Starting /dee2/code/volunteer_pipeline.sh SRR22283134 current disk space = 1550637895680 free memory = 1349217988 SRR22283134 SRAfilesize 1b45ee8a3ff7b08c43eae36ed80c3a91 SRR22283134.sra SRR22283134.sra file validated SRR22283134 is single end SRR22283134 is conventional basespace SRR22283134 read1 length is 120 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22283134_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 120 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.51725 38.0 38.0 38.0 32.0 38.0 2 36.65325 38.0 38.0 38.0 32.0 38.0 3 36.8905 38.0 38.0 38.0 32.0 38.0 4 36.697 38.0 38.0 38.0 32.0 38.0 5 36.834 38.0 38.0 38.0 32.0 38.0 6 38.9455 40.0 38.0 40.0 38.0 40.0 7 38.98475 40.0 38.0 40.0 38.0 40.0 8 38.958 40.0 38.0 40.0 38.0 40.0 9 38.86225 40.0 38.0 40.0 38.0 40.0 10-11 38.81375 40.0 38.0 40.0 38.0 40.0 12-13 38.861374999999995 40.0 38.0 40.0 38.0 40.0 14-15 38.628625 40.0 38.0 40.0 38.0 40.0 16-17 38.775875 40.0 38.0 40.0 38.0 40.0 18-19 38.768375000000006 40.0 38.0 40.0 38.0 40.0 20-21 38.714625 40.0 38.0 40.0 38.0 40.0 22-23 38.736999999999995 40.0 38.0 40.0 38.0 40.0 24-25 38.506625 40.0 38.0 40.0 38.0 40.0 26-27 38.539125 40.0 38.0 40.0 38.0 40.0 28-29 38.640375 40.0 38.0 40.0 38.0 40.0 30-31 38.553 40.0 38.0 40.0 38.0 40.0 32-33 38.536500000000004 40.0 38.0 40.0 38.0 40.0 34-35 38.6135 40.0 38.0 40.0 38.0 40.0 36-37 38.628125 40.0 38.0 40.0 38.0 40.0 38-39 38.523250000000004 40.0 38.0 40.0 38.0 40.0 40-41 38.52175 40.0 38.0 40.0 38.0 40.0 42-43 38.475125 40.0 38.0 40.0 38.0 40.0 44-45 38.402125 40.0 38.0 40.0 38.0 40.0 46-47 38.409625000000005 40.0 38.0 40.0 38.0 40.0 48-49 38.063 40.0 38.0 40.0 38.0 40.0 50-51 38.218625 40.0 38.0 40.0 38.0 40.0 52-53 38.24875 40.0 38.0 40.0 38.0 40.0 54-55 38.266875 40.0 38.0 40.0 38.0 40.0 56-57 38.284000000000006 40.0 38.0 40.0 38.0 40.0 58-59 38.363375000000005 40.0 38.0 40.0 38.0 40.0 60-61 37.434 39.0 38.0 40.0 32.0 40.0 62-63 38.06225 40.0 38.0 40.0 38.0 40.0 64-65 38.213875 40.0 38.0 40.0 38.0 40.0 66-67 38.199375 40.0 38.0 40.0 38.0 40.0 68-69 38.109375 40.0 38.0 40.0 38.0 40.0 70-71 38.142875000000004 40.0 38.0 40.0 38.0 40.0 72-73 38.03725 40.0 38.0 40.0 38.0 40.0 74-75 37.965125 40.0 38.0 40.0 38.0 40.0 76-77 37.102125 39.0 38.0 40.0 35.0 40.0 78-79 37.509125 38.0 38.0 40.0 32.0 40.0 80-81 37.748875 38.0 38.0 40.0 35.0 40.0 82-83 37.84 38.0 38.0 40.0 35.0 40.0 84-85 37.636375 38.0 38.0 40.0 32.0 40.0 86-87 37.626000000000005 38.0 38.0 40.0 32.0 40.0 88-89 37.627250000000004 38.0 38.0 40.0 32.0 40.0 90-91 37.598375000000004 38.0 38.0 40.0 32.0 40.0 92-93 37.666250000000005 38.0 38.0 40.0 32.0 40.0 94-95 37.561875 38.0 38.0 40.0 32.0 40.0 96-97 37.331125 38.0 38.0 40.0 32.0 40.0 98-99 37.311875 38.0 38.0 40.0 32.0 40.0 100-101 37.286125 38.0 38.0 40.0 32.0 40.0 102-103 35.678 38.0 35.0 38.0 29.5 38.0 104-105 37.49625 38.0 38.0 40.0 32.0 40.0 106-107 37.997 40.0 38.0 40.0 38.0 40.0 108-109 38.026125 40.0 38.0 40.0 38.0 40.0 110-111 38.071 40.0 38.0 40.0 38.0 40.0 112-113 37.92475 40.0 38.0 40.0 38.0 40.0 114-115 37.164249999999996 38.0 38.0 40.0 32.0 40.0 116-117 37.614999999999995 39.0 38.0 40.0 38.0 40.0 118-119 37.379 40.0 38.0 40.0 35.0 40.0 120 34.15975 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 0.0 20 3.0 21 1.0 22 0.0 23 2.0 24 3.0 25 6.0 26 11.0 27 15.0 28 22.0 29 38.0 30 41.0 31 54.0 32 63.0 33 86.0 34 97.0 35 137.0 36 162.0 37 295.0 38 768.0 39 2192.