Starting /dee2/code/volunteer_pipeline.sh SRR24195890 current disk space = 1549440827392 free memory = 1597183364 SRR24195890 SRAfilesize 161ccd6b649a22696a86bf9c9ca74889 SRR24195890.sra SRR24195890.sra file validated SRR24195890 is single end SRR24195890 is conventional basespace SRR24195890 read1 length is 36-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195890_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 36-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8985 32.0 32.0 32.0 32.0 32.0 2 31.5975 32.0 32.0 32.0 32.0 32.0 3 31.63625 32.0 32.0 32.0 32.0 32.0 4 31.66825 32.0 32.0 32.0 32.0 32.0 5 31.78325 32.0 32.0 32.0 32.0 32.0 6 35.35625 36.0 36.0 36.0 36.0 36.0 7 35.27725 36.0 36.0 36.0 36.0 36.0 8 35.25775 36.0 36.0 36.0 36.0 36.0 9 35.21575 36.0 36.0 36.0 36.0 36.0 10-11 35.191500000000005 36.0 36.0 36.0 36.0 36.0 12-13 35.19525 36.0 36.0 36.0 36.0 36.0 14-15 35.176249999999996 36.0 36.0 36.0 36.0 36.0 16-17 35.205875 36.0 36.0 36.0 36.0 36.0 18-19 35.2095 36.0 36.0 36.0 36.0 36.0 20-21 35.263875 36.0 36.0 36.0 36.0 36.0 22-23 35.193625 36.0 36.0 36.0 36.0 36.0 24-25 35.128 36.0 36.0 36.0 36.0 36.0 26-27 35.150375 36.0 36.0 36.0 36.0 36.0 28-29 35.091625 36.0 36.0 36.0 36.0 36.0 30-31 35.119125 36.0 36.0 36.0 36.0 36.0 32-33 35.12375 36.0 36.0 36.0 36.0 36.0 34-35 35.051125 36.0 36.0 36.0 36.0 36.0 36-37 35.069759846211554 36.0 36.0 36.0 36.0 36.0 38-39 35.08052013003251 36.0 36.0 36.0 36.0 36.0 40-41 35.11465366341585 36.0 36.0 36.0 36.0 36.0 42-43 35.023505876469116 36.0 36.0 36.0 36.0 36.0 44-45 34.98987246811703 36.0 36.0 36.0 36.0 36.0 46-47 35.09714928732183 36.0 36.0 36.0 36.0 36.0 48-49 35.04351087771943 36.0 36.0 36.0 36.0 36.0 50-51 35.00650162540635 36.0 36.0 36.0 36.0 36.0 52-53 34.98562140535134 36.0 36.0 36.0 36.0 36.0 54-55 34.96324081020255 36.0 36.0 36.0 34.0 36.0 56-57 34.890722680670166 36.0 36.0 36.0 32.0 36.0 58-59 34.88795635627266 36.0 36.0 36.0 36.0 36.0 60-61 34.979864932466235 36.0 36.0 36.0 36.0 36.0 62-63 34.92183591795898 36.0 36.0 36.0 36.0 36.0 64-65 34.812031015507756 36.0 36.0 36.0 36.0 36.0 66-67 34.804728546409805 36.0 36.0 36.0 36.0 36.0 68-69 34.647610708031024 36.0 36.0 36.0 32.0 36.0 70-71 34.736427320490364 36.0 36.0 36.0 32.0 36.0 72-73 34.74080100125157 36.0 36.0 36.0 34.0 36.0 74-75 34.635857846260016 36.0 36.0 36.0 32.0 36.0 76 35.18785425101215 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 3.0 24 9.0 25 13.0 26 13.0 27 27.0 28 28.0 29 40.0 30 74.0 31 91.0 32 143.0 33 187.0 34 431.0 35 2939.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.4 10.549999999999999 9.4 46.650000000000006 2 22.525000000000002 11.700000000000001 31.574999999999996 34.2 3 21.8 14.149999999999999 21.7 42.35 4 26.650000000000002 18.475 19.950000000000003 34.925 5 27.275 24.224999999999998 21.925 26.575 6 26.55 28.499999999999996 21.8 23.150000000000002 7 21.6 25.074999999999996 34.275 19.05 8 21.925 24.175 28.95 24.95 9 23.075000000000003 21.725 31.0 24.2 10-11 23.825 28.3625 23.674999999999997 24.1375 12-13 24.118529632408105 23.36834208552138 24.731182795698924 27.781945486371594 14-15 24.0625 24.2 25.525 26.2125 16-17 25.374999999999996 23.2375 24.85 26.5375 18-19 25.112499999999997 24.275 24.0375 26.575 20-21 24.9906191369606 23.214509068167605 23.72732958098812 28.067542213883677 22-23 24.85 24.0625 24.6125 26.474999999999998 24-25 24.7 23.7375 24.0 27.5625 26-27 24.4 24.3875 23.9375 27.275 28-29 25.424999999999997 24.1375 24.3125 26.125 30-31 24.55 24.6875 23.925 26.8375 32-33 25.0375 24.3875 24.2625 26.3125 34-35 25.374999999999996 22.775000000000002 24.2875 