Starting /dee2/code/volunteer_pipeline.sh SRR24195891 current disk space = 1549574148096 free memory = 1602847100 SRR24195891 SRAfilesize 82e968e7f9ca9ff3a4e44e4eb481fa24 SRR24195891.sra SRR24195891.sra file validated SRR24195891 is single end SRR24195891 is conventional basespace SRR24195891 read1 length is 54-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195891_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 54-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.82425 32.0 32.0 32.0 32.0 32.0 2 31.52725 32.0 32.0 32.0 32.0 32.0 3 31.6405 32.0 32.0 32.0 32.0 32.0 4 31.66475 32.0 32.0 32.0 32.0 32.0 5 31.655 32.0 32.0 32.0 32.0 32.0 6 35.18425 36.0 36.0 36.0 36.0 36.0 7 35.17375 36.0 36.0 36.0 36.0 36.0 8 35.1205 36.0 36.0 36.0 36.0 36.0 9 35.145 36.0 36.0 36.0 36.0 36.0 10-11 35.169375 36.0 36.0 36.0 36.0 36.0 12-13 35.109625 36.0 36.0 36.0 36.0 36.0 14-15 35.249375 36.0 36.0 36.0 36.0 36.0 16-17 35.215125 36.0 36.0 36.0 36.0 36.0 18-19 35.197375 36.0 36.0 36.0 36.0 36.0 20-21 35.20875 36.0 36.0 36.0 36.0 36.0 22-23 35.237875 36.0 36.0 36.0 36.0 36.0 24-25 35.152375 36.0 36.0 36.0 36.0 36.0 26-27 35.153 36.0 36.0 36.0 36.0 36.0 28-29 35.04325 36.0 36.0 36.0 36.0 36.0 30-31 35.1215 36.0 36.0 36.0 36.0 36.0 32-33 35.058625 36.0 36.0 36.0 36.0 36.0 34-35 35.058 36.0 36.0 36.0 36.0 36.0 36-37 34.975875 36.0 36.0 36.0 36.0 36.0 38-39 34.97687500000001 36.0 36.0 36.0 36.0 36.0 40-41 35.017250000000004 36.0 36.0 36.0 36.0 36.0 42-43 34.98325 36.0 36.0 36.0 36.0 36.0 44-45 34.932249999999996 36.0 36.0 36.0 36.0 36.0 46-47 34.876999999999995 36.0 36.0 36.0 36.0 36.0 48-49 34.952 36.0 36.0 36.0 36.0 36.0 50-51 34.937375 36.0 36.0 36.0 36.0 36.0 52-53 35.0275 36.0 36.0 36.0 36.0 36.0 54-55 34.93973493373343 36.0 36.0 36.0 36.0 36.0 56-57 34.88947236809203 36.0 36.0 36.0 34.0 36.0 58-59 34.8304576144036 36.0 36.0 36.0 36.0 36.0 60-61 34.90285071267817 36.0 36.0 36.0 36.0 36.0 62-63 34.85621405351338 36.0 36.0 36.0 34.0 36.0 64-65 34.75831457864466 36.0 36.0 36.0 34.0 36.0 66-67 34.826831707926985 36.0 36.0 36.0 34.0 36.0 68-69 34.672336168084044 36.0 36.0 36.0 34.0 36.0 70-71 34.77226113056528 36.0 36.0 36.0 34.0 36.0 72-73 34.76054882753657 36.0 36.0 36.0 34.0 36.0 74-75 34.71108043723365 36.0 36.0 36.0 32.0 36.0 76 35.14116059379217 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 6.0 24 7.0 25 11.0 26 19.0 27 31.0 28 36.0 29 53.0 30 70.0 31 87.0 32 146.0 33 200.0 34 415.0 35 2915.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.775 10.925 9.775 45.525 2 22.25 11.95 32.45 33.35 3 21.65 13.900000000000002 22.05 42.4 4 26.525 19.075 19.85 34.55 5 27.750000000000004 24.4 22.525000000000002 25.324999999999996 6 28.525 28.349999999999998 20.424999999999997 22.7 7 20.375 25.674999999999997 34.075 19.875 8 21.975 23.425 29.5 25.1 9 23.1 21.349999999999998 32.125 23.425 10-11 24.075 28.487499999999997 23.1 24.337500000000002 12-13 24.840525328330205 22.80175109443402 25.35334584115072 27.004377736085054 14-15 24.1625 23.3875 26.2125 26.237500000000004 16-17 24.6 23.674999999999997 24.25 27.474999999999998 18-19 24.5625 24.0375 23.974999999999998 27.425 20-21 25.753595997498437 24.027517198248905 24.840525328330205 25.37836147592245 22-23 25.0375 24.275 24.25 26.437500000000004 24-25 24.875 24.05 24.5125 26.5625 26-27 25.1875 24.212500000000002 24.025 26.575 28-29 25.03125781445361 24.44361090272568 24.093523380845213 26.431607901975497 