Starting /dee2/code/volunteer_pipeline.sh SRR24195893 current disk space = 1549504270336 free memory = 1597864964 SRR24195893 SRAfilesize 178a87a85f8775bc3a548000827ef485 SRR24195893.sra SRR24195893.sra file validated SRR24195893 is single end SRR24195893 is conventional basespace SRR24195893 read1 length is 55-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195893_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.878 32.0 32.0 32.0 32.0 32.0 2 31.5125 32.0 32.0 32.0 32.0 32.0 3 31.64275 32.0 32.0 32.0 32.0 32.0 4 31.68925 32.0 32.0 32.0 32.0 32.0 5 31.74725 32.0 32.0 32.0 32.0 32.0 6 35.25725 36.0 36.0 36.0 36.0 36.0 7 35.249 36.0 36.0 36.0 36.0 36.0 8 35.2035 36.0 36.0 36.0 36.0 36.0 9 35.22475 36.0 36.0 36.0 36.0 36.0 10-11 35.211749999999995 36.0 36.0 36.0 36.0 36.0 12-13 35.186375 36.0 36.0 36.0 36.0 36.0 14-15 35.228125 36.0 36.0 36.0 36.0 36.0 16-17 35.139624999999995 36.0 36.0 36.0 36.0 36.0 18-19 35.236625000000004 36.0 36.0 36.0 36.0 36.0 20-21 35.2145 36.0 36.0 36.0 36.0 36.0 22-23 35.28575 36.0 36.0 36.0 36.0 36.0 24-25 35.207750000000004 36.0 36.0 36.0 36.0 36.0 26-27 35.177 36.0 36.0 36.0 36.0 36.0 28-29 35.135374999999996 36.0 36.0 36.0 36.0 36.0 30-31 35.145624999999995 36.0 36.0 36.0 36.0 36.0 32-33 35.06075 36.0 36.0 36.0 36.0 36.0 34-35 35.083375 36.0 36.0 36.0 36.0 36.0 36-37 35.092 36.0 36.0 36.0 36.0 36.0 38-39 35.07425 36.0 36.0 36.0 36.0 36.0 40-41 35.057 36.0 36.0 36.0 36.0 36.0 42-43 35.112375 36.0 36.0 36.0 36.0 36.0 44-45 34.942750000000004 36.0 36.0 36.0 36.0 36.0 46-47 34.995000000000005 36.0 36.0 36.0 36.0 36.0 48-49 35.050875000000005 36.0 36.0 36.0 36.0 36.0 50-51 35.07075 36.0 36.0 36.0 36.0 36.0 52-53 34.910250000000005 36.0 36.0 36.0 36.0 36.0 54-55 34.98375 36.0 36.0 36.0 36.0 36.0 56-57 34.9904976244061 36.0 36.0 36.0 36.0 36.0 58-59 34.86046511627907 36.0 36.0 36.0 36.0 36.0 60-61 34.94361090272568 36.0 36.0 36.0 36.0 36.0 62-63 34.88847211802951 36.0 36.0 36.0 36.0 36.0 64-65 34.85783945986496 36.0 36.0 36.0 36.0 36.0 66-67 34.78132033008252 36.0 36.0 36.0 34.0 36.0 68-69 34.67212169475586 36.0 36.0 36.0 34.0 36.0 70-71 34.820629260089135 36.0 36.0 36.0 34.0 36.0 72-73 34.79725093145223 36.0 36.0 36.0 34.0 36.0 74-75 34.81661308343024 36.0 36.0 36.0 32.0 36.0 76 35.18619022031166 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 3.0 23 5.0 24 7.0 25 10.0 26 21.0 27 22.0 28 33.0 29 49.0 30 64.0 31 102.0 32 135.0 33 161.0 34 353.0 35 3031.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.075 9.65 10.6 44.675 2 22.15 11.525 32.824999999999996 33.5 3 22.95 13.350000000000001 23.075000000000003 40.625 4 28.000000000000004 18.7 19.075 34.225 5 27.150000000000002 23.599999999999998 22.675 26.575 6 26.700000000000003 27.800000000000004 22.075 23.425 7 21.95 27.05 32.125 18.875 8 23.674999999999997 23.599999999999998 28.65 24.075 9 22.7 21.8 31.45 24.05 10-11 25.525 28.3625 24.0375 22.075 12-13 25.015626953369168 23.090386298287285 25.240655081885237 26.653331666458307 14-15 23.5875 24.212500000000002 26.224999999999998 25.974999999999998 16-17 24.925 23.7625 24.825 26.487500000000004 18-19 25.525 23.1375 24.9125 26.424999999999997 20-21 24.56535334584115 24.527829893683553 24.42776735459662 26.479049405878673 22-23 25.137500000000003 24.075 24.775 26.0125 24-25 25.2625 24.125 23.474999999999998 27.1375 26-27 24.887500000000003 23.425 25.2875 26.400000000000002 28-29 24.675 24.15 24.712500000000002 26.4625 30-31 25.2375 