 24.75 23.825 23.5 27.925 116-117 23.95 24.925 24.349999999999998 26.775 118-119 24.349999999999998 24.3125 25.025 26.3125 120 23.799999999999997 23.400000000000002 25.525 27.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.5 29 1.5 30 3.5 31 6.0 32 12.0 33 17.5 34 20.0 35 25.0 36 31.5 37 48.0 38 57.5 39 57.5 40 75.5 41 99.5 42 125.0 43 135.5 44 145.0 45 149.5 46 148.5 47 155.5 48 165.0 49 183.0 50 191.0 51 174.0 52 138.0 53 146.5 54 169.5 55 177.5 56 182.5 57 163.5 58 138.0 59 121.0 60 101.5 61 87.0 62 78.0 63 72.5 64 66.0 65 53.5 66 48.0 67 50.5 68 42.5 69 26.5 70 24.5 71 22.5 72 17.5 73 12.5 74 10.0 75 9.0 76 5.5 77 3.5 78 2.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 120 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.45 #Duplication Level Percentage of deduplicated Percentage of total 1 94.07787993510006 86.97500000000001 2 4.597079502433748 8.5 3 0.7301243915630071 2.025 4 0.40562466197944835 1.5 5 0.1352082206598161 0.625 6 0.027041644131963225 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027041644131963225 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 9 0.22499999999999998 No Hit GGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCGATTAGTCTTTCGC 6 0.15 No Hit GGTCGTTCGAGCTTTTCCTGGGAGTATGGCATCGGTTACATACTTCAGTG 5 0.125 No Hit CTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCC 5 0.125 No Hit CCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGATTACTAGCGATTC 5 0.125 No Hit GTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTC 5 0.125 No Hit CATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCTTTTATCTAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.6499999999999999 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.2875 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.7125 0.0 0.0 0.0 0.0 106-107 3.3 0.0 0.0 0.0 0.0 108 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099872 READS because READLEN < 1 Read 1099872 spots for SRR22283132.sra Written 1099872 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra Rejected 1099865 READS because READLEN < 1 Read 1099865 spots for SRR22283132.sra Written 1099865 spots for SRR22283132.sra SRR ids: ['SRR22283132.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i135wmh8 SRR22283132.sra spots: 21997307 blocks: [[1, 1099865], [1099866, 2199730], [2199731, 3299595], [3299596, 4399460], [4399461, 5499325], [5499326, 6599190], [6599191, 7699055], [7699056, 8798920], [8798921, 9898785], [9898786, 10998650], [10998651, 12098515], [12098516, 13198380], [13198381, 14298245], [14298246, 15398110], [15398111, 16497975], [16497976, 17597840], [17597841, 18697705], [18697706, 19797570], [19797571, 20897435], [20897436, 21997307]] SRR22283132 file size 6122078 SRR22283132 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22283132 SRR22283132_1.fastq Input file: SRR22283132_1.fastq trimmed: SRR22283132-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:51:42 2024 >> started Fri Dec 6 13:51:52 2024 >> done (10.528s) 21997307 reads processed; of these: 1338 ( 0.01%) short reads filtered out after trimming by size control 3544 ( 0.02%) empty reads filtered out after trimming by size control 21992425 (99.98%) reads available; of these: 2343344 (10.66%) trimmed reads available after processing 19649081 (89.34%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 179 0.00% 19 205 0.00% 20 233 0.00% 21 267 0.00% 22 329 0.00% 23 460 0.00% 24 498 0.00% 25 639 0.00% 26 901 0.00% 27 649 0.00% 28 496 0.00% 29 588 0.00% 30 573 0.00% 31 627 0.00% 32 668 0.00% 33 654 0.00% 34 720 0.00% 35 704 0.00% 36 837 0.00% 37 931 0.00% 38 844 0.00% 39 879 0.00% 40 860 0.00% 41 860 0.00% 42 807 0.00% 43 839 0.00% 44 899 0.00% 45 895 0.00% 46 901 0.00% 47 966 0.00% 48 988 0.00% 49 1082 0.00% 50 1078 0.00% 51 1182 0.01% 52 1197 0.01% 53 1180 0.01% 54 1265 0.01% 55 1427 0.01% 56 1449 0.01% 57 1510 0.01% 58 1546 0.01% 59 1712 0.01% 60 1787 0.01% 61 1989 0.01% 62 2020 0.01% 63 2227 0.01% 64 2537 0.01% 65 2608 0.01% 66 2611 0.01% 67 3079 0.01% 68 3253 0.01% 69 3507 0.02% 70 3653 0.02% 71 4093 0.02% 72 4601 0.02% 73 5008 0.02% 74 5401 0.02% 75 5637 0.03% 76 6414 0.03% 77 6767 0.03% 78 7229 0.03% 79 8512 0.04% 80 8956 0.04% 81 9741 0.04% 82 10904 0.05% 83 11927 0.05% 84 13025 0.06% 85 14634 0.07% 86 16217 0.07% 87 16932 0.08% 88 18635 0.08% 89 2639 0.01% 90 2794 0.01% 91 2959 0.01% 92 3139 0.01% 93 3439 0.02% 94 3327 0.02% 95 3645 0.02% 96 3689 0.02% 97 4008 0.02% 98 4193 0.02% 99 4560 0.02% 100 5290 0.02% 101 5901 0.03% 102 2235 0.01% 103 3423 0.02% 104 4485 0.02% 105 5773 0.03% 106 7140 0.03% 107 9088 0.04% 108 11024 0.05% 109 13245 0.06% 110 15787 0.07% 111 20046 0.09% 112 24453 0.11% 113 31535 0.14% 114 41908 0.19% 115 57733 0.26% 116 84547 0.38% 117 127500 0.58% 118 281307 1.28% 119 1313104 5.97% 120 19649081 89.34% 21992425 reads passed initial QC criterion=sequence-density sequence-density=3.50 sequence-density-rank=1 fanout-score=57.26 fanout-score-rank=1 prefix-density=4.61 prefix-fanout=43.