Starting /dee2/code/volunteer_pipeline.sh SRR24195892 current disk space = 1549440729088 free memory = 1598005460 SRR24195892 SRAfilesize 14256fdd6a8eed5bf29e5806b9c7093c SRR24195892.sra SRR24195892.sra file validated SRR24195892 is single end SRR24195892 is conventional basespace SRR24195892 read1 length is 53-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195892_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 53-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8585 32.0 32.0 32.0 32.0 32.0 2 31.51675 32.0 32.0 32.0 32.0 32.0 3 31.57225 32.0 32.0 32.0 32.0 32.0 4 31.683 32.0 32.0 32.0 32.0 32.0 5 31.748 32.0 32.0 32.0 32.0 32.0 6 35.32825 36.0 36.0 36.0 36.0 36.0 7 35.23725 36.0 36.0 36.0 36.0 36.0 8 35.271 36.0 36.0 36.0 36.0 36.0 9 35.30975 36.0 36.0 36.0 36.0 36.0 10-11 35.149125 36.0 36.0 36.0 36.0 36.0 12-13 35.23925 36.0 36.0 36.0 36.0 36.0 14-15 35.258875 36.0 36.0 36.0 36.0 36.0 16-17 35.304874999999996 36.0 36.0 36.0 36.0 36.0 18-19 35.201750000000004 36.0 36.0 36.0 36.0 36.0 20-21 35.196875 36.0 36.0 36.0 36.0 36.0 22-23 35.2085 36.0 36.0 36.0 36.0 36.0 24-25 35.124624999999995 36.0 36.0 36.0 36.0 36.0 26-27 35.237875 36.0 36.0 36.0 36.0 36.0 28-29 35.156375 36.0 36.0 36.0 36.0 36.0 30-31 35.098375 36.0 36.0 36.0 36.0 36.0 32-33 35.086375000000004 36.0 36.0 36.0 36.0 36.0 34-35 35.087625 36.0 36.0 36.0 36.0 36.0 36-37 35.01025 36.0 36.0 36.0 36.0 36.0 38-39 35.056625 36.0 36.0 36.0 36.0 36.0 40-41 35.058125000000004 36.0 36.0 36.0 36.0 36.0 42-43 35.034125 36.0 36.0 36.0 36.0 36.0 44-45 34.981875 36.0 36.0 36.0 36.0 36.0 46-47 35.001374999999996 36.0 36.0 36.0 36.0 36.0 48-49 34.94675 36.0 36.0 36.0 36.0 36.0 50-51 35.036375 36.0 36.0 36.0 36.0 36.0 52-53 34.96025 36.0 36.0 36.0 36.0 36.0 54-55 34.97249312328082 36.0 36.0 36.0 36.0 36.0 56-57 35.002501250625315 36.0 36.0 36.0 36.0 36.0 58-59 34.91743807855892 36.0 36.0 36.0 36.0 36.0 60-61 34.885510510510514 36.0 36.0 36.0 36.0 36.0 62-63 34.82957957957958 36.0 36.0 36.0 34.0 36.0 64-65 34.86536536536536 36.0 36.0 36.0 34.0 36.0 66-67 34.79041541541541 36.0 36.0 36.0 34.0 36.0 68-69 34.67488010538699 36.0 36.0 36.0 32.0 36.0 70-71 34.7188986232791 36.0 36.0 36.0 32.0 36.0 72-73 34.67726663087186 36.0 36.0 36.0 32.0 36.0 74-75 34.63173257651823 36.0 36.0 36.0 32.0 36.0 76 35.13638799571275 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 5.0 25 4.0 26 21.0 27 31.0 28 32.0 29 44.0 30 57.0 31 108.0 32 143.0 33 222.0 34 446.0 35 2884.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.925 9.875 9.35 46.85 2 21.8 11.600000000000001 32.925 33.675 3 20.825 13.575000000000001 22.5 43.1 4 25.974999999999998 18.95 20.225 34.849999999999994 5 28.975 23.275000000000002 22.45 25.3 6 28.1 27.400000000000002 20.925 23.575 7 21.075 24.95 34.55 19.425 8 20.674999999999997 23.175 29.475 26.674999999999997 9 21.2 21.875 31.324999999999996 25.6 10-11 25.5 27.525 24.1875 22.787499999999998 12-13 24.65924721770664 22.896086032262097 25.934725522070778 26.50994122796049 14-15 23.025000000000002 23.7875 25.9875 27.200000000000003 16-17 25.362499999999997 23.0625 24.5125 27.0625 18-19 24.637500000000003 24.224999999999998 24.25 26.887499999999996 20-21 25.04689258471927 23.77141428035513 25.221958234337876 25.959734900587723 22-23 25.35 24.0 24.2 26.450000000000003 24-25 24.9375 23.7 24.5125 26.85 26-27 25.1 23.8625 24.762500000000003 26.275 28-29 25.61570196274534 