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.8173979203652 9.764138980471722 6.416434187167132 44.00202891199594 2 23.05 12.0 33.525 31.424999999999997 3 20.599999999999998 12.85 23.225 43.325 4 26.825 19.825 20.95 32.4 5 26.75 24.45 23.925 24.875 6 23.724999999999998 27.375 25.275 23.625 7 18.15 22.3 37.675 21.875 8 20.150000000000002 21.5 30.075000000000003 28.275 9 20.8 20.625 31.65 26.924999999999997 10-11 24.95 27.224999999999998 21.95 25.874999999999996 12-13 24.1875 21.3 25.4625 29.049999999999997 14-15 23.962500000000002 23.0375 25.7125 27.287499999999998 16-17 23.925 22.8 24.712500000000002 28.5625 18-19 23.674999999999997 22.237499999999997 24.4125 29.675 20-21 23.4875 23.400000000000002 25.7375 27.375 22-23 23.7 24.15 24.5625 27.5875 24-25 23.1875 24.5 24.762500000000003 27.55 26-27 23.8375 23.0625 25.374999999999996 27.725 28-29 24.2 22.025 25.650000000000002 28.125 30-31 23.5875 22.8375 25.087500000000002 28.487499999999997 32-33 23.674999999999997 22.9375 25.362499999999997 28.025 34-35 24.125 22.787499999999998 25.587500000000002 27.500000000000004 36-37 24.3125 23.45 24.587500000000002 27.650000000000002 38-39 24.0375 22.275 24.925 28.762500000000003 40-41 24.6875 22.85 24.45 28.012500000000003 42-43 23.9875 23.400000000000002 24.375 28.237499999999997 44-45 23.8375 22.8125 25.162499999999998 28.1875 46-47 24.125 22.825 24.8625 28.1875 48-49 23.3125 22.5625 24.7875 29.3375 50-51 23.25 22.85 25.5125 28.3875 52-53 24.525 22.925 24.8625 27.6875 54-55 23.625 23.599999999999998 24.85 27.925 56-57 22.8875 22.775000000000002 26.075 28.262500000000003 58-59 24.5375 22.5125 24.65 28.299999999999997 60-61 24.712500000000002 22.95 24.962500000000002 27.375 62-63 23.375 21.725 25.8625 29.037499999999998 64-65 23.9875 21.8875 25.650000000000002 28.475 66-67 24.275 23.3125 24.0375 28.375 68-69 23.025000000000002 23.3375 25.15 28.487499999999997 70-71 24.6875 21.9 24.925 28.487499999999997 72-73 24.5125 23.5625 23.3625 28.5625 74-75 25.05 23.2625 24.4875 27.200000000000003 76-77 24.9375 22.400000000000002 25.0 27.6625 78-79 23.8875 22.4625 24.6 29.049999999999997 80-81 23.5875 22.25 24.762500000000003 29.4 82-83 25.074999999999996 21.875 24.5 28.549999999999997 84-85 24.4875 21.675 25.0625 28.775000000000002 86-87 25.624999999999996 22.225 24.0 28.15 88-89 24.525 22.4625 24.6625 28.349999999999998 90-91 25.2375 21.5 24.5125 28.749999999999996 92-93 25.15 22.175 25.124999999999996 27.55 94-95 24.2375 21.637500000000003 25.5625 28.5625 96-97 23.9 22.5 24.5 29.099999999999998 98-99 24.962500000000002 22.375 23.9 28.762500000000003 100-101 24.75 23.0125 24.825 27.4125 102-103 24.1875 23.0625 24.65 28.1 104-105 24.587500000000002 22.3 24.4125 28.7 106-107 24.3 23.225 23.962500000000002 28.512500000000003 108-109 24.325 22.35 24.9375 28.3875 110-111 24.75 21.8125 25.7875 27.650000000000002 112-113 24.8 23.3125 24.5125 27.375 114-115 25.025 23.75 24.1125 27.1125 116-117 24.474999999999998 24.45 23.625 27.450000000000003 118-119 23.95 23.8375 24.3625 27.85 120 25.4 22.925 24.325 27.35 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.0 29 3.0 30 3.0 31 3.0 32 5.0 33 6.0 34 8.0 35 13.0 36 28.0 37 39.5 38 45.0 39 48.5 40 61.0 41 77.0 42 82.0 43 94.0 44 110.0 45 120.5 46 135.5 47 170.0 48 175.5 49 173.0 50 195.0 51 188.0 52 172.0 53 161.5 54 166.5 55 195.0 56 195.5 57 170.0 58 145.5 59 125.5 60 113.5 61 101.5 62 82.5 63 82.0 64 81.5 65 65.5 66 58.5 67 56.0 68 53.0 69 38.5 70 31.5 71 37.5 72 29.0 73 14.5 74 10.5 75 10.5 76 7.5 77 4.0 78 3.