Starting /dee2/code/volunteer_pipeline.sh SRR24195889 current disk space = 1549511753728 free memory = 1408245844 SRR24195889 SRAfilesize 3725f59efd110963690afbf52ffe1f78 SRR24195889.sra SRR24195889.sra file validated SRR24195889 is single end SRR24195889 is conventional basespace SRR24195889 read1 length is 39-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195889_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 39-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.78675 32.0 32.0 32.0 32.0 32.0 2 31.48125 32.0 32.0 32.0 32.0 32.0 3 31.5665 32.0 32.0 32.0 32.0 32.0 4 31.61825 32.0 32.0 32.0 32.0 32.0 5 31.70775 32.0 32.0 32.0 32.0 32.0 6 35.12975 36.0 36.0 36.0 36.0 36.0 7 35.0865 36.0 36.0 36.0 36.0 36.0 8 35.16575 36.0 36.0 36.0 36.0 36.0 9 35.1145 36.0 36.0 36.0 36.0 36.0 10-11 35.130375 36.0 36.0 36.0 36.0 36.0 12-13 35.107 36.0 36.0 36.0 36.0 36.0 14-15 35.185625 36.0 36.0 36.0 36.0 36.0 16-17 35.104875 36.0 36.0 36.0 36.0 36.0 18-19 35.18425 36.0 36.0 36.0 36.0 36.0 20-21 35.09825 36.0 36.0 36.0 36.0 36.0 22-23 35.163375 36.0 36.0 36.0 36.0 36.0 24-25 35.080749999999995 36.0 36.0 36.0 36.0 36.0 26-27 35.12575 36.0 36.0 36.0 36.0 36.0 28-29 34.975875 36.0 36.0 36.0 36.0 36.0 30-31 34.954875 36.0 36.0 36.0 36.0 36.0 32-33 34.980875 36.0 36.0 36.0 36.0 36.0 34-35 34.902625 36.0 36.0 36.0 36.0 36.0 36-37 34.866749999999996 36.0 36.0 36.0 36.0 36.0 38-39 34.9045 36.0 36.0 36.0 34.0 36.0 40-41 34.94086021505376 36.0 36.0 36.0 36.0 36.0 42-43 34.8503375843961 36.0 36.0 36.0 34.0 36.0 44-45 34.856464116029 36.0 36.0 36.0 34.0 36.0 46-47 34.864932466233114 36.0 36.0 36.0 32.0 36.0 48-49 34.81690845422711 36.0 36.0 36.0 32.0 36.0 50-51 34.89369684842421 36.0 36.0 36.0 34.0 36.0 52-53 34.82151180043362 36.0 36.0 36.0 32.0 36.0 54-55 34.79495858129833 36.0 36.0 36.0 32.0 36.0 56-57 34.79652321282484 36.0 36.0 36.0 32.0 36.0 58-59 34.769461827284104 36.0 36.0 36.0 34.0 36.0 60-61 34.77679018527792 36.0 36.0 36.0 32.0 36.0 62-63 34.67338507761642 36.0 36.0 36.0 32.0 36.0 64-65 34.69404106159239 36.0 36.0 36.0 32.0 36.0 66-67 34.691247960094415 36.0 36.0 36.0 32.0 36.0 68-69 34.60005008765339 36.0 36.0 36.0 32.0 36.0 70-71 34.61402591684747 36.0 36.0 36.0 32.0 36.0 72-73 34.60585039309228 36.0 36.0 36.0 32.0 36.0 74-75 34.607656179466375 36.0 36.0 36.0 32.0 36.0 76 35.07470010905126 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 3.0 24 7.0 25 15.0 26 17.0 27 27.0 28 53.0 29 58.0 30 76.0 31 108.0 32 143.0 33 226.0 34 483.0 35 2782.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.2 10.025 10.5 45.275 2 22.2 10.725 31.55 35.525 3 21.125 14.099999999999998 21.025 43.75 4 26.075 19.775000000000002 19.925 34.225 5 27.750000000000004 24.075 22.400000000000002 25.775 6 27.1 27.750000000000004 22.400000000000002 22.75 7 22.400000000000002 24.575 33.45 19.575 8 21.825 24.45 27.625 26.1 9 21.125 22.125 32.05 24.7 10-11 25.0625 27.150000000000002 23.7625 24.025 12-13 25.56597873671044 22.201375859912446 25.8411507191995 26.391494684177612 14-15 24.1625 23.4125 25.087500000000002 27.3375 16-17 25.95 23.150000000000002 24.7 26.200000000000003 18-19 25.4375 23.3125 24.25 27.0 20-21 25.881470367591895 24.15603900975244 23.518379594898725 26.44411102775694 22-23 25.474999999999998 24.1375 24.0375 26.35 24-25 25.5375 22.975 23.4375 28.050000000000004 26-27 24.587500000000002 24.3 25.45 25.662499999999998 28-29 26.5 23.125 23.974999999999998 26.400000000000002 30-31 24.887500000000003 24.5 24.337500000000002 26.275 32-33 25.362499999999997 23.1375 24.275 27.224999999999998 34-35 25.912499999999998 