Starting /dee2/code/volunteer_pipeline.sh SRR24195886 current disk space = 1549664555008 free memory = 1410480552 SRR24195886 SRAfilesize 3e5c4de7229c9f4c70cfa5b139d02368 SRR24195886.sra SRR24195886.sra file validated SRR24195886 is single end SRR24195886 is conventional basespace SRR24195886 read1 length is 57-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195886_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 57-76 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8615 32.0 32.0 32.0 32.0 32.0 2 31.64825 32.0 32.0 32.0 32.0 32.0 3 31.696 32.0 32.0 32.0 32.0 32.0 4 31.69925 32.0 32.0 32.0 32.0 32.0 5 31.77075 32.0 32.0 32.0 32.0 32.0 6 35.357 36.0 36.0 36.0 36.0 36.0 7 35.28275 36.0 36.0 36.0 36.0 36.0 8 35.2845 36.0 36.0 36.0 36.0 36.0 9 35.2145 36.0 36.0 36.0 36.0 36.0 10-11 35.287625000000006 36.0 36.0 36.0 36.0 36.0 12-13 35.351875 36.0 36.0 36.0 36.0 36.0 14-15 35.27675 36.0 36.0 36.0 36.0 36.0 16-17 35.31525 36.0 36.0 36.0 36.0 36.0 18-19 35.308499999999995 36.0 36.0 36.0 36.0 36.0 20-21 35.302125000000004 36.0 36.0 36.0 36.0 36.0 22-23 35.268875 36.0 36.0 36.0 36.0 36.0 24-25 35.23225 36.0 36.0 36.0 36.0 36.0 26-27 35.228624999999994 36.0 36.0 36.0 36.0 36.0 28-29 35.193875000000006 36.0 36.0 36.0 36.0 36.0 30-31 35.159875 36.0 36.0 36.0 36.0 36.0 32-33 35.177 36.0 36.0 36.0 36.0 36.0 34-35 35.163375 36.0 36.0 36.0 36.0 36.0 36-37 35.17075 36.0 36.0 36.0 36.0 36.0 38-39 35.076750000000004 36.0 36.0 36.0 36.0 36.0 40-41 35.131625 36.0 36.0 36.0 36.0 36.0 42-43 35.22325 36.0 36.0 36.0 36.0 36.0 44-45 35.079 36.0 36.0 36.0 36.0 36.0 46-47 35.068 36.0 36.0 36.0 36.0 36.0 48-49 35.104875 36.0 36.0 36.0 36.0 36.0 50-51 35.03475 36.0 36.0 36.0 36.0 36.0 52-53 35.071749999999994 36.0 36.0 36.0 36.0 36.0 54-55 35.078625 36.0 36.0 36.0 36.0 36.0 56-57 35.05 36.0 36.0 36.0 36.0 36.0 58-59 34.92123030757689 36.0 36.0 36.0 36.0 36.0 60-61 35.02738184546136 36.0 36.0 36.0 36.0 36.0 62-63 34.978744686171545 36.0 36.0 36.0 36.0 36.0 64-65 34.93673418354589 36.0 36.0 36.0 36.0 36.0 66-67 35.05501697460383 36.0 36.0 36.0 36.0 36.0 68-69 34.938704028021014 36.0 36.0 36.0 34.0 36.0 70-71 34.9158062240374 36.0 36.0 36.0 34.0 36.0 72-73 34.89927653239815 36.0 36.0 36.0 34.0 36.0 74-75 34.81726380871146 36.0 36.0 36.0 32.0 36.0 76 35.17115435883764 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 8.0 25 7.0 26 12.0 27 19.0 28 32.0 29 45.0 30 63.0 31 86.0 32 106.0 33 197.0 34 408.0 35 3014.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.175 10.424999999999999 9.675 45.725 2 22.475 11.625 32.824999999999996 33.074999999999996 3 20.825 13.325000000000001 23.45 42.4 4 27.0 17.9 19.3 35.8 5 27.224999999999998 24.0 23.150000000000002 25.624999999999996 6 27.1 27.750000000000004 22.225 22.925 7 21.475 25.35 34.675 18.5 8 21.65 24.85 28.95 24.55 9 21.85 22.0 32.824999999999996 23.325000000000003 10-11 24.05 28.8875 23.8125 23.25 12-13 24.24053006625828 24.603075384423054 25.14064258032254 26.015751968996128 14-15 24.3 24.15 26.137500000000003 25.412499999999998 16-17 24.474999999999998 23.7375 24.962500000000002 26.825 18-19 24.075 24.8625 25.05 26.0125 20-21 24.362181090545274 24.424712356178087 25.100050025012504 26.113056528264135 22-23 23.8875 24.2625 24.962500000000002 26.887499999999996 24-25 24.05 24.2875 25.2875 26.375 26-27 23.974999999999998 24.3875 25.087500000000002 26.55 28-29 24.762500000000003 24.2875 25.1 25.85 30-31 25.4625 