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 120 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.09563994374122 81.85 2 5.20393811533052 9.25 3 1.659634317862166 4.425 4 0.6188466947960619 2.1999999999999997 5 0.14064697609001406 0.625 6 0.16877637130801687 0.8999999999999999 7 0.05625879043600562 0.35000000000000003 8 0.05625879043600562 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGGGGCAGGCGGCGGGCGCAGGCGCCGCTTGCTAGCTTGGATTCTGAC 8 0.2 No Hit GTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCC 8 0.2 No Hit CTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACAC 7 0.17500000000000002 No Hit GCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGC 7 0.17500000000000002 No Hit ATCGCTTCGAGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGC 6 0.15 No Hit GTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC 6 0.15 No Hit CTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCC 6 0.15 No Hit CCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTT 6 0.15 No Hit CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 6 0.15 No Hit GTGCGACGTGGGGCTGGATCTCAGTGGATCGTGGCAGCAAGGCCACTCTG 6 0.15 No Hit CCCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGC 5 0.125 No Hit CCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAA 5 0.125 No Hit CCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTT 5 0.125 No Hit CCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGA 5 0.125 No Hit CCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCCGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.9124999999999996 0.0 0.0 0.0 0.0 108 3.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGAC 15 0.004841414 57.0 14-15 >>END_MODULE Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824796 READS because READLEN < 1 Read 824796 spots for SRR22283134.sra Written 824796 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra Rejected 824788 READS because READLEN < 1 Read 824788 spots for SRR22283134.sra Written 824788 spots for SRR22283134.sra SRR ids: ['SRR22283134.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zny8e3yy SRR22283134.sra spots: 16495768 blocks: [[1, 824788], [824789, 1649576], [1649577, 2474364], [2474365, 3299152], [3299153, 4123940], [4123941, 4948728], [4948729, 5773516], [5773517, 6598304], [6598305, 7423092], [7423093, 8247880], [8247881, 9072668], [9072669, 9897456], [9897457, 10722244], [10722245, 11547032], [11547033, 12371820], [12371821, 13196608], [13196609, 14021396], [14021397, 14846184], [14846185, 15670972], [15670973, 16495768]] SRR22283134 file size 4585516 SRR22283134 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22283134 SRR22283134_1.fastq Input file: SRR22283134_1.fastq trimmed: SRR22283134-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 13:59:44 2024 >> started Fri Dec 6 13:59:53 