Starting /dee2/code/volunteer_pipeline.sh SRR22283133 current disk space = 1550787047424 free memory = 1350014096 SRR22283133 SRAfilesize ba80e227baace1237bdf0bc7bd681a19 SRR22283133.sra SRR22283133.sra file validated SRR22283133 is single end SRR22283133 is conventional basespace SRR22283133 read1 length is 120 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22283133_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 120 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.48925 38.0 38.0 38.0 32.0 38.0 2 36.7435 38.0 38.0 38.0 32.0 38.0 3 36.8 38.0 38.0 38.0 32.0 38.0 4 36.57 38.0 38.0 38.0 32.0 38.0 5 36.7695 38.0 38.0 38.0 32.0 38.0 6 38.815 40.0 38.0 40.0 38.0 40.0 7 38.91025 40.0 38.0 40.0 38.0 40.0 8 38.96125 40.0 38.0 40.0 38.0 40.0 9 38.9065 40.0 38.0 40.0 38.0 40.0 10-11 38.7615 40.0 38.0 40.0 38.0 40.0 12-13 38.7485 40.0 38.0 40.0 38.0 40.0 14-15 38.58025000000001 40.0 38.0 40.0 38.0 40.0 16-17 38.71 40.0 38.0 40.0 38.0 40.0 18-19 38.7925 40.0 38.0 40.0 38.0 40.0 20-21 38.767125 40.0 38.0 40.0 38.0 40.0 22-23 38.788875 40.0 38.0 40.0 38.0 40.0 24-25 38.564750000000004 40.0 38.0 40.0 38.0 40.0 26-27 38.584375 40.0 38.0 40.0 38.0 40.0 28-29 38.65325 40.0 38.0 40.0 38.0 40.0 30-31 38.614625000000004 40.0 38.0 40.0 38.0 40.0 32-33 38.564625 40.0 38.0 40.0 38.0 40.0 34-35 38.546375 40.0 38.0 40.0 38.0 40.0 36-37 38.506875 40.0 38.0 40.0 38.0 40.0 38-39 38.506375 40.0 38.0 40.0 38.0 40.0 40-41 38.522125 40.0 38.0 40.0 38.0 40.0 42-43 38.573499999999996 40.0 38.0 40.0 38.0 40.0 44-45 38.332375 40.0 38.0 40.0 38.0 40.0 46-47 38.43025 40.0 38.0 40.0 38.0 40.0 48-49 38.052625 40.0 38.0 40.0 38.0 40.0 50-51 38.23025 40.0 38.0 40.0 38.0 40.0 52-53 38.246750000000006 40.0 38.0 40.0 38.0 40.0 54-55 38.24375 40.0 38.0 40.0 38.0 40.0 56-57 38.297 40.0 38.0 40.0 38.0 40.0 58-59 38.245625000000004 40.0 38.0 40.0 38.0 40.0 60-61 37.344125 38.0 38.0 40.0 32.0 40.0 62-63 38.025375 40.0 38.0 40.0 38.0 40.0 64-65 38.079375 40.0 38.0 40.0 38.0 40.0 66-67 38.142875000000004 40.0 38.0 40.0 38.0 40.0 68-69 38.1825 40.0 38.0 40.0 38.0 40.0 70-71 38.123625000000004 40.0 38.0 40.0 38.0 40.0 72-73 37.983125 40.0 38.0 40.0 35.0 40.0 74-75 37.870000000000005 40.0 38.0 40.0 38.0 40.0 76-77 36.9435 39.0 38.0 40.0 32.5 40.0 78-79 37.29175 38.0 38.0 40.0 32.0 40.0 80-81 37.6735 38.0 38.0 40.0 32.0 40.0 82-83 37.69775 38.0 38.0 40.0 32.0 40.0 84-85 37.70675 40.0 38.0 40.0 32.0 40.0 86-87 37.544375 38.0 38.0 40.0 32.0 40.0 88-89 37.516000000000005 38.0 38.0 40.0 32.0 40.0 90-91 37.633875 38.0 38.0 40.0 32.0 40.0 92-93 37.532125 38.0 38.0 40.0 32.0 40.0 94-95 37.443875 38.0 38.0 40.0 32.0 40.0 96-97 37.184749999999994 38.0 38.0 40.0 32.0 40.0 98-99 37.292375 38.0 38.0 40.0 32.0 40.0 100-101 37.25775 38.0 38.0 40.0 32.0 40.0 102-103 35.619625 38.0 35.0 38.0 29.5 38.0 104-105 37.289125 38.0 38.0 40.0 32.0 40.0 106-107 37.8795 40.0 38.0 40.0 38.0 40.0 108-109 37.84925 40.0 