23.215401925240656 25.14064258032254 26.02825353169146 30-31 25.4375 24.0375 23.75 26.775 32-33 24.95 23.9875 24.65 26.4125 34-35 25.5125 23.225 23.925 27.3375 36-37 25.575 23.375 24.2625 26.787499999999998 38-39 25.2125 23.5625 24.337500000000002 26.887499999999996 40-41 25.374999999999996 24.0375 23.8875 26.700000000000003 42-43 24.925 23.6125 24.0625 27.400000000000002 44-45 24.962500000000002 23.35 24.75 26.937499999999996 46-47 25.478184773096636 24.21552694086761 24.028003500437556 26.2782847855982 48-49 25.6125 24.087500000000002 23.8625 26.437500000000004 50-51 25.324999999999996 23.2375 24.3875 27.05 52-53 25.75 23.3625 23.8875 27.0 54-55 25.78466925096911 23.708890834062775 23.49631111666875 27.01012879829936 56-57 24.69984992496248 24.12456228114057 24.637318659329665 26.538269134567283 58-59 25.334835398673178 23.094254600075104 24.49618225059457 27.07472775065715 60-61 25.08758758758759 23.435935935935937 24.274274274274273 27.2022022022022 62-63 25.33783783783784 22.62262262262262 24.924924924924923 27.114614614614613 64-65 25.650650650650654 22.985485485485484 24.74974974974975 26.614114114114113 66-67 26.151151151151154 23.04804804804805 23.923923923923923 26.876876876876878 68-69 24.139657114253534 23.876861469152797 24.527593542735577 27.455887873858092 70-71 26.25782227784731 24.11764705882353 23.504380475594495 26.12015018773467 72-73 25.325488232348526 23.42263395092639 23.773159739609415 27.478718077115673 74-75 25.687610396164523 22.975018925056776 24.88014130709059 26.45722937168811 76 27.116827438370844 21.2486602357985 25.32154340836013 26.312968917470524 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 5.5 29 9.0 30 7.5 31 7.0 32 13.0 33 18.0 34 23.0 35 28.5 36 50.0 37 68.5 38 74.5 39 97.5 40 121.5 41 154.0 42 179.0 43 195.0 44 216.0 45 213.0 46 204.0 47 209.5 48 221.5 49 212.0 50 196.0 51 183.0 52 178.5 53 186.0 54 184.0 55 164.0 56 138.5 57 144.0 58 153.5 59 148.0 60 132.5 61 123.5 62 129.0 63 127.0 64 109.5 65 94.0 66 80.0 67 69.5 68 70.5 69 64.0 70 57.5 71 60.0 72 57.0 73 45.0 74 33.5 75 26.0 76 18.5 77 9.5 78 5.0 79 4.0 80 4.0 81 2.5 82 1.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0375 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0375 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.012503125781445362 56-57 0.0 58-59 0.06254691018263697 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 53 1.0 54 0.0 55 1.0 56 0.0 57 1.0 58 0.0 59 1.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 0.0 72 2.0 73 14.0 74 32.0 75 215.0 76 3732.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.025 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315037 READS because READLEN < 1 Read 1315037 spots for SRR24195892.sra Written 1315037 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra Rejected 1315032 READS because READLEN < 1 Read 1315032 spots for SRR24195892.sra Written 1315032 spots for SRR24195892.sra SRR ids: ['SRR24195892.