30-31 24.525 23.674999999999997 24.625 27.175 32-33 24.6625 23.2875 24.95 27.1 34-35 24.75 23.6375 24.8 26.8125 36-37 24.7875 23.175 24.5 27.537499999999998 38-39 25.2 23.8375 23.9 27.0625 40-41 24.5375 24.837500000000002 23.6375 26.987499999999997 42-43 25.4375 23.875 24.675 26.0125 44-45 24.887500000000003 23.4375 25.424999999999997 26.25 46-47 25.078134766845857 23.502937867233403 24.32804100512564 27.090886360795096 48-49 24.8125 24.6625 23.5875 26.937499999999996 50-51 24.587500000000002 24.762500000000003 24.1625 26.487500000000004 52-53 25.025 23.9375 23.9125 27.125 54-55 26.43821910955478 23.536768384192097 24.537268634317158 25.48774387193597 56-57 24.956239059764943 23.905976494123532 23.968492123030757 27.169292323080768 58-59 24.571285517586684 24.671423206909502 23.757666791838776 26.99962448366504 60-61 25.55638909727432 24.468617154288573 24.15603900975244 25.818954738684667 62-63 25.44386096524131 22.83070767691923 24.55613903475869 27.169292323080768 64-65 24.318579644911228 23.818454613653415 24.58114528632158 27.28182045511378 66-67 25.743935983995996 23.380845211302827 24.44361090272568 26.431607901975497 68-69 25.212606303151574 24.012006003001503 24.174587293646823 26.600800400200097 70-71 26.17558779389695 23.23661830915458 24.012006003001503 26.575787893946973 72-73 26.035280870761916 24.09608407356437 23.55811334918053 26.310521706493184 74-75 25.643289606458126 24.457618567103935 23.39808274470232 26.50100908173562 76 26.774628879892038 22.61808367071525 24.183535762483128 26.42375168690958 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.0 27 1.5 28 2.5 29 3.5 30 4.5 31 11.0 32 19.5 33 20.0 34 27.0 35 40.0 36 58.5 37 72.5 38 85.0 39 117.5 40 147.0 41 157.5 42 159.0 43 177.0 44 196.0 45 221.0 46 239.0 47 226.0 48 210.0 49 210.5 50 217.5 51 199.5 52 174.5 53 164.5 54 163.0 55 145.0 56 121.5 57 129.5 58 143.5 59 137.0 60 122.0 61 118.5 62 123.0 63 108.0 64 91.5 65 89.0 66 87.0 67 86.5 68 85.0 69 75.0 70 63.0 71 60.0 72 52.0 73 38.5 74 29.0 75 25.5 76 22.0 77 13.5 78 10.5 79 9.5 80 6.5 81 5.0 82 3.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0625 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0625 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.037504688086010755 56-57 0.0 58-59 0.11252813203300824 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 54 1.0 55 0.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 1.0 68 0.0 69 0.0 70 0.0 71 1.0 72 1.0 73 14.0 74 36.0 75 241.0 76 3705.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.025 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277537 READS because READLEN < 1 Read 1277537 spots for SRR24195891.sra Written 1277537 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra Rejected 1277532 READS because READLEN < 1 Read 1277532 spots for SRR24195891.sra Written 1277532 spots for SRR24195891.sra SRR ids: ['SRR24195891.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3wv8l54j SRR24195891.sra spots: 25550645 blocks: [[1, 1277532], [1277533, 2555064], [2555065, 3832596], [3832597, 5110128], [5110129, 6387660], [6387661, 7665192], [7665193, 8942724], [8942725, 10220256], [10220257, 11497788], [11497789, 12775320], [12775321, 14052852], [14052853, 15330384], [15330385, 16607916], [16607917, 17885448], [17885449, 19162980], [19162981, 20440512], [20440513, 21718044], [21718045, 22995576], [22995577, 24273108], [24273109, 25550645]] SRR24195891 