38.0 40.0 38.0 40.0 110-111 37.89775 40.0 38.0 40.0 38.0 40.0 112-113 37.72425 40.0 38.0 40.0 35.0 40.0 114-115 37.058125 38.0 38.0 40.0 32.0 40.0 116-117 37.575625 39.0 38.0 40.0 38.0 40.0 118-119 37.410125 38.0 38.0 40.0 38.0 40.0 120 33.90275 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 2.0 15 0.0 16 0.0 17 2.0 18 1.0 19 0.0 20 5.0 21 0.0 22 1.0 23 3.0 24 5.0 25 7.0 26 11.0 27 15.0 28 22.0 29 29.0 30 39.0 31 67.0 32 62.0 33 87.0 34 97.0 35 141.0 36 170.0 37 333.0 38 774.0 39 2125.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.58559472482881 10.32208977935582 4.133908191732184 47.95840730408318 2 20.375 10.925 37.425000000000004 31.275 3 18.175 11.975 25.275 44.574999999999996 4 27.375 17.875 21.5 33.25 5 27.625 24.65 24.625 23.1 6 23.674999999999997 27.075 24.625 24.625 7 19.675 21.05 37.2 22.075 8 19.25 19.725 32.275 28.749999999999996 9 20.375 19.900000000000002 33.95 25.775 10-11 24.5125 26.5 22.2625 26.724999999999998 12-13 23.5375 20.5 26.5125 29.45 14-15 23.6875 21.85 26.450000000000003 28.012500000000003 16-17 24.3875 20.8 24.825 29.9875 18-19 23.4125 23.125 24.1125 29.349999999999998 20-21 23.799999999999997 23.125 25.587500000000002 27.487499999999997 22-23 23.825 22.8 25.275 28.1 24-25 24.325 22.5 24.637500000000003 28.537499999999998 26-27 23.25 22.2125 26.2875 28.249999999999996 28-29 23.674999999999997 21.825 25.25 29.25 30-31 23.4375 21.075 25.55 29.9375 32-33 24.1625 22.412499999999998 25.2375 28.1875 34-35 23.5375 22.6 24.85 29.012500000000003 36-37 23.9125 22.4875 24.825 28.775000000000002 38-39 23.025000000000002 22.3 25.674999999999997 28.999999999999996 40-41 24.7375 22.1375 24.15 28.975 42-43 25.224999999999998 23.525 22.4875 28.762500000000003 44-45 24.3625 21.975 26.1125 27.55 46-47 23.7125 23.0 25.324999999999996 27.962500000000002 48-49 23.849999999999998 22.2125 24.9375 28.999999999999996 50-51 22.8375 22.35 25.2875 29.525000000000002 52-53 23.125 22.2625 25.4625 29.15 54-55 24.45 23.400000000000002 25.087500000000002 27.0625 56-57 23.5375 21.9 25.687500000000004 28.875 58-59 23.1375 23.3 24.762500000000003 28.799999999999997 60-61 24.725 22.5625 24.85 27.8625 62-63 23.8625 21.587500000000002 25.724999999999998 28.825 64-65 23.1 21.475 25.9625 29.462500000000002 66-67 24.375 22.537499999999998 24.175 28.9125 68-69 24.337500000000002 21.9625 25.25 28.449999999999996 70-71 24.275 22.45 24.6125 28.6625 72-73 25.5375 22.0625 24.224999999999998 28.175 74-75 24.65 22.537499999999998 25.074999999999996 27.737499999999997 76-77 25.0625 22.4625 24.4 28.075 78-79 24.55 23.1125 23.799999999999997 28.537499999999998 80-81 24.1625 22.2 24.5 29.1375 82-83 25.025 21.675 24.5625 28.7375 84-85 24.4875 21.912499999999998 23.974999999999998 29.625 86-87 25.1875 22.037499999999998 24.425 28.349999999999998 88-89 24.1875 21.6 25.025 29.1875 90-91 24.8 21.725 23.3875 30.0875 92-93 25.0625 21.087500000000002 24.675 29.175 94-95 