Starting /dee2/code/volunteer_pipeline.sh SRR24195887 current disk space = 1549585776640 free memory = 1599768588 SRR24195887 SRAfilesize 8c83efcbfb347f808b9807955c630d62 SRR24195887.sra SRR24195887.sra file validated SRR24195887 is single end SRR24195887 is conventional basespace SRR24195887 read1 length is 43-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195887_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 43-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.83675 32.0 32.0 32.0 32.0 32.0 2 31.48675 32.0 32.0 32.0 32.0 32.0 3 31.6265 32.0 32.0 32.0 32.0 32.0 4 31.699 32.0 32.0 32.0 32.0 32.0 5 31.74225 32.0 32.0 32.0 32.0 32.0 6 35.1315 36.0 36.0 36.0 36.0 36.0 7 35.252 36.0 36.0 36.0 36.0 36.0 8 35.09725 36.0 36.0 36.0 36.0 36.0 9 35.24025 36.0 36.0 36.0 36.0 36.0 10-11 35.179125 36.0 36.0 36.0 36.0 36.0 12-13 35.231875 36.0 36.0 36.0 36.0 36.0 14-15 35.162875 36.0 36.0 36.0 36.0 36.0 16-17 35.199124999999995 36.0 36.0 36.0 36.0 36.0 18-19 35.243375 36.0 36.0 36.0 36.0 36.0 20-21 35.164 36.0 36.0 36.0 36.0 36.0 22-23 35.206374999999994 36.0 36.0 36.0 36.0 36.0 24-25 35.126125 36.0 36.0 36.0 36.0 36.0 26-27 35.17 36.0 36.0 36.0 36.0 36.0 28-29 35.096875 36.0 36.0 36.0 36.0 36.0 30-31 35.107 36.0 36.0 36.0 36.0 36.0 32-33 35.084125 36.0 36.0 36.0 36.0 36.0 34-35 35.018125 36.0 36.0 36.0 36.0 36.0 36-37 34.97025 36.0 36.0 36.0 36.0 36.0 38-39 35.0035 36.0 36.0 36.0 36.0 36.0 40-41 35.032375 36.0 36.0 36.0 36.0 36.0 42-43 35.005750000000006 36.0 36.0 36.0 36.0 36.0 44-45 34.90360090022506 36.0 36.0 36.0 36.0 36.0 46-47 34.945736434108525 36.0 36.0 36.0 36.0 36.0 48-49 34.89697424356089 36.0 36.0 36.0 36.0 36.0 50-51 35.011877969492375 36.0 36.0 36.0 36.0 36.0 52-53 34.908352088022006 36.0 36.0 36.0 34.0 36.0 54-55 34.9282320580145 36.0 36.0 36.0 32.0 36.0 56-57 34.94959811113358 36.0 36.0 36.0 34.0 36.0 58-59 34.84904952476238 36.0 36.0 36.0 34.0 36.0 60-61 34.817408704352175 36.0 36.0 36.0 36.0 36.0 62-63 34.806028014007005 36.0 36.0 36.0 32.0 36.0 64-65 34.80365182591296 36.0 36.0 36.0 34.0 36.0 66-67 34.848299149574785 36.0 36.0 36.0 36.0 36.0 68-69 34.729989994997496 36.0 36.0 36.0 34.0 36.0 70-71 34.74420685449054 36.0 36.0 36.0 32.0 36.0 72-73 34.731231231231234 36.0 36.0 36.0 34.0 36.0 74-75 34.64892021597583 36.0 36.0 36.0 32.0 36.0 76 35.07085346215781 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 5.0 24 9.0 25 4.0 26 16.0 27 19.0 28 47.0 29 56.0 30 80.0 31 88.0 32 126.0 33 201.0 34 455.0 35 2890.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.650000000000006 11.75 10.174999999999999 44.425 2 22.0 11.774999999999999 31.4 34.825 3 20.525 13.675 23.025000000000002 42.775 4 26.55 18.175 19.6 35.675000000000004 5 28.175 22.8 22.925 26.1 6 27.0 26.200000000000003 22.375 24.425 7 21.725 25.5 33.425 19.35 8 22.475 23.425 28.4 25.7 9 21.7 22.725 29.95 25.624999999999996 10-11 23.65 28.9375 23.799999999999997 23.6125 12-13 25.13442540952857 23.533825184444165 25.24696761285482 26.08478179317244 14-15 24.55 24.337500000000002 25.087500000000002 26.025 16-17 24.087500000000002 24.887500000000003 24.275 26.75 18-19 25.2625 24.3 23.1625 27.275 20-21 24.071526822558457 24.19657371514318 24.871826935100664 26.860072527197698 22-23 24.375 24.587500000000002 24.55 26.487500000000004 24-25 24.975 23.275000000000002 24.825 26.924999999999997 26-27 23.875 24.75 24.675 26.700000000000003 28-29 25.18129532383096 24.23105776444111 23.818454613653415 26.76919229807452 30-31 25.1 24.925 23.625 26.35 32-33 24.1125 24.25 24.3875 