Starting /dee2/code/volunteer_pipeline.sh SRR24195894 current disk space = 1549574897664 free memory = 1595286084 SRR24195894 SRAfilesize 212a44a7356d59f900f97603c3a117b8 SRR24195894.sra SRR24195894.sra file validated SRR24195894 is single end SRR24195894 is conventional basespace SRR24195894 read1 length is 55-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24195894_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-76 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.88175 32.0 32.0 32.0 32.0 32.0 2 31.49275 32.0 32.0 32.0 32.0 32.0 3 31.58075 32.0 32.0 32.0 32.0 32.0 4 31.7205 32.0 32.0 32.0 32.0 32.0 5 31.73325 32.0 32.0 32.0 32.0 32.0 6 35.22475 36.0 36.0 36.0 36.0 36.0 7 35.216 36.0 36.0 36.0 36.0 36.0 8 35.1225 36.0 36.0 36.0 36.0 36.0 9 35.159 36.0 36.0 36.0 36.0 36.0 10-11 35.30737499999999 36.0 36.0 36.0 36.0 36.0 12-13 35.20375 36.0 36.0 36.0 36.0 36.0 14-15 35.206375 36.0 36.0 36.0 36.0 36.0 16-17 35.2725 36.0 36.0 36.0 36.0 36.0 18-19 35.205124999999995 36.0 36.0 36.0 36.0 36.0 20-21 35.1815 36.0 36.0 36.0 36.0 36.0 22-23 35.2265 36.0 36.0 36.0 36.0 36.0 24-25 35.1965 36.0 36.0 36.0 36.0 36.0 26-27 35.199124999999995 36.0 36.0 36.0 36.0 36.0 28-29 35.164875 36.0 36.0 36.0 36.0 36.0 30-31 35.076 36.0 36.0 36.0 36.0 36.0 32-33 35.0465 36.0 36.0 36.0 36.0 36.0 34-35 35.0385 36.0 36.0 36.0 36.0 36.0 36-37 35.106125 36.0 36.0 36.0 36.0 36.0 38-39 34.9875 36.0 36.0 36.0 36.0 36.0 40-41 35.0635 36.0 36.0 36.0 36.0 36.0 42-43 35.074625 36.0 36.0 36.0 36.0 36.0 44-45 34.932375 36.0 36.0 36.0 36.0 36.0 46-47 34.992125 36.0 36.0 36.0 36.0 36.0 48-49 35.05625 36.0 36.0 36.0 36.0 36.0 50-51 34.94975 36.0 36.0 36.0 36.0 36.0 52-53 34.9815 36.0 36.0 36.0 36.0 36.0 54-55 34.940375 36.0 36.0 36.0 36.0 36.0 56-57 34.961115278819705 36.0 36.0 36.0 36.0 36.0 58-59 34.902716205564644 36.0 36.0 36.0 36.0 36.0 60-61 34.86118059029515 36.0 36.0 36.0 36.0 36.0 62-63 34.8980740370185 36.0 36.0 36.0 36.0 36.0 64-65 34.83366683341671 36.0 36.0 36.0 36.0 36.0 66-67 34.7747623811906 36.0 36.0 36.0 36.0 36.0 68-69 34.76521229090903 36.0 36.0 36.0 34.0 36.0 70-71 34.74105579184388 36.0 36.0 36.0 34.0 36.0 72-73 34.77931132287404 36.0 36.0 36.0 34.0 36.0 74-75 34.70392335343728 36.0 36.0 36.0 32.0 36.0 76 35.201664876476904 36.0 36.0 36.0 32.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 4.0 23 3.0 24 7.0 25 8.0 26 14.0 27 33.0 28 28.0 29 51.0 30 74.0 31 104.0 32 123.0 33 196.0 34 390.0 35 2965.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.625 11.1 10.075000000000001 45.2 2 24.224999999999998 11.25 31.075000000000003 33.45 3 21.5 13.55 21.25 43.7 4 26.224999999999998 19.2 20.225 34.35 5 27.250000000000004 22.875 22.875 27.0 6 26.55 27.900000000000002 21.75 23.799999999999997 7 22.95 24.25 33.975 18.825 8 23.05 23.0 28.299999999999997 25.650000000000002 9 22.875 23.025000000000002 30.075000000000003 24.025 10-11 23.225 28.249999999999996 24.3875 24.1375 12-13 24.15603900975244 22.605651412853213 26.44411102775694 26.79419854963741 14-15 