25.15 21.9625 25.05 27.8375 96-97 23.95 22.825 23.7375 29.4875 98-99 24.337500000000002 22.075 24.575 29.012500000000003 100-101 24.099999999999998 22.3375 24.95 28.6125 102-103 25.2625 23.6125 23.7625 27.3625 104-105 24.3125 22.237499999999997 24.224999999999998 29.225 106-107 24.587500000000002 22.8625 23.9 28.65 108-109 25.2875 22.425 24.45 27.8375 110-111 24.4125 22.875 24.4 28.3125 112-113 25.6 23.4125 23.425 27.5625 114-115 25.1 23.2375 23.525 28.1375 116-117 26.1125 23.5625 22.9875 27.3375 118-119 24.212500000000002 23.9 23.0625 28.825 120 24.625 24.474999999999998 22.575 28.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 0.5 29 0.0 30 0.5 31 2.5 32 5.0 33 5.0 34 6.0 35 10.5 36 19.5 37 30.5 38 33.5 39 32.5 40 47.5 41 69.0 42 81.0 43 97.0 44 113.0 45 116.5 46 131.0 47 160.5 48 168.0 49 177.5 50 192.5 51 170.5 52 165.0 53 185.0 54 186.5 55 199.5 56 224.0 57 200.0 58 160.5 59 139.5 60 110.5 61 92.5 62 83.0 63 94.5 64 90.5 65 63.5 66 53.5 67 47.0 68 46.0 69 39.5 70 30.0 71 29.0 72 26.5 73 15.5 74 8.0 75 13.5 76 13.0 77 6.5 78 4.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 120 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.425 #Duplication Level Percentage of deduplicated Percentage of total 1 88.83624518803673 75.0 2 7.0772875333135925 11.95 3 2.368966538347646 6.0 4 1.036422860527095 3.5000000000000004 5 0.3553449807521469 1.5 6 0.11844832691738229 0.6 7 0.059224163458691144 0.35000000000000003 8 0.08883624518803672 0.6 9 0.029612081729345572 0.22499999999999998 >10 0.029612081729345572 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGGGGCAGGCGGCGGGCGCAGGCGCCGCTTGCTAGCTTGGATTCTGAC 11 0.27499999999999997 No Hit CCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGA 9 0.22499999999999998 No Hit CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 8 0.2 No Hit ATCGCTTCGAGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGC 8 0.2 No Hit CTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACAC 8 0.2 No Hit GTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCAC 7 0.17500000000000002 No Hit GTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC 7 0.17500000000000002 No Hit CTCAGAGCCAATCCTTTTCCCGAAGTTACGGATCCGTTTTGCCGACTTCC 6 0.15 No Hit CTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCAAAGACTTT 6 0.15 No Hit GTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTC 6 0.15 No Hit GTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCC 6 0.15 No Hit CTCAGGCATAGTTCACCATCTTTCGGGTCCCGACAGGCGTGCTCCAACTC 5 0.125 No Hit CTCCTACTCATCGGGGCATGGCGCTCGCCCAGATGGCCGGGTGTGGGTCG 5 0.125 No Hit CTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCA 5 0.125 No Hit CCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGC 5 0.125 No Hit CCCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACC 5 0.125 No Hit CCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTT 5 0.125 No Hit CCCGAAGTTACGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCA 5 0.125 No Hit CTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACT 5 0.125 No Hit CTTTTATCTAATAAATGCGCCCCTCCCAGAAGTCGGGGTTTGTTGCACGT 5 0.125 No Hit GTTCTATTTCACTACCCACTGGGGGTTCTTTTCACCTTTCCCTCACGGTA 5 0.125 No Hit CCGCTGATTCCGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGT 5 0.125 No Hit CTTGTCCGTACCAGTTCTGAGTCGACTGTTCAGCGCTCGGGGAAAGCCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2875 0.0 0.0 0.0 0.0 96-97 1.525 0.0 0.0 0.0 0.0 98-99 1.8875000000000002 0.0 0.0 0.0 0.0 100-101 2.325 0.0 0.0 0.0 0.0 102-103 2.825 0.0 0.0 0.0 0.0 104-105 3.35 0.0 0.0 0.0 0.0 106-107 3.9000000000000004 0.0 0.0 0.0 0.0 108 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889713 READS because READLEN < 1 Read 889713 spots for SRR22283133.sra Written 889713 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra Rejected 889704 READS because READLEN < 1 Read 889704 spots for SRR22283133.sra Written 889704 spots for SRR22283133.sra SRR ids: ['SRR22283133.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6do5znn6 SRR22283133.sra spots: 17794089 blocks: [[1, 889704], [889705, 1779408], [1779409, 2669112], [2669113, 3558816], [3558817, 4448520], [4448521, 5338224], [5338225, 6227928], [6227929, 7117632], [7117633, 8007336], [8007337, 8897040], [8897041, 9786744], [9786745, 10676448], [10676449, 11566152], [11566153, 12455856], [12455857, 13345560], [13345561, 14235264], [14235265, 15124968], [15124969, 16014672], [16014673, 16904376], [16904377, 17794089]] SRR22283133 file size 4948133 SRR22283133 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22283133 SRR22283133_1.fastq Input file: SRR22283133_1.fastq trimmed: SRR22283133-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:51:31 2024 >> started Fri Dec 6 13:51:40 2024 >> done (9.288s) 17794089 reads processed; of these: 992 ( 0.01%) short reads filtered out after trimming by size control 3930 ( 0.02%) empty reads filtered out after trimming by size control 17789167 (99.97%) reads available; of these: 1918762 (10.79%) trimmed reads available after processing 15870405 (89.21%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 135 0.00% 19 166 0.00% 20 189 0.00% 21 179 0.00% 22 278 0.00% 23 349 0.00% 24 416 0.00% 25 544 0.00% 26 772 0.00% 27 503 0.00% 28 399 0.00% 29 508 0.00% 30 411 0.00% 31 470 0.00% 32 539 0.00% 33 507 0.00% 34 506 0.00% 35 589 0.00% 36 656 0.00% 37 726 0.00% 38 641 0.00% 39 654 0.00% 40 633 0.00% 41 664 0.00% 42 648 0.00% 43 648 0.00% 44 669 0.00% 45 634 0.00% 46 639 0.00% 47 667 0.00% 48 797 0.00% 49 792 0.00% 50 789 0.00% 51 820 0.00% 52 867 0.00% 53 854 0.00% 54 940 0.01% 55 980 0.01% 56 982 0.01% 57 1129 0.01% 58 1099 0.01% 59 1117 0.01% 60 1323 0.01% 61 1384 0.01% 62 1481 0.01% 63 1561 0.01% 64 1688 0.01% 65 1800 0.01% 66 1918 0.01% 67 2266 0.01% 68 2282 0.01% 69 2520 0.01% 70 2572 0.01% 71 2897 0.02% 72 3323 0.02% 73 3722 0.02% 74 