27.250000000000004 34-35 25.0 22.787499999999998 25.025 27.187499999999996 36-37 25.3 23.974999999999998 24.075 26.650000000000002 38-39 25.2375 23.4625 24.099999999999998 27.200000000000003 40-41 25.7125 24.474999999999998 23.5625 26.25 42-43 24.85 23.8125 23.6875 27.650000000000002 44-45 24.76869217304326 24.18104526131533 24.3935983995999 26.65666416604151 46-47 25.71607254534084 24.202626641651033 23.402126328955596 26.67917448405253 48-49 25.18129532383096 24.256064016004 23.78094523630908 26.78169542385596 50-51 24.893723430857715 23.918479619904975 25.10627656914228 26.081520380095025 52-53 25.318829707426854 23.543385846461614 24.60615153788447 26.531632908227053 54-55 26.35397123202001 23.564727954971858 23.827392120075046 26.25390869293308 56-57 24.034012754783042 23.308740777791673 24.796798799549833 27.860447667875455 58-59 24.53066332916145 24.25531914893617 24.380475594493117 26.83354192740926 60-61 25.975487743871934 23.186593296648326 23.736868434217108 27.101050525262632 62-63 25.250125062531264 24.049524762381193 23.774387193596798 26.92596298149075 64-65 25.46273136568284 24.212106053026513 23.411705852926463 26.91345672836418 66-67 25.212606303151574 23.449224612306153 24.68734367183592 26.650825412706354 68-69 25.250125062531264 23.111555777888945 24.19959979989995 27.43871935967984 70-71 25.575575575575577 23.7987987987988 24.236736736736734 26.38888888888889 72-73 25.813313313313312 23.235735735735734 24.11161161161161 26.83933933933934 74-75 24.990557723781947 23.404255319148938 24.323303537706156 27.281883419362963 76 25.577026301663984 23.161567364465917 23.778851315083198 27.482555018786904 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 3.5 26 2.5 27 2.5 28 5.5 29 7.0 30 6.5 31 12.0 32 16.0 33 14.0 34 25.5 35 41.5 36 53.0 37 60.5 38 75.0 39 99.5 40 132.0 41 158.0 42 164.0 43 188.0 44 217.0 45 221.5 46 218.5 47 232.0 48 231.0 49 209.5 50 202.5 51 196.0 52 180.0 53 151.0 54 131.0 55 132.0 56 130.0 57 122.0 58 121.0 59 122.5 60 126.5 61 129.0 62 126.0 63 114.5 64 99.0 65 88.0 66 75.5 67 69.5 68 74.5 69 73.5 70 62.5 71 59.0 72 53.0 73 45.5 74 35.5 75 24.0 76 21.0 77 19.5 78 14.0 79 9.0 80 7.0 81 4.5 82 3.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0375 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0375 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.037509377344336084 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.037509377344336084 56-57 0.0 58-59 0.0750375187593797 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0375234521575985 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 43 1.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 1.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 7.0 74 35.0 75 228.0 76 3726.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407537 READS because READLEN < 1 Read 1407537 spots for SRR24195887.sra Written 1407537 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra Rejected 1407532 READS because READLEN < 1 Read 1407532 spots for SRR24195887.sra Written 1407532 spots for SRR24195887.sra SRR ids: ['SRR24195887.