23.6875 23.9875 26.8625 32-33 25.474999999999998 23.974999999999998 25.124999999999996 25.424999999999997 34-35 24.925 24.349999999999998 24.8625 25.8625 36-37 25.3 23.400000000000002 24.85 26.450000000000003 38-39 24.6125 23.4125 25.1 26.875 40-41 24.575 23.7625 25.162499999999998 26.5 42-43 24.349999999999998 23.9875 24.8125 26.85 44-45 24.6625 24.5 24.325 26.5125 46-47 24.79059882485311 24.153019127390923 24.85310663832979 26.20327540942618 48-49 24.8 24.5125 24.325 26.3625 50-51 24.95 24.0375 25.124999999999996 25.887500000000003 52-53 24.6625 24.0 24.224999999999998 27.1125 54-55 24.265533191648956 24.415551943992998 24.36554569321165 26.95336917114639 56-57 24.7375 23.4375 25.074999999999996 26.75 58-59 24.527593542735577 23.801776999124012 24.69027656113127 26.980352897009137 60-61 25.23130782695674 24.381095273818453 24.10602650662666 26.281570392598148 62-63 25.04376094023506 24.456114028507127 24.33108277069267 26.16904226056514 64-65 25.943985996499126 24.081020255063766 24.518629657414355 25.456364091022753 66-67 25.372014505439537 24.234087782918596 23.658872077028885 26.73502563461298 68-69 24.630973229922443 23.817863397548162 24.580935701776333 26.970227670753065 70-71 24.4994994994995 23.536036036036037 25.63813813813814 26.326326326326328 72-73 25.344352617079892 23.42849987478087 24.430252942649634 26.79689456548961 74-75 24.738632069530166 22.88701347776798 24.738632069530166 27.635722383171686 76 25.48653692348707 21.460943748333776 25.113303119168222 27.93921620901093 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 1.0 28 2.0 29 4.0 30 6.0 31 11.5 32 20.5 33 27.0 34 30.0 35 36.0 36 58.0 37 77.0 38 86.0 39 125.5 40 166.5 41 178.0 42 179.0 43 189.5 44 208.5 45 225.0 46 237.5 47 225.5 48 204.0 49 200.0 50 201.0 51 199.0 52 187.0 53 170.0 54 160.0 55 157.5 56 145.5 57 124.0 58 117.0 59 120.5 60 120.5 61 113.5 62 108.5 63 108.0 64 96.5 65 86.0 66 76.5 67 63.5 68 57.5 69 54.0 70 53.0 71 51.0 72 43.0 73 37.5 74 32.0 75 24.5 76 20.0 77 14.5 78 10.5 79 7.0 80 5.0 81 2.0 82 1.5 83 2.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.05 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0125 56-57 0.0 58-59 0.08752188047011752 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.012510947078693858 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 57 1.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 0.0 70 1.0 71 1.0 72 4.0 73 7.0 74 29.0 75 204.0 76 3751.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.075 0.0 0.0 0.0 0.0 63 0.075 0.0 0.0 0.0 0.0 64 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295074 READS because READLEN < 1 Read 1295074 spots for SRR24195886.sra Written 1295074 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra Rejected 1295066 READS because READLEN < 1 Read 1295066 spots for SRR24195886.sra Written 1295066 spots for SRR24195886.sra SRR ids: ['SRR24195886.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l67tqpln SRR24195886.sra spots: 25901328 blocks: [[1, 1295066], [1295067, 2590132], [2590133, 3885198], [3885199, 5180264], [5180265, 6475330], [6475331, 7770396], [7770397, 9065462], [9065463, 10360528], [10360529, 11655594], [11655595, 12950660], [12950661, 14245726], [14245727, 15540792], [15540793, 16835858], [16835859, 18130924], [18130925, 19425990], [19425991, 20721056], [20721057, 22016122], [22016123, 23311188], [23311189, 24606254], [24606255, 25901328]] SRR24195886 