2024 >> done (9.268s) 16495768 reads processed; of these: 908 ( 0.01%) short reads filtered out after trimming by size control 6414 ( 0.04%) empty reads filtered out after trimming by size control 16488446 (99.96%) reads available; of these: 1746034 (10.59%) trimmed reads available after processing 14742412 (89.41%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 131 0.00% 19 167 0.00% 20 177 0.00% 21 191 0.00% 22 251 0.00% 23 336 0.00% 24 413 0.00% 25 510 0.00% 26 704 0.00% 27 500 0.00% 28 374 0.00% 29 412 0.00% 30 401 0.00% 31 462 0.00% 32 477 0.00% 33 474 0.00% 34 502 0.00% 35 487 0.00% 36 585 0.00% 37 679 0.00% 38 622 0.00% 39 595 0.00% 40 567 0.00% 41 655 0.00% 42 638 0.00% 43 633 0.00% 44 646 0.00% 45 617 0.00% 46 593 0.00% 47 665 0.00% 48 692 0.00% 49 707 0.00% 50 698 0.00% 51 741 0.00% 52 792 0.00% 53 770 0.00% 54 855 0.01% 55 885 0.01% 56 910 0.01% 57 913 0.01% 58 980 0.01% 59 1073 0.01% 60 1166 0.01% 61 1241 0.01% 62 1325 0.01% 63 1374 0.01% 64 1551 0.01% 65 1607 0.01% 66 1651 0.01% 67 1761 0.01% 68 1875 0.01% 69 2097 0.01% 70 2160 0.01% 71 2442 0.01% 72 2658 0.02% 73 2937 0.02% 74 3275 0.02% 75 3441 0.02% 76 3732 0.02% 77 4030 0.02% 78 4402 0.03% 79 5044 0.03% 80 5503 0.03% 81 6106 0.04% 82 6465 0.04% 83 7178 0.04% 84 7840 0.05% 85 8809 0.05% 86 9497 0.06% 87 10253 0.06% 88 11552 0.07% 89 1866 0.01% 90 2022 0.01% 91 2180 0.01% 92 2278 0.01% 93 2390 0.01% 94 2516 0.02% 95 2551 0.02% 96 2790 0.02% 97 2816 0.02% 98 3067 0.02% 99 3372 0.02% 100 3807 0.02% 101 4522 0.03% 102 1662 0.01% 103 2519 0.02% 104 3430 0.02% 105 4276 0.03% 106 5548 0.03% 107 6911 0.04% 108 8334 0.05% 109 10050 0.06% 110 12086 0.07% 111 15098 0.09% 112 18487 0.11% 113 24281 0.15% 114 31800 0.19% 115 43842 0.27% 116 64117 0.39% 117 96859 0.59% 118 212726 1.29% 119 1000379 6.07% 120 14742412 89.41% 16488446 reads passed initial QC criterion=sequence-density sequence-density=2.97 sequence-density-rank=1 fanout-score=59.73 fanout-score-rank=1 prefix-density=3.96 prefix-fanout=44.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=2.97 sequence-density-rank=1 fanout-score=59.73 fanout-score-rank=1 prefix-density=3.96 prefix-fanout=44.7 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR22283134 - Input file: STDIN trimmed: SRR22283134-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 14:00:34 2024 >> started Fri Dec 6 14:00:43 2024 >> done (8.470s) 5496149 reads processed; of these: 2 ( 0.00%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 5496142 (100.00%) reads available; of these: 487733 ( 8.87%) trimmed reads available after processing 5008409 (91.13%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 43 0.00% 19 64 0.00% 20 68 0.00% 21 51 0.00% 22 76 0.00% 23 107 0.00% 24 129 0.00% 25 179 0.00% 26 255 0.00% 27 188 0.00% 28 136 0.00% 29 144 0.00% 30 130 0.00% 31 151 0.00% 32 151 0.00% 33 149 0.00% 34 179 0.00% 35 149 0.00% 36 211 0.00% 37 248 0.00% 38 210 0.00% 39 184 0.00% 40 178 0.00% 41 221 0.00% 42 196 0.00% 43 226 0.00% 44 240 0.00% 45 212 0.00% 46 218 0.00% 47 237 0.00% 48 228 0.00% 49 239 0.00% 50 221 0.00% 51 255 0.00% 52 281 0.01% 53 262 0.00% 54 294 0.01% 55 297 0.01% 56 337 0.01% 57 310 0.01% 58 360 0.01% 59 356 0.01% 60 368 0.01% 61 396 0.01% 62 419 0.01% 63 444 0.01% 