Starting /dee2/code/volunteer_pipeline.sh SRR22283135 current disk space = 1550665162752 free memory = 1598980844 SRR22283135 SRAfilesize 868a2a69cd03044bde9ad9c3e31158ea SRR22283135.sra SRR22283135.sra file validated SRR22283135 is single end SRR22283135 is conventional basespace SRR22283135 read1 length is 120 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR22283135_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 120 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.65675 38.0 38.0 38.0 32.0 38.0 2 36.7285 38.0 38.0 38.0 32.0 38.0 3 36.89525 38.0 38.0 38.0 32.0 38.0 4 36.67275 38.0 38.0 38.0 32.0 38.0 5 36.82475 38.0 38.0 38.0 32.0 38.0 6 38.911 40.0 38.0 40.0 38.0 40.0 7 38.85725 40.0 38.0 40.0 38.0 40.0 8 38.92475 40.0 38.0 40.0 38.0 40.0 9 38.93675 40.0 38.0 40.0 38.0 40.0 10-11 38.85075 40.0 38.0 40.0 38.0 40.0 12-13 38.906625000000005 40.0 38.0 40.0 38.0 40.0 14-15 38.7355 40.0 38.0 40.0 38.0 40.0 16-17 38.848875 40.0 38.0 40.0 38.0 40.0 18-19 38.852375 40.0 38.0 40.0 38.0 40.0 20-21 38.8695 40.0 38.0 40.0 38.0 40.0 22-23 38.830875 40.0 38.0 40.0 38.0 40.0 24-25 38.605625 40.0 38.0 40.0 38.0 40.0 26-27 38.704375 40.0 38.0 40.0 38.0 40.0 28-29 38.697125 40.0 38.0 40.0 38.0 40.0 30-31 38.673874999999995 40.0 38.0 40.0 38.0 40.0 32-33 38.545375 40.0 38.0 40.0 38.0 40.0 34-35 38.630875 40.0 38.0 40.0 38.0 40.0 36-37 38.6905 40.0 38.0 40.0 38.0 40.0 38-39 38.6505 40.0 38.0 40.0 38.0 40.0 40-41 38.630875 40.0 38.0 40.0 38.0 40.0 42-43 38.653375 40.0 38.0 40.0 38.0 40.0 44-45 38.488125 40.0 38.0 40.0 38.0 40.0 46-47 38.42425 40.0 38.0 40.0 38.0 40.0 48-49 38.2405 40.0 38.0 40.0 38.0 40.0 50-51 38.3235 40.0 38.0 40.0 38.0 40.0 52-53 38.31925 40.0 38.0 40.0 38.0 40.0 54-55 38.291 40.0 38.0 40.0 38.0 40.0 56-57 38.379374999999996 40.0 38.0 40.0 38.0 40.0 58-59 38.271375 40.0 38.0 40.0 38.0 40.0 60-61 37.415125 39.0 38.0 40.0 35.0 40.0 62-63 38.137375000000006 40.0 38.0 40.0 38.0 40.0 64-65 38.23175 40.0 38.0 40.0 38.0 40.0 66-67 38.165625000000006 40.0 38.0 40.0 38.0 40.0 68-69 38.286375 40.0 38.0 40.0 38.0 40.0 70-71 38.22475 40.0 38.0 40.0 38.0 40.0 72-73 37.99075 40.0 38.0 40.0 38.0 40.0 74-75 37.982375 40.0 38.0 40.0 38.0 40.0 76-77 37.12949999999999 39.0 38.0 40.0 32.5 40.0 78-79 37.42725 38.0 38.0 40.0 32.0 40.0 80-81 37.825625 38.0 38.0 40.0 38.0 40.0 82-83 37.834 38.0 38.0 40.0 35.0 40.0 84-85 37.779375 38.0 38.0 40.0 35.0 40.0 86-87 37.738125 38.0 38.0 40.0 32.0 40.0 88-89 37.643249999999995 38.0 38.0 40.0 32.0 40.0 90-91 37.666375 38.0 38.0 40.0 32.0 40.0 92-93 37.63575 38.0 38.0 40.0 35.0 40.0 94-95 37.57425 38.0 38.0 40.0 32.0 40.0 96-97 37.488875 38.0 38.0 40.0 32.0 40.0 98-99 37.363875 38.0 38.0 40.0 32.0 40.0 100-101 37.343625 38.0 38.0 40.0 32.0 40.0 102-103 35.718625 38.0 35.0 38.0 29.5 38.0 104-105 37.399249999999995 38.0 38.0 40.0 35.0 40.0 106-107 37.984875 40.0 38.0 40.0 38.0 40.0 108-109 38.07175 40.0 38.0 40.0 38.0 40.0 110-111 38.09375 40.0 38.0 40.0 38.0 40.0 112-113 37.96575 40.0 38.0 40.0 38.0 40.0 114-115 37.334374999999994 38.0 38.0 40.0 32.0 40.0 116-117 37.720875 39.0 38.0 40.0 38.0 40.0 118-119 37.63775 39.0 38.0 40.0 38.0 40.0 120 34.199 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 0.0 16 0.0 17 0.0 18 3.