27.5625 36-37 24.640580072509064 24.0780097512189 23.740467558444806 27.54094261782723 38-39 25.85646411602901 23.88097024256064 23.768442110527634 26.494123530882717 40-41 25.10627656914228 24.056014003500874 24.493623405851466 26.344086021505376 42-43 25.318829707426854 23.268317079269817 23.830957739434858 27.581895473868467 44-45 25.693923480870218 24.193548387096776 23.568392098024507 26.544136034008503 46-47 25.42521260630315 23.949474737368686 24.324662331165584 26.300650325162582 48-49 25.03125781445361 23.755938984746187 23.830957739434858 27.38184546136534 50-51 25.506376594148538 23.80595148787197 23.793448362090523 26.894223555888974 52-53 25.581395348837212 23.78094523630908 23.830957739434858 26.806701675418854 54-55 25.275137568784395 24.16208104052026 23.411705852926463 27.151075537768882 56-57 25.456364091022753 23.705926481620406 23.53088272068017 27.306826706676667 58-59 25.309800976342473 24.02052822631118 23.219426711728627 27.450244085617726 60-61 25.362681340670335 24.412206103051524 23.54927463731866 26.675837918959477 62-63 25.42521260630315 23.724362181090545 24.58729364682341 26.263131565782892 64-65 25.962981490745374 23.411705852926463 23.949474737368686 26.675837918959477 66-67 26.019514635976982 23.430072554415812 23.14235676757568 27.408056042031525 68-69 25.31898924193145 23.555166374781088 24.055541656242184 27.070302727045288 70-71 26.36977733299975 22.779584688516387 24.030522892169127 26.82011508631474 72-73 25.65707133917397 23.416770963704632 24.09261576971214 26.83354192740926 74-75 25.749936980085707 22.586337282581294 25.38442147718679 26.27930426014621 76 25.802968960863698 22.780026990553306 23.751686909581647 27.66531713900135 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 0.5 27 2.5 28 6.5 29 8.5 30 8.0 31 8.5 32 18.5 33 28.0 34 26.0 35 31.5 36 53.0 37 66.5 38 76.0 39 94.0 40 121.0 41 156.5 42 177.0 43 196.5 44 201.5 45 196.5 46 204.0 47 214.5 48 219.5 49 213.5 50 212.0 51 209.0 52 191.5 53 163.0 54 145.5 55 145.0 56 143.0 57 132.5 58 124.5 59 119.5 60 121.5 61 124.5 62 120.5 63 115.0 64 108.5 65 101.0 66 91.0 67 83.5 68 76.5 69 69.0 70 57.5 71 48.0 72 45.5 73 43.5 74 36.0 75 29.5 76 27.5 77 21.5 78 12.0 79 6.5 80 6.5 81 4.5 82 2.0 83 1.0 84 1.0 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.025 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0625 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.025006251562890724 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025006251562890724 56-57 0.0 58-59 0.10003751406777542 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 36 1.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 53 0.0 54 0.0 55 0.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 2.0 72 0.0 73 10.0 74 36.0 75 244.0 76 3705.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378440 READS because READLEN < 1 Read 1378440 spots for SRR24195890.sra Written 1378440 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra Rejected 1378438 READS because READLEN < 1 Read 1378438 spots for SRR24195890.sra Written 1378438 spots for SRR24195890.sra SRR ids: ['SRR24195890.