Starting /dee2/code/volunteer_pipeline.sh SRR24195888 current disk space = 1549577711616 free memory = 1392830692 SRR24195888 SRAfilesize 31f47973438debc04547200bb56e8b79 SRR24195888.sra SRR24195888.sra file validated SRR24195888 is single end SRR24195888 is conventional basespace SRR24195888 read1 length is 47-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195888_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 47-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.856 32.0 32.0 32.0 32.0 32.0 2 31.588 32.0 32.0 32.0 32.0 32.0 3 31.629 32.0 32.0 32.0 32.0 32.0 4 31.64875 32.0 32.0 32.0 32.0 32.0 5 31.71575 32.0 32.0 32.0 32.0 32.0 6 35.13425 36.0 36.0 36.0 36.0 36.0 7 35.0985 36.0 36.0 36.0 36.0 36.0 8 35.1285 36.0 36.0 36.0 36.0 36.0 9 35.1655 36.0 36.0 36.0 36.0 36.0 10-11 35.185125 36.0 36.0 36.0 36.0 36.0 12-13 35.141000000000005 36.0 36.0 36.0 36.0 36.0 14-15 35.138125 36.0 36.0 36.0 36.0 36.0 16-17 35.098375000000004 36.0 36.0 36.0 36.0 36.0 18-19 35.128625 36.0 36.0 36.0 36.0 36.0 20-21 35.091 36.0 36.0 36.0 36.0 36.0 22-23 35.171875 36.0 36.0 36.0 36.0 36.0 24-25 35.149625 36.0 36.0 36.0 36.0 36.0 26-27 35.137125 36.0 36.0 36.0 36.0 36.0 28-29 35.054625 36.0 36.0 36.0 36.0 36.0 30-31 35.059875 36.0 36.0 36.0 36.0 36.0 32-33 35.02675000000001 36.0 36.0 36.0 36.0 36.0 34-35 35.037375 36.0 36.0 36.0 36.0 36.0 36-37 35.002875 36.0 36.0 36.0 36.0 36.0 38-39 35.059124999999995 36.0 36.0 36.0 36.0 36.0 40-41 34.974000000000004 36.0 36.0 36.0 36.0 36.0 42-43 34.992875 36.0 36.0 36.0 36.0 36.0 44-45 34.914625 36.0 36.0 36.0 36.0 36.0 46-47 35.01725 36.0 36.0 36.0 36.0 36.0 48-49 34.96423211605803 36.0 36.0 36.0 36.0 36.0 50-51 35.00087543771886 36.0 36.0 36.0 36.0 36.0 52-53 35.01425712856428 36.0 36.0 36.0 36.0 36.0 54-55 34.959479739869934 36.0 36.0 36.0 36.0 36.0 56-57 34.87781390695348 36.0 36.0 36.0 34.0 36.0 58-59 34.843171585792895 36.0 36.0 36.0 34.0 36.0 60-61 34.8344172086043 36.0 36.0 36.0 34.0 36.0 62-63 34.83004002001 36.0 36.0 36.0 36.0 36.0 64-65 34.717483741870936 36.0 36.0 36.0 34.0 36.0 66-67 34.683841920960475 36.0 36.0 36.0 32.0 36.0 68-69 34.62006003001501 36.0 36.0 36.0 32.0 36.0 70-71 34.74424712356178 36.0 36.0 36.0 32.0 36.0 72-73 34.71636803128398 36.0 36.0 36.0 32.0 36.0 74-75 34.689391193681274 36.0 36.0 36.0 32.0 36.0 76 35.12600969305331 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 5.0 23 7.0 24 6.0 25 17.0 26 11.0 27 22.0 28 40.0 29 61.0 30 58.0 31 96.0 32 135.0 33 203.0 34 452.0 35 2886.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.550000000000004 10.975 9.1 47.375 2 22.275 12.575 31.4 33.75 3 21.7 12.55 22.85 42.9 4 25.825 18.475 20.974999999999998 34.725 5 28.4 23.674999999999997 22.400000000000002 25.525 6 26.525 27.075 21.975 24.425 7 20.5 27.224999999999998 32.7 19.575 8 21.675 23.875 29.525000000000002 24.925 9 21.625 23.575 30.75 24.05 10-11 24.587500000000002 29.125 22.675 23.6125 12-13 25.106329747310486 23.15486614961221 24.981235926945207 26.7575681761321 14-15 24.15 24.05 25.525 26.275 16-17 24.4125 24.375 24.4375 26.775 18-19 23.599999999999998 24.75 24.7375 26.9125 20-21 24.618654663665918 24.568642160540136 24.318579644911228 26.494123530882717 22-23 24.675 24.4875 24.712500000000002 26.125 24-25 25.25 23.974999999999998 24.1375 26.637499999999996 26-27 23.7 24.6875 24.725 26.887499999999996 28-29 24.253031628953618 25.328166020752597 24.190523815476936 26.22827853481685 30-31 25.5125 23.1625 24.3625 26.9625 32-33 24.3 