23.3625 24.75 26.650000000000002 32-33 23.962500000000002 24.25 25.2375 26.55 34-35 25.025 24.075 24.025 26.875 36-37 24.925 23.7625 24.9375 26.375 38-39 24.725 24.337500000000002 24.349999999999998 26.5875 40-41 26.2125 23.5375 23.4375 26.8125 42-43 25.275 24.3875 24.099999999999998 26.237500000000004 44-45 24.325 24.637500000000003 24.8125 26.224999999999998 46-47 25.740717589698715 24.1780222527816 23.790473809226153 26.290786348293537 48-49 25.3125 23.425 24.712500000000002 26.55 50-51 24.8 23.3 24.975 26.924999999999997 52-53 25.8625 23.5875 23.6125 26.937499999999996 54-55 25.98149537384346 23.74343585896474 24.131032758189548 26.144036009002253 56-57 24.518629657414355 24.293573393348336 24.306076519129782 26.881720430107524 58-59 25.732165206508135 23.829787234042556 24.04255319148936 26.395494367959948 60-61 24.85621405351338 22.55563890972743 24.5311327831958 28.057014253563388 62-63 25.393848462115532 23.793448362090523 24.33108277069267 26.481620405101275 64-65 25.76894223555889 23.468367091772944 23.843460865216304 26.91922980745186 66-67 25.79394848712178 22.643160790197552 24.093523380845213 27.46936734183546 68-69 25.04689258471927 23.608853319995 24.64674252844817 26.697511566837562 70-71 25.606705028771582 23.705278959219413 23.667750813109834 27.020265198899175 72-73 26.095118898623284 23.30413016270338 24.46808510638298 26.132665832290364 74-75 25.896564741411854 23.530892160563734 23.44280860702152 27.129734491002893 76 26.840408382590002 22.487909725953788 24.073078989790435 26.598602901665767 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.0 18 1.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.5 25 3.0 26 2.5 27 3.0 28 3.5 29 3.0 30 6.0 31 11.5 32 14.5 33 15.5 34 26.0 35 42.0 36 55.5 37 62.5 38 74.5 39 104.0 40 136.5 41 161.0 42 171.0 43 189.0 44 214.5 45 221.0 46 223.5 47 226.5 48 229.0 49 212.5 50 189.5 51 176.0 52 158.5 53 142.5 54 132.0 55 140.5 56 141.0 57 136.5 58 138.5 59 142.0 60 133.0 61 109.5 62 101.5 63 114.5 64 107.0 65 89.0 66 81.5 67 70.5 68 69.5 69 69.0 70 59.5 71 53.5 72 52.5 73 46.0 74 35.0 75 30.0 76 28.0 77 19.0 78 10.5 79 5.5 80 5.0 81 5.5 82 3.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0625 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0 58-59 0.1000250062515629 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.012507817385866166 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 1.0 56 0.0 57 0.0 58 0.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 1.0 71 1.0 72 2.0 73 7.0 74 27.0 75 238.0 76 3722.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.075 0.0 0.0 0.0 0.0 64 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892537 READS because READLEN < 1 Read 892537 spots for SRR24195893.sra Written 892537 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra Rejected 892532 READS because READLEN < 1 Read 892532 spots for SRR24195893.sra Written 892532 spots for SRR24195893.sra SRR ids: ['SRR24195893.