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 6.0 25 5.0 26 8.0 27 10.0 28 21.0 29 29.0 30 42.0 31 51.0 32 60.0 33 71.0 34 103.0 35 130.0 36 168.0 37 343.0 38 757.0 39 2185.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.994949494949495 9.94949494949495 7.752525252525253 45.3030303030303 2 24.825 12.425 34.949999999999996 27.800000000000004 3 21.325 14.149999999999999 22.675 41.85 4 27.025 21.099999999999998 21.125 30.75 5 27.85 27.825 21.575 22.75 6 23.200000000000003 30.125 23.25 23.425 7 18.775 22.5 37.75 20.974999999999998 8 20.549999999999997 23.325000000000003 29.275000000000002 26.85 9 21.575 20.974999999999998 31.275 26.174999999999997 10-11 23.8625 28.975 23.2375 23.925 12-13 23.799999999999997 22.4875 26.35 27.3625 14-15 23.8125 23.25 27.1125 25.825 16-17 24.175 24.0625 25.15 26.6125 18-19 24.0625 24.3875 24.587500000000002 26.9625 20-21 24.349999999999998 25.474999999999998 24.3875 25.7875 22-23 24.3 24.6125 24.762500000000003 26.325 24-25 24.6625 24.7 23.925 26.7125 26-27 24.099999999999998 24.575 24.6 26.724999999999998 28-29 24.2625 24.637500000000003 24.0 27.1 30-31 24.05 24.462500000000002 24.5125 26.974999999999998 32-33 23.962500000000002 23.5875 25.5 26.950000000000003 34-35 23.5625 24.675 25.575 26.187500000000004 36-37 24.712500000000002 23.8375 24.637500000000003 26.8125 38-39 24.587500000000002 23.599999999999998 24.45 27.3625 40-41 24.425 23.8875 24.8625 26.825 42-43 24.6625 24.462500000000002 24.349999999999998 26.525 44-45 23.9375 23.65 25.474999999999998 26.937499999999996 46-47 23.9875 22.95 25.074999999999996 27.987499999999997 48-49 23.849999999999998 24.5 24.7875 26.8625 50-51 24.875 24.3875 24.5375 26.200000000000003 52-53 24.212500000000002 24.325 24.0 27.462500000000002 54-55 23.45 24.6125 24.775 27.1625 56-57 23.7125 24.474999999999998 25.4 26.4125 58-59 24.1625 24.525 24.375 26.937499999999996 60-61 24.925 23.9 24.9 26.275 62-63 24.825 24.5125 24.6 26.0625 64-65 25.7375 23.2875 24.6875 26.2875 66-67 24.775 23.7375 24.7 26.787499999999998 68-69 24.2875 23.825 25.4625 26.424999999999997 70-71 25.3 24.0 24.5 26.200000000000003 72-73 24.4 23.7875 24.0 27.8125 74-75 24.075 23.724999999999998 24.9125 27.287499999999998 76-77 25.087500000000002 23.6875 24.425 26.8 78-79 25.087500000000002 24.625 24.3625 25.924999999999997 80-81 23.7875 24.25 25.95 26.0125 82-83 25.0 23.8375 24.45 26.7125 84-85 24.5 23.474999999999998 24.712500000000002 27.3125 86-87 24.8 23.575 24.6625 26.9625 88-89 24.725 23.3875 24.5125 27.375 90-91 24.474999999999998 23.775 24.887500000000003 26.8625 92-93 25.174999999999997 23.3125 24.725 26.787499999999998 94-95 24.9875 23.6625 24.425 26.924999999999997 96-97 23.8375 24.575 24.9375 26.650000000000002 98-99 25.25 24.462500000000002 24.224999999999998 26.0625 100-101 25.937500000000004 24.05 23.0375 26.974999999999998 102-103 24.462500000000002 