file size 4888396 SRR24195891 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195891 SRR24195891_1.fastq Input file: SRR24195891_1.fastq trimmed: SRR24195891-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:16:10 2024 >> started Fri Dec 6 20:16:22 2024 >> done (11.807s) 25550645 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 25550640 (100.00%) reads available; of these: 14 ( 0.00%) trimmed reads available after processing 25550626 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 29 1 0.00% 30 74 0.00% 31 84 0.00% 32 91 0.00% 33 126 0.00% 34 93 0.00% 35 134 0.00% 36 117 0.00% 37 141 0.00% 38 155 0.00% 39 183 0.00% 40 241 0.00% 41 255 0.00% 42 260 0.00% 43 300 0.00% 44 311 0.00% 45 353 0.00% 46 403 0.00% 47 488 0.00% 48 577 0.00% 49 725 0.00% 50 901 0.00% 51 1136 0.00% 52 1260 0.00% 53 1312 0.01% 54 1458 0.01% 55 1620 0.01% 56 1793 0.01% 57 1973 0.01% 58 2309 0.01% 59 2681 0.01% 60 333 0.00% 61 371 0.00% 62 544 0.00% 63 773 0.00% 64 808 0.00% 65 863 0.00% 66 912 0.00% 67 1314 0.01% 68 1652 0.01% 69 2544 0.01% 70 4307 0.02% 71 8732 0.03% 72 19851 0.08% 73 54820 0.21% 74 206055 0.81% 75 1437138 5.62% 76 23788068 93.10% 25550640 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=17 prefix-density=0.40 prefix-fanout=2.1 sequence=GACGCTGCCGAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=7.23 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=1.5 sequence=GATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTT Started job on | Dec 06 20:16:42 Started mapping on | Dec 06 20:16:42 Finished on | Dec 06 20:17:06 Mapping speed, Million of reads per hour | 3832.60 Number of input reads | 25550640 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 24948400 Uniquely mapped reads % | 97.64% Average mapped length | 75.64 Number of splices: Total | 6341819 Number of splices: Annotated (sjdb) | 6055761 Number of splices: GT/AG | 6257352 Number of splices: GC/AG | 75252 Number of splices: AT/AC | 2994 Number of splices: Non-canonical | 6221 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 387014 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 2707 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.83% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 215226 215226 215226 N_multimapping 387014 387014 387014 N_noFeature 637389 24426153 800962 N_ambiguous 401500 1877 43910 UnstrandedReadsAssigned:23909511 PositiveStrandReadsAssigned:520370 NegativeStrandReadsAssigned:24103528 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195891 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195891-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,550,640 reads, 24,259,014 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,260 rounds 52973 SRR24195891.ke.tsv 35125 SRR24195891.se.tsv 88098 total ==> SRR24195891.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 79.0189 5.96037 PNS24247 1044 945 43.7049 2.91989 PNS24249 1928 1829 201.413 6.95252 PNS24246 1044 945 43.7049 2.91989 PNS24248 1044 945 43.7049 2.91989 PNS24244 1471 1372 40.4534 1.86152 PNS24243 293 194 0 0 KQK14069 1603 1504 3088.28 129.639 KQK14071 474 375 566.639 95.3989 ==> SRR24195891.se.tsv <== BRADI_1g14170v3 3788 BRADI_1g53295v3 19 BRADI_1g59795v3 204 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 3351 BRADI_1g74790v3 236 BRADI_1g09890v3 13 BRADI_1g77505v3 428 BRADI_1g48960v3 0 SRR24195891 completed mapping pipeline successfully