3909 0.02% 75 4139 0.02% 76 4779 0.03% 77 4956 0.03% 78 5497 0.03% 79 6276 0.04% 80 6669 0.04% 81 7666 0.04% 82 8461 0.05% 83 8837 0.05% 84 9702 0.05% 85 11322 0.06% 86 12297 0.07% 87 13193 0.07% 88 14472 0.08% 89 2095 0.01% 90 2209 0.01% 91 2374 0.01% 92 2403 0.01% 93 2644 0.01% 94 2663 0.01% 95 2823 0.02% 96 3040 0.02% 97 3178 0.02% 98 3294 0.02% 99 3799 0.02% 100 4161 0.02% 101 4850 0.03% 102 1791 0.01% 103 2719 0.02% 104 3696 0.02% 105 4535 0.03% 106 5869 0.03% 107 7520 0.04% 108 9045 0.05% 109 10884 0.06% 110 13170 0.07% 111 16622 0.09% 112 20425 0.11% 113 26188 0.15% 114 35009 0.20% 115 47674 0.27% 116 70181 0.39% 117 104829 0.59% 118 231830 1.30% 119 1087825 6.12% 120 15870405 89.21% 17789167 reads passed initial QC criterion=sequence-density sequence-density=3.61 sequence-density-rank=1 fanout-score=56.89 fanout-score-rank=1 prefix-density=4.78 prefix-fanout=42.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=3.61 sequence-density-rank=1 fanout-score=56.89 fanout-score-rank=1 prefix-density=4.78 prefix-fanout=42.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR22283133 - Input file: STDIN trimmed: SRR22283133-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 13:53:09 2024 >> started Fri Dec 6 13:53:26 2024 >> done (17.050s) 8894584 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 2 ( 0.00%) empty reads filtered out after trimming by size control 8894577 (100.00%) reads available; of these: 897613 (10.09%) trimmed reads available after processing 7996964 (89.91%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 73 0.00% 19 76 0.00% 20 85 0.00% 21 91 0.00% 22 147 0.00% 23 197 0.00% 24 222 0.00% 25 278 0.00% 26 389 0.00% 27 270 0.00% 28 204 0.00% 29 250 0.00% 30 208 0.00% 31 227 0.00% 32 249 0.00% 33 246 0.00% 34 238 0.00% 35 298 0.00% 36 331 0.00% 37 373 0.00% 38 322 0.00% 39 325 0.00% 40 319 0.00% 41 331 0.00% 42 327 0.00% 43 325 0.00% 44 323 0.00% 45 329 0.00% 46 309 0.00% 47 349 0.00% 48 419 0.00% 49 393 0.00% 50 383 0.00% 51 436 0.00% 52 452 0.01% 53 412 0.00% 54 464 0.01% 55 490 0.01% 56 483 0.01% 57 559 0.01% 58 528 0.01% 59 561 0.01% 60 678 0.01% 61 691 0.01% 62 765 0.01% 63 765 0.01% 64 837 0.01% 65 912 0.01% 66 976 0.01% 67 1151 0.01% 68 1152 0.01% 69 1282 0.01% 70 1311 0.01% 71 1461 0.02% 72 1654 0.02% 73 1876 0.02% 74 1963 0.02% 75 2092 0.02% 76 2440 0.03% 77 2463 0.03% 78 2751 0.03% 79 3139 0.04% 80 3380 0.04% 81 3862 0.04% 82 4238 0.05% 83 4400 0.05% 84 4942 0.06% 85 5672 0.06% 86 6142 0.07% 87 6643 0.07% 88 7367 0.08% 89 8083 0.09% 90 8593 0.10% 91 9294 0.10% 92 10684 0.12% 93 11734 0.13% 94 12808 0.14% 95 14238 0.16% 96 15501 0.17% 97 17256 0.19% 98 18904 0.21% 99 20038 0.23% 100 21940 0.25% 101 23400 0.26% 102 23456 0.26% 103 26101 0.29% 104 27953 0.31% 105 28982 0.33% 106 32330 0.36% 107 35468 0.40% 108 37445 0.42% 109 41791 0.47% 110 43839 0.49% 111 48476 0.55% 112 53529 0.60% 113 55258 0.62% 114 65242 