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4p9mm9rm SRR24195887.sra spots: 28150645 blocks: [[1, 1407532], [1407533, 2815064], [2815065, 4222596], [4222597, 5630128], [5630129, 7037660], [7037661, 8445192], [8445193, 9852724], [9852725, 11260256], [11260257, 12667788], [12667789, 14075320], [14075321, 15482852], [15482853, 16890384], [16890385, 18297916], [18297917, 19705448], [19705449, 21112980], [21112981, 22520512], [22520513, 23928044], [23928045, 25335576], [25335577, 26743108], [26743109, 28150645]] SRR24195887 file size 5388723 SRR24195887 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195887 SRR24195887_1.fastq Input file: SRR24195887_1.fastq trimmed: SRR24195887-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:13:40 2024 >> started Fri Dec 6 20:13:54 2024 >> done (13.744s) 28150645 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 28150642 (100.00%) reads available; of these: 6 ( 0.00%) trimmed reads available after processing 28150636 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 30 35 0.00% 31 38 0.00% 32 40 0.00% 33 58 0.00% 34 50 0.00% 35 62 0.00% 36 77 0.00% 37 88 0.00% 38 98 0.00% 39 123 0.00% 40 131 0.00% 41 176 0.00% 42 189 0.00% 43 219 0.00% 44 225 0.00% 45 249 0.00% 46 296 0.00% 47 342 0.00% 48 426 0.00% 49 545 0.00% 50 642 0.00% 51 769 0.00% 52 942 0.00% 53 1015 0.00% 54 1162 0.00% 55 1267 0.00% 56 1321 0.00% 57 1620 0.01% 58 1864 0.01% 59 2167 0.01% 60 107 0.00% 61 139 0.00% 62 157 0.00% 63 214 0.00% 64 340 0.00% 65 393 0.00% 66 605 0.00% 67 963 0.00% 68 1305 0.00% 69 2351 0.01% 70 4182 0.01% 71 8584 0.03% 72 19786 0.07% 73 55189 0.20% 74 213800 0.76% 75 1529033 5.43% 76 26297258 93.42% 28150642 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=2.0 sequence=GGGGAGGCCGGCGGTGGACTTGAGGCCCTGGAAAGGGGCCACGGAGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=8.26 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=1.5 sequence=GATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTT Started job on | Dec 06 20:14:17 Started mapping on | Dec 06 20:14:17 Finished on | Dec 06 20:14:38 Mapping speed, Million of reads per hour | 4825.82 Number of input reads | 28150642 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 27532489 Uniquely mapped reads % | 97.80% Average mapped length | 75.65 Number of splices: Total | 7076506 Number of splices: Annotated (sjdb) | 6760693 Number of splices: GT/AG | 6981642 Number of splices: GC/AG | 84583 Number of splices: AT/AC | 3441 Number of splices: Non-canonical | 6840 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433391 % of reads mapped to multiple loci | 1.54% Number of reads mapped to too many loci | 2683 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.65% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 184762 184762 184762 N_multimapping 433391 433391 433391 N_noFeature 694686 26968560 859556 N_ambiguous 446669 1896 48654 UnstrandedReadsAssigned:26391134 PositiveStrandReadsAssigned:562033 NegativeStrandReadsAssigned:26624279 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195887 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195887-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,150,642 reads, 26,802,964 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,193 rounds 52973 SRR24195887.ke.tsv 35125 SRR24195887.se.tsv 88098 total ==> SRR24195887.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 7.13388 0.488454 PNS24247 1044 945 76.9459 4.66635 PNS24249 1928 1829 223.686 7.00887 PNS24246 1044 945 76.9459 4.66635 PNS24248 1044 945 76.9459 4.66635 PNS24244 1471 1372 26.3426 1.10034 PNS24243 293 194 0 0 KQK14069 1603 1504 5614.35 213.932 KQK14071 474 375 1320.49 201.803 ==> SRR24195887.se.tsv <== BRADI_1g14170v3 7216 BRADI_1g53295v3 31 BRADI_1g59795v3 271 BRADI_1g07683v3 0 BRADI_1g00485v3 65 BRADI_1g20270v3 3713 BRADI_1g74790v3 263 BRADI_1g09890v3 9 BRADI_1g77505v3 423 BRADI_1g48960v3 0 SRR24195887 completed mapping pipeline successfully