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xonzgmgv SRR24195892.sra spots: 26300645 blocks: [[1, 1315032], [1315033, 2630064], [2630065, 3945096], [3945097, 5260128], [5260129, 6575160], [6575161, 7890192], [7890193, 9205224], [9205225, 10520256], [10520257, 11835288], [11835289, 13150320], [13150321, 14465352], [14465353, 15780384], [15780385, 17095416], [17095417, 18410448], [18410449, 19725480], [19725481, 21040512], [21040513, 22355544], [22355545, 23670576], [23670577, 24985608], [24985609, 26300645]] SRR24195892 file size 5033060 SRR24195892 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195892 SRR24195892_1.fastq Input file: SRR24195892_1.fastq trimmed: SRR24195892-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:04:17 2024 >> started Fri Dec 6 20:04:29 2024 >> done (12.193s) 26300645 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 26300642 (100.00%) reads available; of these: 3 ( 0.00%) trimmed reads available after processing 26300639 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 33 0.00% 31 43 0.00% 32 35 0.00% 33 46 0.00% 34 56 0.00% 35 61 0.00% 36 68 0.00% 37 82 0.00% 38 96 0.00% 39 125 0.00% 40 125 0.00% 41 182 0.00% 42 195 0.00% 43 197 0.00% 44 219 0.00% 45 237 0.00% 46 268 0.00% 47 353 0.00% 48 442 0.00% 49 565 0.00% 50 653 0.00% 51 834 0.00% 52 919 0.00% 53 1006 0.00% 54 1140 0.00% 55 1254 0.00% 56 1407 0.01% 57 1560 0.01% 58 1929 0.01% 59 2199 0.01% 60 126 0.00% 61 167 0.00% 62 222 0.00% 63 296 0.00% 64 361 0.00% 65 461 0.00% 66 570 0.00% 67 869 0.00% 68 1219 0.00% 69 2079 0.01% 70 3627 0.01% 71 7317 0.03% 72 17424 0.07% 73 51634 0.20% 74 203847 0.78% 75 1452266 5.52% 76 24541827 93.31% 26300642 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=0.41 prefix-fanout=2.0 sequence=GGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=10.32 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=TTTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC Started job on | Dec 06 20:04:43 Started mapping on | Dec 06 20:04:43 Finished on | Dec 06 20:05:10 Mapping speed, Million of reads per hour | 3506.75 Number of input reads | 26300642 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 25758666 Uniquely mapped reads % | 97.94% Average mapped length | 75.65 Number of splices: Total | 6648023 Number of splices: Annotated (sjdb) | 6360768 Number of splices: GT/AG | 6560307 Number of splices: GC/AG | 78572 Number of splices: AT/AC | 2983 Number of splices: Non-canonical | 6161 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403035 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 1989 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.52% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 138941 138941 138941 N_multimapping 403035 403035 403035 N_noFeature 552764 25235645 698560 N_ambiguous 420780 1783 44629 UnstrandedReadsAssigned:24785122 PositiveStrandReadsAssigned:521238 NegativeStrandReadsAssigned:25015477 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195892 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195892-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,300,642 reads, 25,184,209 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR24195892.ke.tsv 35125 SRR24195892.se.tsv 88098 total ==> SRR24195892.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 126.214 8.93142 PNS24247 1044 945 21.2785 1.33367 PNS24249 1928 1829 113.586 3.67833 PNS24246 1044 945 21.2785 1.33367 PNS24248 1044 945 21.2785 1.33367 PNS24244 1471 1372 64.3645 2.77864 PNS24243 293 194 0 0 KQK14069 1603 1504 2358.47 92.8798 KQK14071 474 375 458.946 72.4885 ==> SRR24195892.se.tsv <== BRADI_1g14170v3 2913 BRADI_1g53295v3 13 BRADI_1g59795v3 216 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 3692 BRADI_1g74790v3 292 BRADI_1g09890v3 13 BRADI_1g77505v3 365 BRADI_1g48960v3 0 SRR24195892 completed mapping pipeline successfully