23.2625 23.724999999999998 25.937500000000004 27.075 16-17 25.587500000000002 23.7625 24.474999999999998 26.174999999999997 18-19 25.2 24.337500000000002 23.849999999999998 26.6125 20-21 23.921470551456796 24.634237839189694 24.496686257346507 26.947605352007002 22-23 25.5125 24.125 24.8625 25.5 24-25 25.224999999999998 24.212500000000002 24.075 26.487500000000004 26-27 25.337500000000002 23.25 25.112499999999997 26.3 28-29 25.51568946118265 23.31541442680335 24.85310663832979 26.31578947368421 30-31 25.124999999999996 23.1625 24.2875 27.425 32-33 25.55 24.4375 23.6375 26.375 34-35 24.45 23.962500000000002 24.725 26.8625 36-37 25.837500000000002 23.200000000000003 24.125 26.8375 38-39 25.25 23.549999999999997 23.9125 27.287499999999998 40-41 25.2 23.7625 23.7 27.3375 42-43 24.5625 24.275 24.5 26.6625 44-45 25.0625 24.45 24.6125 25.874999999999996 46-47 25.365670708838607 24.415551943992998 23.44043005375672 26.778347293411674 48-49 24.474999999999998 23.3 24.25 27.975 50-51 24.975 23.4375 24.2625 27.325 52-53 25.587500000000002 23.8125 24.0375 26.5625 54-55 24.90622655663916 24.01850462615654 24.44361090272568 26.63165791447862 56-57 25.35633908477119 24.44361090272568 23.80595148787197 26.39409852463116 58-59 26.054311099987487 23.40132649230384 24.35239644600175 26.19196596170692 60-61 25.512756378189096 23.524262131065534 24.037018509254626 26.92596298149075 62-63 24.487243621810904 24.187093546773387 25.125062531265634 26.20060030015007 64-65 25.7503751875938 23.149074537268636 24.362181090545274 26.738369184592298 66-67 25.65032516258129 23.3991995997999 23.32416208104052 27.62631315657829 68-69 25.403377110694187 24.752970606629145 23.864915572232643 25.97873671044403 70-71 25.906930197648236 23.567675756817614 23.742807105328996 26.782586940205157 72-73 26.265030060120242 22.657815631262526 24.123246492985974 26.95390781563126 74-75 26.47876643073812 23.369565217391305 23.938321536905967 26.21334681496461 76 25.93984962406015 23.1203007518797 22.824919441460796 28.114930182599355 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 3.0 26 2.5 27 2.0 28 3.0 29 4.0 30 4.5 31 10.5 32 19.0 33 22.0 34 23.5 35 35.5 36 60.5 37 76.0 38 90.5 39 107.0 40 134.0 41 161.0 42 164.0 43 184.5 44 211.0 45 217.5 46 216.5 47 219.5 48 214.0 49 198.0 50 192.0 51 174.5 52 167.0 53 156.0 54 133.5 55 141.0 56 141.5 57 136.5 58 136.5 59 141.5 60 136.5 61 125.0 62 130.5 63 105.5 64 84.5 65 98.5 66 94.0 67 79.5 68 69.5 69 64.5 70 59.0 71 52.5 72 50.5 73 43.5 74 34.0 75 27.5 76 27.0 77 23.0 78 12.5 79 7.5 80 5.5 81 2.0 82 2.0 83 2.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.025 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0375 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0125 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.025 56-57 0.0 58-59 0.07502813555083156 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 1.0 56 0.0 57 0.0 58 1.0 59 0.0 60 0.0 61 0.0 62 0.0 63 0.0 64 0.0 65 0.0 66 0.0 67 0.0 68 1.0 69 0.0 70 0.0 71 3.0 72 4.0 73 13.0 74 42.0 75 211.0 76 3724.