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hba3mj88 SRR24195890.sra spots: 27568762 blocks: [[1, 1378438], [1378439, 2756876], [2756877, 4135314], [4135315, 5513752], [5513753, 6892190], [6892191, 8270628], [8270629, 9649066], [9649067, 11027504], [11027505, 12405942], [12405943, 13784380], [13784381, 15162818], [15162819, 16541256], [16541257, 17919694], [17919695, 19298132], [19298133, 20676570], [20676571, 22055008], [22055009, 23433446], [23433447, 24811884], [24811885, 26190322], [26190323, 27568762]] SRR24195890 file size 5275813 SRR24195890 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195890 SRR24195890_1.fastq Input file: SRR24195890_1.fastq trimmed: SRR24195890-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:03:08 2024 >> started Fri Dec 6 20:03:23 2024 >> done (15.631s) 27568762 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 6 ( 0.00%) empty reads filtered out after trimming by size control 27568756 (100.00%) reads available; of these: 13 ( 0.00%) trimmed reads available after processing 27568743 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 30 65 0.00% 31 84 0.00% 32 100 0.00% 33 103 0.00% 34 107 0.00% 35 118 0.00% 36 166 0.00% 37 167 0.00% 38 216 0.00% 39 264 0.00% 40 363 0.00% 41 386 0.00% 42 421 0.00% 43 449 0.00% 44 487 0.00% 45 514 0.00% 46 606 0.00% 47 752 0.00% 48 919 0.00% 49 1148 0.00% 50 1325 0.00% 51 1721 0.01% 52 1879 0.01% 53 2106 0.01% 54 2263 0.01% 55 2310 0.01% 56 2653 0.01% 57 3058 0.01% 58 3590 0.01% 59 4197 0.02% 60 128 0.00% 61 198 0.00% 62 241 0.00% 63 345 0.00% 64 428 0.00% 65 491 0.00% 66 583 0.00% 67 957 0.00% 68 1292 0.00% 69 2213 0.01% 70 3872 0.01% 71 8093 0.03% 72 19308 0.07% 73 56257 0.20% 74 224807 0.82% 75 1616912 5.87% 76 25600094 92.86% 27568756 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=15 prefix-density=0.44 prefix-fanout=2.2 sequence=GACGCTGCCGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=11.09 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=TTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC Started job on | Dec 06 20:03:38 Started mapping on | Dec 06 20:03:38 Finished on | Dec 06 20:03:58 Mapping speed, Million of reads per hour | 4962.38 Number of input reads | 27568756 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 26975895 Uniquely mapped reads % | 97.85% Average mapped length | 75.61 Number of splices: Total | 6793429 Number of splices: Annotated (sjdb) | 6494811 Number of splices: GT/AG | 6703503 Number of splices: GC/AG | 79962 Number of splices: AT/AC | 3222 Number of splices: Non-canonical | 6742 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.73 Insertion rate per base | 0.00% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426985 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 2699 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.59% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 165876 165876 165876 N_multimapping 426985 426985 426985 N_noFeature 638179 26427650 807382 N_ambiguous 426184 1973 48577 UnstrandedReadsAssigned:25911532 PositiveStrandReadsAssigned:546272 NegativeStrandReadsAssigned:26119936 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195890 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195890-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,568,756 reads, 26,294,271 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,267 rounds 52973 SRR24195890.ke.tsv 35125 SRR24195890.se.tsv 88098 total ==> SRR24195890.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 78.4117 5.34912 PNS24247 1044 945 32.6741 1.97423 PNS24249 1928 1829 249.108 7.77679 PNS24246 1044 945 32.6741 1.97423 PNS24248 1044 945 32.6741 1.97423 PNS24244 1471 1372 9.45812 0.39362 PNS24243 293 194 0 0 KQK14069 1603 1504 2296.97 87.2035 KQK14071 474 375 490.012 74.611 ==> SRR24195890.se.tsv <== BRADI_1g14170v3 2875 BRADI_1g53295v3 22 BRADI_1g59795v3 208 BRADI_1g07683v3 0 BRADI_1g00485v3 60 BRADI_1g20270v3 3610 BRADI_1g74790v3 290 BRADI_1g09890v3 28 BRADI_1g77505v3 424 BRADI_1g48960v3 0 SRR24195890 completed mapping pipeline successfully