file size 4956113 SRR24195886 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195886 SRR24195886_1.fastq Input file: SRR24195886_1.fastq trimmed: SRR24195886-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:12:26 2024 >> started Fri Dec 6 20:13:19 2024 >> done (53.079s) 25901328 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 2 ( 0.00%) empty reads filtered out after trimming by size control 25901326 (100.00%) reads available; of these: 8 ( 0.00%) trimmed reads available after processing 25901318 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 30 42 0.00% 31 58 0.00% 32 59 0.00% 33 70 0.00% 34 75 0.00% 35 109 0.00% 36 101 0.00% 37 123 0.00% 38 171 0.00% 39 198 0.00% 40 220 0.00% 41 261 0.00% 42 344 0.00% 43 332 0.00% 44 348 0.00% 45 381 0.00% 46 496 0.00% 47 572 0.00% 48 674 0.00% 49 875 0.00% 50 1003 0.00% 51 1199 0.00% 52 1476 0.01% 53 1553 0.01% 54 1713 0.01% 55 1985 0.01% 56 2060 0.01% 57 2329 0.01% 58 2891 0.01% 59 3261 0.01% 60 125 0.00% 61 179 0.00% 62 182 0.00% 63 294 0.00% 64 356 0.00% 65 441 0.00% 66 521 0.00% 67 803 0.00% 68 1174 0.00% 69 1986 0.01% 70 3292 0.01% 71 6773 0.03% 72 16016 0.06% 73 47055 0.18% 74 186568 0.72% 75 1375880 5.31% 76 24234702 93.57% 25901326 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=23 prefix-density=0.35 prefix-fanout=2.0 sequence=GGGGAGGCCGGCGGTGGACTTGAGGCCCTGGAAAGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=7.58 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=1.5 sequence=GATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTT Started job on | Dec 06 20:13:42 Started mapping on | Dec 06 20:13:43 Finished on | Dec 06 20:14:53 Mapping speed, Million of reads per hour | 1332.07 Number of input reads | 25901326 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 25365211 Uniquely mapped reads % | 97.93% Average mapped length | 75.63 Number of splices: Total | 6474693 Number of splices: Annotated (sjdb) | 6184003 Number of splices: GT/AG | 6389622 Number of splices: GC/AG | 75760 Number of splices: AT/AC | 3029 Number of splices: Non-canonical | 6282 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409564 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 2458 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 126551 126551 126551 N_multimapping 409564 409564 409564 N_noFeature 620640 24853066 770977 N_ambiguous 405962 1917 45010 UnstrandedReadsAssigned:24338609 PositiveStrandReadsAssigned:510228 NegativeStrandReadsAssigned:24549224 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195886 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195886-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,901,326 reads, 24,727,751 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR24195886.ke.tsv 35125 SRR24195886.se.tsv 88098 total ==> SRR24195886.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 39.1947 2.87338 PNS24247 1044 945 40.9269 2.65747 PNS24249 1928 1829 214.353 7.19129 PNS24246 1044 945 40.9269 2.65747 PNS24248 1044 945 40.9269 2.65747 PNS24244 1471 1372 55.6721 2.48986 PNS24243 293 194 0 0 KQK14069 1603 1504 3723.56 151.915 KQK14071 474 375 822.912 134.652 ==> SRR24195886.se.tsv <== BRADI_1g14170v3 4693 BRADI_1g53295v3 19 BRADI_1g59795v3 256 BRADI_1g07683v3 0 BRADI_1g00485v3 62 BRADI_1g20270v3 3547 BRADI_1g74790v3 251 BRADI_1g09890v3 10 BRADI_1g77505v3 385 BRADI_1g48960v3 0 SRR24195886 completed mapping pipeline successfully