23.7125 24.4 27.5875 34-35 23.799999999999997 24.349999999999998 24.4375 27.4125 36-37 25.25 23.5125 24.5625 26.674999999999997 38-39 24.875 23.549999999999997 25.337500000000002 26.237500000000004 40-41 24.5375 24.1625 25.074999999999996 26.224999999999998 42-43 24.0 24.337500000000002 23.95 27.712500000000002 44-45 25.025 23.8875 24.1625 26.924999999999997 46-47 26.26578322290286 23.71546443305413 24.04050506313289 25.978247280910118 48-49 25.662831415707853 24.674837418709355 23.3991995997999 26.263131565782892 50-51 24.674837418709355 24.224612306153077 24.662331165582792 26.43821910955478 52-53 25.80040020010005 24.149574787393696 22.861430715357677 27.188594297148573 54-55 25.77861163227017 23.214509068167605 23.764853033145716 27.24202626641651 56-57 24.16208104052026 24.037018509254626 24.58729364682341 27.213606803401703 58-59 23.78033525143858 25.01876407305479 24.83112334250688 26.36977733299975 60-61 24.72486243121561 23.299149574787396 24.599799899949975 27.37618809404702 62-63 25.287643821910955 23.62431215607804 24.16208104052026 26.92596298149075 64-65 25.275137568784395 23.911955977988995 23.51175587793897 27.301150575287643 66-67 24.96248124062031 23.449224612306153 24.037018509254626 27.55127563781891 68-69 25.137568784392194 23.59929964982491 24.412206103051524 26.850925462731368 70-71 25.78789394697349 24.112056028014006 24.112056028014006 25.987993996998497 72-73 25.57266241081487 23.77018400300413 24.333458505444987 26.32369508073601 74-75 25.697689102159366 23.39941911857558 23.639348402576083 27.263543376688975 76 25.63274098007539 22.859450726979 23.909531502423263 27.59827679052235 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.0 24 1.5 25 2.0 26 2.5 27 4.0 28 4.0 29 3.0 30 4.5 31 12.0 32 18.5 33 19.5 34 27.5 35 43.0 36 63.0 37 76.5 38 80.5 39 99.0 40 130.0 41 162.5 42 181.5 43 193.5 44 219.5 45 222.5 46 212.0 47 219.5 48 226.5 49 213.0 50 196.5 51 179.5 52 170.0 53 166.5 54 156.0 55 149.0 56 141.0 57 127.5 58 117.5 59 123.5 60 126.0 61 124.0 62 123.5 63 106.5 64 86.0 65 79.0 66 81.5 67 86.5 68 79.5 69 65.5 70 55.0 71 51.5 72 45.5 73 43.5 74 36.0 75 24.5 76 26.0 77 21.5 78 11.5 79 7.5 80 6.5 81 3.5 82 1.0 83 0.5 84 1.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.075 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.01250625312656328 56-57 0.0 58-59 0.02501250625312656 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 47 2.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 1.0 72 5.0 73 15.0 74 35.0 75 228.0 76 3714.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4271356783919598 0.8500000000000001 3 0.0 0.0 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662537 READS because READLEN < 1 Read 1662537 spots for SRR24195888.sra Written 1662537 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra Rejected 1662532 READS because READLEN < 1 Read 1662532 spots for SRR24195888.sra Written 1662532 spots for SRR24195888.sra SRR ids: ['SRR24195888.