24.2625 24.45 26.825 104-105 25.4375 24.1125 24.625 25.825 106-107 25.424999999999997 24.4 23.674999999999997 26.5 108-109 26.1625 24.375 23.325000000000003 26.137500000000003 110-111 25.112499999999997 24.875 24.6875 25.324999999999996 112-113 25.575 23.875 23.8125 26.737499999999997 114-115 25.1875 24.6125 23.2375 26.9625 116-117 25.5125 24.7375 23.825 25.924999999999997 118-119 26.0375 24.6875 23.4375 25.837500000000002 120 24.5 25.0 24.825 25.674999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 1.0 29 3.0 30 4.5 31 4.0 32 7.5 33 11.0 34 16.0 35 22.0 36 24.0 37 42.5 38 56.0 39 61.5 40 92.0 41 116.0 42 127.5 43 147.5 44 162.5 45 170.0 46 176.5 47 179.0 48 184.0 49 182.5 50 170.5 51 169.5 52 164.5 53 141.5 54 130.5 55 125.0 56 112.0 57 113.0 58 107.5 59 98.0 60 96.5 61 93.0 62 87.0 63 78.0 64 76.5 65 67.5 66 63.5 67 66.5 68 61.5 69 55.5 70 39.5 71 28.0 72 20.5 73 13.5 74 11.5 75 9.0 76 5.0 77 2.5 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 120 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98887765419616 97.89999999999999 2 0.910010111223458 1.7999999999999998 3 0.10111223458038424 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.5249999999999999 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.275 0.0 0.0 0.0 0.0 94-95 1.575 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.3875 0.0 0.0 0.0 0.0 100-101 3.1500000000000004 0.0 0.0 0.0 0.0 102-103 3.675 0.0 0.0 0.0 0.0 104-105 4.262499999999999 0.0 0.0 0.0 0.0 106-107 4.8 0.0 0.0 0.0 0.0 108 5.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861068 READS because READLEN < 1 Read 861068 spots for SRR22283135.sra Written 861068 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra Rejected 861049 READS because READLEN < 1 Read 861049 spots for SRR22283135.sra Written 861049 spots for SRR22283135.sra SRR ids: ['SRR22283135.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uvm9b9nk SRR22283135.sra spots: 17220999 blocks: [[1, 861049], [861050, 1722098], [1722099, 2583147], [2583148, 3444196], [3444197, 4305245], [4305246, 5166294], [5166295, 6027343], [6027344, 6888392], [6888393, 7749441], [7749442, 8610490], [8610491, 9471539], [9471540, 10332588], [10332589, 11193637], [11193638, 12054686], [12054687, 12915735], [12915736, 13776784], [13776785, 14637833], [14637834, 15498882], [15498883, 16359931], [16359932, 17220999]] SRR22283135 file size 4788070 SRR22283135 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR22283135 SRR22283135_1.fastq Input file: SRR22283135_1.fastq trimmed: SRR22283135-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 14:01:39 2024 >> started Fri Dec 6 14:01:47 2024 >> done (8.669s) 17220999 reads processed; of these: 857 ( 0.00%) short reads filtered out after trimming by size control 4141 ( 0.02%) empty reads filtered out after trimming by size control 17216001 (99.97%) reads available; of these: 1824713 (10.60%) trimmed reads available after processing 15391288 (89.40%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 114 0.00% 19 153 0.00% 20 161 0.00% 