64 508 0.01% 65 530 0.01% 66 544 0.01% 67 588 0.01% 68 648 0.01% 69 702 0.01% 70 757 0.01% 71 824 0.01% 72 905 0.02% 73 947 0.02% 74 1037 0.02% 75 1194 0.02% 76 1246 0.02% 77 1371 0.02% 78 1444 0.03% 79 1709 0.03% 80 1813 0.03% 81 2059 0.04% 82 2105 0.04% 83 2432 0.04% 84 2626 0.05% 85 2966 0.05% 86 3157 0.06% 87 3481 0.06% 88 3908 0.07% 89 4056 0.07% 90 4447 0.08% 91 4942 0.09% 92 5648 0.10% 93 6342 0.12% 94 6823 0.12% 95 7496 0.14% 96 8175 0.15% 97 9021 0.16% 98 9782 0.18% 99 10321 0.19% 100 11418 0.21% 101 12304 0.22% 102 12073 0.22% 103 13486 0.25% 104 14493 0.26% 105 15515 0.28% 106 16962 0.31% 107 19049 0.35% 108 19773 0.36% 109 22397 0.41% 110 23591 0.43% 111 25736 0.47% 112 28329 0.52% 113 30583 0.56% 114 36330 0.66% 115 46491 0.85% 116 65186 1.19% 117 117184 2.13% 118 64814 1.18% 119 303956 5.53% 120 4469921 81.33% criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=29 prefix-density=0.73 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=36.17 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=1.9 sequence=TTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCT Started job on | Dec 06 14:01:14 Started mapping on | Dec 06 14:01:14 Finished on | Dec 06 14:02:00 Mapping speed, Million of reads per hour | 1290.40 Number of input reads | 16488439 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 8846379 Uniquely mapped reads % | 53.65% Average mapped length | 118.22 Number of splices: Total | 3335148 Number of splices: Annotated (sjdb) | 3155094 Number of splices: GT/AG | 3282409 Number of splices: GC/AG | 41679 Number of splices: AT/AC | 1441 Number of splices: Non-canonical | 9619 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.02% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2596366 % of reads mapped to multiple loci | 15.75% Number of reads mapped to too many loci | 4506248 % of reads mapped to too many loci | 27.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.83% % of reads unmapped: other | 2.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5045694 5045694 5045694 N_multimapping 2596366 2596366 2596366 N_noFeature 742950 8618848 804426 N_ambiguous 187537 899 21579 UnstrandedReadsAssigned:7915892 PositiveStrandReadsAssigned:226632 NegativeStrandReadsAssigned:8020374 Dataset is classified negative stranded MeadianReadLen=120 20thPercentileLength=120 echo kmer=115 SRR22283134 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR22283134-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,488,439 reads, 8,363,006 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52973 SRR22283134.ke.tsv 35125 SRR22283134.se.tsv 88098 total ==> SRR22283134.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 28.0607 6.16968 PNS24247 1044 945 23.2063 4.51923 PNS24249 1928 1829 36.1841 3.64077 PNS24246 1044 945 23.2063 4.51923 PNS24248 1044 945 23.2063 4.51923 PNS24244 1471 1372 83.1362 11.1513 PNS24243 293 194 0 0 KQK14069 1603 1504 3544.91 433.758 KQK14071 474 375 546.01 267.953 ==> SRR22283134.se.tsv <== BRADI_1g14170v3 4557 BRADI_1g53295v3 362 BRADI_1g59795v3 65 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 244 BRADI_1g74790v3 76 BRADI_1g09890v3 0 BRADI_1g77505v3 138 BRADI_1g48960v3 0 SRR22283134 completed mapping pipeline successfully