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qlgsx9tc SRR24195893.sra spots: 17850645 blocks: [[1, 892532], [892533, 1785064], [1785065, 2677596], [2677597, 3570128], [3570129, 4462660], [4462661, 5355192], [5355193, 6247724], [6247725, 7140256], [7140257, 8032788], [8032789, 8925320], [8925321, 9817852], [9817853, 10710384], [10710385, 11602916], [11602917, 12495448], [12495449, 13387980], [13387981, 14280512], [14280513, 15173044], [15173045, 16065576], [16065577, 16958108], [16958109, 17850645]] SRR24195893 file size 3408816 SRR24195893 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195893 SRR24195893_1.fastq Input file: SRR24195893_1.fastq trimmed: SRR24195893-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:05:13 2024 >> started Fri Dec 6 20:05:22 2024 >> done (9.032s) 17850645 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 4 ( 0.00%) empty reads filtered out after trimming by size control 17850641 (100.00%) reads available; of these: 6 ( 0.00%) trimmed reads available after processing 17850635 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 30 35 0.00% 31 36 0.00% 32 42 0.00% 33 41 0.00% 34 57 0.00% 35 66 0.00% 36 57 0.00% 37 89 0.00% 38 104 0.00% 39 114 0.00% 40 147 0.00% 41 162 0.00% 42 217 0.00% 43 210 0.00% 44 250 0.00% 45 224 0.00% 46 277 0.00% 47 361 0.00% 48 481 0.00% 49 549 0.00% 50 634 0.00% 51 790 0.00% 52 907 0.01% 53 1010 0.01% 54 1049 0.01% 55 1136 0.01% 56 1244 0.01% 57 1458 0.01% 58 1725 0.01% 59 1963 0.01% 60 79 0.00% 61 92 0.00% 62 135 0.00% 63 186 0.00% 64 248 0.00% 65 312 0.00% 66 404 0.00% 67 641 0.00% 68 918 0.01% 69 1530 0.01% 70 2612 0.01% 71 5429 0.03% 72 12611 0.07% 73 35830 0.20% 74 138016 0.77% 75 987547 5.53% 76 16648616 93.27% 17850641 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=23 prefix-density=0.37 prefix-fanout=2.1 sequence=GGGGAGGCCGGCGGTGGACTTGAGGCCCTGGAAAGG criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=6.69 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=1.4 sequence=GATCTGCTTCAAGAGGGACTCCACGGTGAGAGGCGGCAGGTAGGAAAGGGTTTCGAACTTCTT Started job on | Dec 06 20:05:40 Started mapping on | Dec 06 20:05:40 Finished on | Dec 06 20:05:53 Mapping speed, Million of reads per hour | 4943.25 Number of input reads | 17850641 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 17466655 Uniquely mapped reads % | 97.85% Average mapped length | 75.63 Number of splices: Total | 4466497 Number of splices: Annotated (sjdb) | 4271773 Number of splices: GT/AG | 4407805 Number of splices: GC/AG | 52243 Number of splices: AT/AC | 2128 Number of splices: Non-canonical | 4321 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267393 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 1418 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 116593 116593 116593 N_multimapping 267393 267393 267393 N_noFeature 383010 17116099 483025 N_ambiguous 280248 1342 30325 UnstrandedReadsAssigned:16803397 PositiveStrandReadsAssigned:349214 NegativeStrandReadsAssigned:16953305 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195893 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195893-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,850,641 reads, 17,063,343 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR24195893.ke.tsv 35125 SRR24195893.se.tsv 88098 total ==> SRR24195893.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 71.403 7.57893 PNS24247 1044 945 12.1155 1.13901 PNS24249 1928 1829 144.446 7.01632 PNS24246 1044 945 12.1155 1.13901 PNS24248 1044 945 12.1155 1.13901 PNS24244 1471 1372 21.8043 1.41191 PNS24243 293 194 0 0 KQK14069 1603 1504 1751.36 103.453 KQK14071 474 375 426.986 101.158 ==> SRR24195893.se.tsv <== BRADI_1g14170v3 2234 BRADI_1g53295v3 10 BRADI_1g59795v3 104 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2620 BRADI_1g74790v3 154 BRADI_1g09890v3 10 BRADI_1g77505v3 311 BRADI_1g48960v3 1 SRR24195893 completed mapping pipeline successfully