21 180 0.00% 22 257 0.00% 23 346 0.00% 24 381 0.00% 25 525 0.00% 26 693 0.00% 27 490 0.00% 28 369 0.00% 29 460 0.00% 30 433 0.00% 31 448 0.00% 32 499 0.00% 33 510 0.00% 34 529 0.00% 35 536 0.00% 36 578 0.00% 37 729 0.00% 38 633 0.00% 39 674 0.00% 40 590 0.00% 41 622 0.00% 42 669 0.00% 43 647 0.00% 44 634 0.00% 45 616 0.00% 46 659 0.00% 47 677 0.00% 48 744 0.00% 49 798 0.00% 50 793 0.00% 51 836 0.00% 52 771 0.00% 53 916 0.01% 54 867 0.01% 55 1030 0.01% 56 957 0.01% 57 1034 0.01% 58 1133 0.01% 59 1206 0.01% 60 1343 0.01% 61 1390 0.01% 62 1479 0.01% 63 1618 0.01% 64 1765 0.01% 65 1886 0.01% 66 1927 0.01% 67 2231 0.01% 68 2332 0.01% 69 2540 0.01% 70 2823 0.02% 71 2926 0.02% 72 3366 0.02% 73 3641 0.02% 74 4090 0.02% 75 4420 0.03% 76 4972 0.03% 77 5343 0.03% 78 5838 0.03% 79 6613 0.04% 80 7080 0.04% 81 7713 0.04% 82 8853 0.05% 83 9969 0.06% 84 10701 0.06% 85 12233 0.07% 86 13402 0.08% 87 14528 0.08% 88 15566 0.09% 89 1967 0.01% 90 2191 0.01% 91 2146 0.01% 92 2347 0.01% 93 2506 0.01% 94 2595 0.02% 95 2610 0.02% 96 2792 0.02% 97 2958 0.02% 98 3126 0.02% 99 3471 0.02% 100 3934 0.02% 101 4581 0.03% 102 1642 0.01% 103 2508 0.01% 104 3335 0.02% 105 4427 0.03% 106 5635 0.03% 107 6781 0.04% 108 8393 0.05% 109 10007 0.06% 110 12157 0.07% 111 15039 0.09% 112 19099 0.11% 113 24078 0.14% 114 31872 0.19% 115 43864 0.25% 116 65371 0.38% 117 99178 0.58% 118 217390 1.26% 119 1028228 5.97% 120 15391288 89.40% 17216001 reads passed initial QC criterion=sequence-density sequence-density=4.03 sequence-density-rank=1 fanout-score=59.36 fanout-score-rank=1 prefix-density=5.31 prefix-fanout=45.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=4.03 sequence-density-rank=1 fanout-score=59.36 fanout-score-rank=1 prefix-density=5.31 prefix-fanout=45.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR22283135 - Input file: STDIN trimmed: SRR22283135-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Fri Dec 6 14:02:26 2024 >> started Fri Dec 6 14:02:35 2024 >> done (9.075s) 10329601 reads processed; of these: 7 ( 0.00%) short reads filtered out after trimming by size control 2 ( 0.00%) empty reads filtered out after trimming by size control 10329592 (100.00%) reads available; of these: 1167426 (11.30%) trimmed reads available after processing 9162166 (88.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 77 0.00% 19 94 0.00% 20 111 0.00% 21 113 0.00% 22 164 0.00% 23 223 0.00% 24 220 0.00% 25 319 0.00% 26 437 0.00% 27 311 0.00% 28 226 0.00% 29 287 0.00% 30 269 0.00% 31 264 0.00% 32 290 0.00% 33 308 0.00% 34 322 0.00% 35 311 0.00% 36 362 0.00% 37 431 0.00% 38 370 0.00% 39 406 0.00% 40 384 0.00% 41 349 0.00% 42 423 0.00% 43 355 0.00% 44 369 0.00% 45 394 0.00% 46 388 0.00% 47 410 0.00% 48 462 0.00% 49 453 0.00% 50 468 0.00% 51 510 0.00% 52 448 0.00% 53 569 0.01% 54 551 0.01% 55 619 0.01% 56 578 0.01% 57 645 0.01% 58 673 0.01% 59 724 0.01% 60 790 0.01% 61 842 0.01% 62 893 0.01% 63 978 0.01% 64 1067 0.01% 65 1178 0.01% 66 1187 0.01% 67 1363 0.01% 68 1435 0.01% 69 1508 0.01% 70 1672 0.02% 71 1777 0.02% 72 