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=3.50 sequence-density-rank=1 fanout-score=57.26 fanout-score-rank=1 prefix-density=4.61 prefix-fanout=43.5 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR22283132 - Input file: STDIN trimmed: SRR22283132-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:53:13 2024 >> started Fri Dec 6 13:53:26 2024 >> done (13.609s) 10996213 reads processed; of these: 6 ( 0.00%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 10996202 (100.00%) reads available; of these: 1092839 ( 9.94%) trimmed reads available after processing 9903363 (90.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 90 0.00% 19 98 0.00% 20 105 0.00% 21 135 0.00% 22 160 0.00% 23 218 0.00% 24 260 0.00% 25 309 0.00% 26 387 0.00% 27 313 0.00% 28 237 0.00% 29 279 0.00% 30 305 0.00% 31 323 0.00% 32 325 0.00% 33 346 0.00% 34 360 0.00% 35 354 0.00% 36 426 0.00% 37 434 0.00% 38 434 0.00% 39 452 0.00% 40 422 0.00% 41 427 0.00% 42 410 0.00% 43 428 0.00% 44 472 0.00% 45 417 0.00% 46 448 0.00% 47 502 0.00% 48 482 0.00% 49 574 0.01% 50 542 0.00% 51 596 0.01% 52 604 0.01% 53 589 0.01% 54 637 0.01% 55 724 0.01% 56 748 0.01% 57 776 0.01% 58 796 0.01% 59 859 0.01% 60 887 0.01% 61 970 0.01% 62 993 0.01% 63 1107 0.01% 64 1294 0.01% 65 1262 0.01% 66 1279 0.01% 67 1587 0.01% 68 1647 0.01% 69 1810 0.02% 70 1827 0.02% 71 2073 0.02% 72 2288 0.02% 73 2528 0.02% 74 2732 0.02% 75 2814 0.03% 76 3224 0.03% 77 3311 0.03% 78 3690 0.03% 79 4223 0.04% 80 4536 0.04% 81 4981 0.05% 82 5507 0.05% 83 5929 0.05% 84 6600 0.06% 85 7302 0.07% 86 8073 0.07% 87 8419 0.08% 88 9497 0.09% 89 10049 0.09% 90 11203 0.10% 91 12332 0.11% 92 13824 0.13% 93 14929 0.14% 94 16233 0.15% 95 17740 0.16% 96 19064 0.17% 97 21100 0.19% 98 22738 0.21% 99 24274 0.22% 100 26504 0.24% 101 28201 0.26% 102 28454 0.26% 103 30772 0.28% 104 33073 0.30% 105 34694 0.32% 106 38175 0.35% 107 41604 0.38% 108 44509 0.40% 109 49117 0.45% 110 51871 0.47% 111 55712 0.51% 112 61061 0.56% 113 64818 0.59% 114 76338 0.69% 115 97958 0.89% 116 136532 1.24% 117 245418 2.23% 118 127890 1.16% 119 593299 5.40% 120 8826523 80.27% criterion=sequence-density sequence-density=1.37 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=24 prefix-density=1.37 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.20 sequence-density-rank=26 fanout-score=5.72 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=2.0 sequence=CATGCACCACCACCCATAGAATCAAGAAAGAGCTCTCAGTCTGTCAATCCTTGCTATGTCTGGACCTGGTAAGTTTCCCCGTGTTG Started job on | Dec 06 13:53:54 Started mapping on | Dec 06 13:53:54 Finished on | Dec 06 13:54:28 Mapping speed, Million of reads per hour | 2328.61 Number of input reads | 21992414 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 14629983 Uniquely mapped reads % | 66.52% Average mapped length | 117.97 Number of splices: Total | 5463956 Number of splices: Annotated (sjdb) | 5156477 Number of splices: GT/AG | 5375641 Number of splices: GC/AG | 68316 Number of splices: AT/AC | 1886 Number of splices: Non-canonical | 18113 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.02% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3844624 % of reads mapped to multiple loci | 17.48% Number of reads mapped to too many loci | 3086545 % of reads mapped to too many loci | 14.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 1.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3517807 3517807 3517807 N_multimapping 3844624 3844624 3844624 N_noFeature 1187674 14256692 1281853 N_ambiguous 313425 954 35311 UnstrandedReadsAssigned:13128884 PositiveStrandReadsAssigned:372337 NegativeStrandReadsAssigned:13312819 Dataset is classified negative stranded MeadianReadLen=120 20thPercentileLength=120 echo kmer=115 SRR22283132 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR22283132-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,992,414 reads, 13,851,372 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR22283132.ke.tsv 35125 SRR22283132.se.tsv 88098 total ==> SRR22283132.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.18651 0.950121 PNS24247 1044 945 36.9084 4.32195 PNS24249 1928 1829 41.5202 2.51207 PNS24246 1044 945 36.9084 4.32195 PNS24248 1044 945 36.9084 4.32195 PNS24244 1471 1372 99.568 8.03067 PNS24243 293 194 0 0 KQK14069 1603 1504 3522.92 259.204 KQK14071 474 375 496.15 146.409 ==> SRR22283132.se.tsv <== BRADI_1g14170v3 4482 BRADI_1g53295v3 817 BRADI_1g59795v3 155 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 215 BRADI_1g74790v3 99 BRADI_1g09890v3 0 BRADI_1g77505v3 258 BRADI_1g48960v3 0 SRR22283132 completed mapping pipeline successfully