22.825 24.6 26.6625 36-37 25.85 23.125 24.3 26.724999999999998 38-39 25.337500000000002 23.0875 23.974999999999998 27.6 40-41 25.431357839459867 22.605651412853213 24.456114028507127 27.506876719179797 42-43 25.206301575393848 23.893473368342086 24.081020255063766 26.819204801200303 44-45 25.218804701175294 22.380595148787197 25.09377344336084 27.306826706676667 46-47 25.691056910569106 23.477173233270797 24.702939337085677 26.12883051907442 48-49 24.83741870935468 23.261630815407706 24.58729364682341 27.313656828414207 50-51 25.30015007503752 23.449224612306153 24.387193596798397 26.863431715857928 52-53 25.90368980612883 22.989368355222016 23.814884302689183 27.292057535959973 54-55 26.63913913913914 23.223223223223226 23.31081081081081 26.826826826826828 56-57 25.566262044800403 23.61406582405206 23.68915029408084 27.130521837066702 58-59 25.96719669462877 23.81369725804432 24.289470389382746 25.92963565794416 60-61 26.189283925888834 23.673009514271406 23.660490736104155 26.477215823735605 62-63 24.937406109163746 23.24737105658488 24.59939909864797 27.215823735603408 64-65 25.663495242864297 23.309964947421133 24.198798197295943 26.827741612418627 66-67 25.328659070990362 23.02491548766746 24.702641792913486 26.9437836484287 68-69 26.120711244678184 22.476834460305533 24.242424242424242 27.160030052592038 70-71 26.21164683782091 22.780212899185972 24.64621164683782 26.36192861615529 72-73 26.51961398671513 22.52161925053265 23.574382754731168 27.38438400802106 74-75 25.079164027865737 23.62254591513616 24.54718176060798 26.751108296390118 76 28.24427480916031 21.292257360959653 22.982551799345693 27.480916030534353 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 1.5 26 0.5 27 1.0 28 2.0 29 2.5 30 5.5 31 7.5 32 11.0 33 16.0 34 20.5 35 32.5 36 49.5 37 59.0 38 64.5 39 91.5 40 132.0 41 158.5 42 170.0 43 177.0 44 191.0 45 229.5 46 255.0 47 232.0 48 206.5 49 191.5 50 185.5 51 180.5 52 176.0 53 168.0 54 156.5 55 161.5 56 150.0 57 133.0 58 133.0 59 136.0 60 131.5 61 130.5 62 135.5 63 124.0 64 107.5 65 105.5 66 91.5 67 72.5 68 68.0 69 66.0 70 65.5 71 60.0 72 51.5 73 43.5 74 36.5 75 30.0 76 23.5 77 18.0 78 13.5 79 10.0 80 5.5 81 2.0 82 2.5 83 3.0 84 2.5 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0625 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.025 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.01250625312656328 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.012510947078693858 56-57 0.0 58-59 0.03754693366708385 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 39 1.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 0.0 54 1.0 55 0.0 56 1.0 57 0.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 1.0 67 0.0 68 0.0 69 0.0 70 1.0 71 2.0 72 1.0 73 16.0 74 51.0 75 254.0 76 3668.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045037 READS because READLEN < 1 Read 1045037 spots for SRR24195889.sra Written 1045037 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra Rejected 1045032 READS because READLEN < 1 Read 1045032 spots for SRR24195889.sra Written 1045032 spots for SRR24195889.sra SRR ids: ['SRR24195889.