2051 0.02% 73 2233 0.02% 74 2426 0.02% 75 2683 0.03% 76 2990 0.03% 77 3253 0.03% 78 3524 0.03% 79 3955 0.04% 80 4247 0.04% 81 4669 0.05% 82 5325 0.05% 83 5946 0.06% 84 6470 0.06% 85 7317 0.07% 86 7982 0.08% 87 8762 0.08% 88 9492 0.09% 89 10408 0.10% 90 11458 0.11% 91 12895 0.12% 92 13955 0.14% 93 15406 0.15% 94 16990 0.16% 95 18464 0.18% 96 20248 0.20% 97 22123 0.21% 98 23950 0.23% 99 25743 0.25% 100 27846 0.27% 101 29451 0.29% 102 30019 0.29% 103 32915 0.32% 104 35186 0.34% 105 37647 0.36% 106 41657 0.40% 107 44590 0.43% 108 47112 0.46% 109 51768 0.50% 110 54534 0.53% 111 58657 0.57% 112 63512 0.61% 113 68582 0.66% 114 77798 0.75% 115 97686 0.95% 116 136788 1.32% 117 255054 2.47% 118 117447 1.14% 119 550372 5.33% 120 8165629 79.05% criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.51 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.19 sequence-density-rank=20 fanout-score=12.07 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=6.0 sequence=CCTTGATCTTCT Started job on | Dec 06 14:02:59 Started mapping on | Dec 06 14:02:59 Finished on | Dec 06 14:03:35 Mapping speed, Million of reads per hour | 1721.60 Number of input reads | 17215992 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 15349390 Uniquely mapped reads % | 89.16% Average mapped length | 117.77 Number of splices: Total | 5802396 Number of splices: Annotated (sjdb) | 5490771 Number of splices: GT/AG | 5712193 Number of splices: GC/AG | 71907 Number of splices: AT/AC | 2160 Number of splices: Non-canonical | 16136 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 813202 % of reads mapped to multiple loci | 4.72% Number of reads mapped to too many loci | 836687 % of reads mapped to too many loci | 4.86% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.86% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1053400 1053400 1053400 N_multimapping 813202 813202 813202 N_noFeature 535128 14924910 631977 N_ambiguous 366286 1347 38776 UnstrandedReadsAssigned:14447976 PositiveStrandReadsAssigned:423133 NegativeStrandReadsAssigned:14678637 Dataset is classified negative stranded MeadianReadLen=120 20thPercentileLength=119 echo kmer=115 SRR22283135 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR22283135-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,215,992 reads, 14,807,292 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52973 SRR22283135.ke.tsv 35125 SRR22283135.se.tsv 88098 total ==> SRR22283135.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 98.4702 11.8573 PNS24247 1044 945 23.3333 2.48859 PNS24249 1928 1829 43.7781 2.41241 PNS24246 1044 945 23.3333 2.48859 PNS24248 1044 945 23.3333 2.48859 PNS24244 1471 1372 123.752 9.09087 PNS24243 293 194 0 0 KQK14069 1603 1504 9682.27 648.84 KQK14071 474 375 808.671 217.345 ==> SRR22283135.se.tsv <== BRADI_1g14170v3 11305 BRADI_1g53295v3 549 BRADI_1g59795v3 83 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 244 BRADI_1g74790v3 89 BRADI_1g09890v3 1 BRADI_1g77505v3 395 BRADI_1g48960v3 0 SRR22283135 completed mapping pipeline successfully