0.73% 115 80874 0.91% 116 110179 1.24% 117 187197 2.10% 118 104315 1.17% 119 487677 5.48% 120 7121696 80.07% criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=27 prefix-density=0.92 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=84.97 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=1.0 sequence=CTCGCTTTCTTTTCTTCAAAAATTCTTATATGTTAGCGGAAAAACCTTATCCATTAATAGCGGGAACTTCAAGAGCAGCTAGATCTAGAGGGAAGTTGTGAGCATTACGTTCGTGCATTACTTCCATACCAAGATTAGCACGGTTGATGATATCAGCCCAAGTATTAATAACGCGACCTTGACTATCAACTACAGATTGGTTGAAATTGAATCCATTTAGGTTGAACGCCATAGTACTAATACCTAAAGCAGTGAACCAGATTCCTACTACAGGCCAAGCAGCCAAGAAGAAGTGTAAAGAACGAGAGTTGTTGAAACTAGCATATTGGAAGATTAATCGGCCAAAATAACCATGAGCAGCCACAATATTATAAGTCTCTTCCTCTTGACCAAATTTGTAACCCTCATTAGCAGATTCATTTTCAGTAGTTTCCCTGATCAAACTAGAGGTTACCAAGGAACCATGCATAGCACTGAATAGGGAACCGCCGAAAACACCAGCTACACCTAA Started job on | Dec 06 13:54:06 Started mapping on | Dec 06 13:54:06 Finished on | Dec 06 13:54:45 Mapping speed, Million of reads per hour | 1642.08 Number of input reads | 17789160 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 8161589 Uniquely mapped reads % | 45.88% Average mapped length | 117.95 Number of splices: Total | 3006606 Number of splices: Annotated (sjdb) | 2840846 Number of splices: GT/AG | 2960270 Number of splices: GC/AG | 36026 Number of splices: AT/AC | 1342 Number of splices: Non-canonical | 8968 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3231909 % of reads mapped to multiple loci | 18.17% Number of reads mapped to too many loci | 5746928 % of reads mapped to too many loci | 32.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.78% % of reads unmapped: other | 2.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6395662 6395662 6395662 N_multimapping 3231909 3231909 3231909 N_noFeature 804094 7951369 864409 N_ambiguous 169221 782 19429 UnstrandedReadsAssigned:7188274 PositiveStrandReadsAssigned:209438 NegativeStrandReadsAssigned:7277751 Dataset is classified negative stranded MeadianReadLen=120 20thPercentileLength=119 echo kmer=115 SRR22283133 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR22283133-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,789,160 reads, 7,673,531 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52973 SRR22283133.ke.tsv 35125 SRR22283133.se.tsv 88098 total ==> SRR22283133.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 91.8608 20.83 PNS24247 1044 945 16.007 3.21485 PNS24249 1928 1829 60.0328 6.22959 PNS24246 1044 945 16.007 3.21485 PNS24248 1044 945 16.007 3.21485 PNS24244 1471 1372 28.0855 3.8852 PNS24243 293 194 0 0 KQK14069 1603 1504 2539.76 320.5 KQK14071 474 375 400.365 202.633 ==> SRR22283133.se.tsv <== BRADI_1g14170v3 3361 BRADI_1g53295v3 274 BRADI_1g59795v3 34 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 325 BRADI_1g74790v3 165 BRADI_1g09890v3 0 BRADI_1g77505v3 128 BRADI_1g48960v3 0 SRR22283133 completed mapping pipeline successfully