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xqu64bib SRR24195889.sra spots: 20900645 blocks: [[1, 1045032], [1045033, 2090064], [2090065, 3135096], [3135097, 4180128], [4180129, 5225160], [5225161, 6270192], [6270193, 7315224], [7315225, 8360256], [8360257, 9405288], [9405289, 10450320], [10450321, 11495352], [11495353, 12540384], [12540385, 13585416], [13585417, 14630448], [14630449, 15675480], [15675481, 16720512], [16720513, 17765544], [17765545, 18810576], [18810577, 19855608], [19855609, 20900645]] SRR24195889 file size 3994180 SRR24195889 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195889 SRR24195889_1.fastq Input file: SRR24195889_1.fastq trimmed: SRR24195889-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 19:57:34 2024 >> started Fri Dec 6 19:58:18 2024 >> done (43.856s) 20900645 reads processed; of these: 1 ( 0.00%) short reads filtered out after trimming by size control 6 ( 0.00%) empty reads filtered out after trimming by size control 20900638 (100.00%) reads available; of these: 9 ( 0.00%) trimmed reads available after processing 20900629 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 43 0.00% 31 58 0.00% 32 71 0.00% 33 80 0.00% 34 104 0.00% 35 101 0.00% 36 130 0.00% 37 126 0.00% 38 193 0.00% 39 211 0.00% 40 279 0.00% 41 340 0.00% 42 337 0.00% 43 357 0.00% 44 387 0.00% 45 462 0.00% 46 599 0.00% 47 665 0.00% 48 840 0.00% 49 1042 0.00% 50 1246 0.01% 51 1519 0.01% 52 1813 0.01% 53 1916 0.01% 54 2069 0.01% 55 2340 0.01% 56 2433 0.01% 57 2855 0.01% 58 3544 0.02% 59 4060 0.02% 60 80 0.00% 61 80 0.00% 62 118 0.00% 63 201 0.00% 64 260 0.00% 65 315 0.00% 66 462 0.00% 67 694 0.00% 68 1095 0.01% 69 1884 0.01% 70 3470 0.02% 71 7305 0.03% 72 16905 0.08% 73 47192 0.23% 74 176917 0.85% 75 1222282 5.85% 76 19391156 92.78% 20900638 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=13 prefix-density=0.44 prefix-fanout=2.2 sequence=GACGCTGCCGAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=7.29 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=1.4 sequence=GATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTT Started job on | Dec 06 19:58:44 Started mapping on | Dec 06 19:58:44 Finished on | Dec 06 20:00:13 Mapping speed, Million of reads per hour | 845.42 Number of input reads | 20900638 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 20434671 Uniquely mapped reads % | 97.77% Average mapped length | 75.59 Number of splices: Total | 5117797 Number of splices: Annotated (sjdb) | 4890031 Number of splices: GT/AG | 5049318 Number of splices: GC/AG | 60887 Number of splices: AT/AC | 2322 Number of splices: Non-canonical | 5270 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305320 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 1864 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.76% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 160647 160647 160647 N_multimapping 305320 305320 305320 N_noFeature 458401 20013960 590630 N_ambiguous 324570 1461 36992 UnstrandedReadsAssigned:19651700 PositiveStrandReadsAssigned:419250 NegativeStrandReadsAssigned:19807049 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195889 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195889-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,900,638 reads, 19,916,263 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR24195889.ke.tsv 35125 SRR24195889.se.tsv 88098 total ==> SRR24195889.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 49.7685 4.47379 PNS24247 1044 945 22.4179 1.78488 PNS24249 1928 1829 184.768 7.60079 PNS24246 1044 945 22.4179 1.78488 PNS24248 1044 945 22.4179 1.78488 PNS24244 1471 1372 18.2103 0.998642 PNS24243 293 194 0 0 KQK14069 1603 1504 1182.79 59.1707 KQK14071 474 375 294.287 59.0455 ==> SRR24195889.se.tsv <== BRADI_1g14170v3 1497 BRADI_1g53295v3 13 BRADI_1g59795v3 139 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 2749 BRADI_1g74790v3 205 BRADI_1g09890v3 11 BRADI_1g77505v3 283 BRADI_1g48960v3 0 SRR24195889 completed mapping pipeline successfully