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iow0iylt SRR24195888.sra spots: 33250645 blocks: [[1, 1662532], [1662533, 3325064], [3325065, 4987596], [4987597, 6650128], [6650129, 8312660], [8312661, 9975192], [9975193, 11637724], [11637725, 13300256], [13300257, 14962788], [14962789, 16625320], [16625321, 18287852], [18287853, 19950384], [19950385, 21612916], [21612917, 23275448], [23275449, 24937980], [24937981, 26600512], [26600513, 28263044], [28263045, 29925576], [29925577, 31588108], [31588109, 33250645]] SRR24195888 file size 6368674 SRR24195888 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195888 SRR24195888_1.fastq Input file: SRR24195888_1.fastq trimmed: SRR24195888-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:16:24 2024 >> started Fri Dec 6 20:16:43 2024 >> done (18.609s) 33250645 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 8 ( 0.00%) empty reads filtered out after trimming by size control 33250637 (100.00%) reads available; of these: 8 ( 0.00%) trimmed reads available after processing 33250629 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 39 0.00% 31 44 0.00% 32 55 0.00% 33 55 0.00% 34 63 0.00% 35 72 0.00% 36 73 0.00% 37 98 0.00% 38 83 0.00% 39 133 0.00% 40 152 0.00% 41 178 0.00% 42 227 0.00% 43 257 0.00% 44 284 0.00% 45 291 0.00% 46 335 0.00% 47 393 0.00% 48 536 0.00% 49 656 0.00% 50 822 0.00% 51 926 0.00% 52 1225 0.00% 53 1380 0.00% 54 1429 0.00% 55 1609 0.00% 56 1739 0.01% 57 2015 0.01% 58 2603 0.01% 59 2787 0.01% 60 139 0.00% 61 169 0.00% 62 233 0.00% 63 311 0.00% 64 421 0.00% 65 536 0.00% 66 748 0.00% 67 1165 0.00% 68 1867 0.01% 69 3155 0.01% 70 5365 0.02% 71 11200 0.03% 72 25092 0.08% 73 70339 0.21% 74 263595 0.79% 75 1844595 5.55% 76 31001146 93.23% 33250637 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=2.1 sequence=GGGGAGGCCGGCGGTGGACTTGAGGCCCTGGAAAGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=8.81 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=1.6 sequence=GATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTT Started job on | Dec 06 20:17:11 Started mapping on | Dec 06 20:17:11 Finished on | Dec 06 20:17:45 Mapping speed, Million of reads per hour | 3520.66 Number of input reads | 33250637 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 32461793 Uniquely mapped reads % | 97.63% Average mapped length | 75.64 Number of splices: Total | 8168822 Number of splices: Annotated (sjdb) | 7804379 Number of splices: GT/AG | 8059827 Number of splices: GC/AG | 96972 Number of splices: AT/AC | 3994 Number of splices: Non-canonical | 8029 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514321 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 3138 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.81% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 274523 274523 274523 N_multimapping 514321 514321 514321 N_noFeature 818898 31793576 1025363 N_ambiguous 516923 2326 56335 UnstrandedReadsAssigned:31125972 PositiveStrandReadsAssigned:665891 NegativeStrandReadsAssigned:31380095 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195888 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195888-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,250,637 reads, 31,587,789 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,299 rounds 52973 SRR24195888.ke.tsv 35125 SRR24195888.se.tsv 88098 total ==> SRR24195888.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 149.64 8.67829 PNS24247 1044 945 32.3291 1.66063 PNS24249 1928 1829 307.935 8.17253 PNS24246 1044 945 32.3291 1.66063 PNS24248 1044 945 32.3291 1.66063 PNS24244 1471 1372 7.4374 0.263135 PNS24243 293 194 0 0 KQK14069 1603 1504 2485.61 80.2224 KQK14071 474 375 691.269 89.4802 ==> SRR24195888.se.tsv <== BRADI_1g14170v3 3327 BRADI_1g53295v3 35 BRADI_1g59795v3 378 BRADI_1g07683v3 0 BRADI_1g00485v3 74 BRADI_1g20270v3 4132 BRADI_1g74790v3 350 BRADI_1g09890v3 23 BRADI_1g77505v3 534 BRADI_1g48960v3 0 SRR24195888 completed mapping pipeline successfully