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4528301886792453 0.8999999999999999 3 0.05031446540880503 0.15 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.025 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275037 READS because READLEN < 1 Read 1275037 spots for SRR24195894.sra Written 1275037 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra Rejected 1275032 READS because READLEN < 1 Read 1275032 spots for SRR24195894.sra Written 1275032 spots for SRR24195894.sra SRR ids: ['SRR24195894.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yc1s81jf SRR24195894.sra spots: 25500645 blocks: [[1, 1275032], [1275033, 2550064], [2550065, 3825096], [3825097, 5100128], [5100129, 6375160], [6375161, 7650192], [7650193, 8925224], [8925225, 10200256], [10200257, 11475288], [11475289, 12750320], [12750321, 14025352], [14025353, 15300384], [15300385, 16575416], [16575417, 17850448], [17850449, 19125480], [19125481, 20400512], [20400513, 21675544], [21675545, 22950576], [22950577, 24225608], [24225609, 25500645]] SRR24195894 file size 4879171 SRR24195894 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24195894 SRR24195894_1.fastq Input file: SRR24195894_1.fastq trimmed: SRR24195894-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:16:24 2024 >> started Fri Dec 6 20:16:36 2024 >> done (11.594s) 25500645 reads processed; of these: 0 ( 0.00%) short reads filtered out after trimming by size control 5 ( 0.00%) empty reads filtered out after trimming by size control 25500640 (100.00%) reads available; of these: 6 ( 0.00%) trimmed reads available after processing 25500634 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 30 29 0.00% 31 41 0.00% 32 40 0.00% 33 44 0.00% 34 62 0.00% 35 75 0.00% 36 79 0.00% 37 104 0.00% 38 106 0.00% 39 138 0.00% 40 168 0.00% 41 204 0.00% 42 217 0.00% 43 238 0.00% 44 261 0.00% 45 282 0.00% 46 330 0.00% 47 413 0.00% 48 499 0.00% 49 691 0.00% 50 834 0.00% 51 1011 0.00% 52 1090 0.00% 53 1291 0.01% 54 1277 0.01% 55 1444 0.01% 56 1602 0.01% 57 1799 0.01% 58 2172 0.01% 59 2567 0.01% 60 92 0.00% 61 107 0.00% 62 133 0.00% 63 215 0.00% 64 277 0.00% 65 353 0.00% 66 541 0.00% 67 839 0.00% 68 1165 0.00% 69 1941 0.01% 70 3715 0.01% 71 7371 0.03% 72 17345 0.07% 73 49810 0.20% 74 194796 0.76% 75 1410071 5.53% 76 23792761 93.30% 25500640 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=16 prefix-density=0.43 prefix-fanout=2.2 sequence=GACGCTGCCGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=11.28 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.9 sequence=TTCTCAACTCTTTCAAACTTTTAGGAATTCACATATGCAAGCTAGCTCCTCGATCGAGAGCCAGGTTGCTACACACAACAACAATCTTGGGGATGAAAAATAGAAAACTCAAAGCAATGTCAGAGTTGACAAAACTGAGCTGACACTTTATATATGGTCCATCTTAATACGGAGCTGTCCTTGGTTGTTTATGCCTTGCCGGATTCCTCGCAGCCCGGTGGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC Started job on | Dec 06 20:16:53 Started mapping on | Dec 06 20:16:53 Finished on | Dec 06 20:17:16 Mapping speed, Million of reads per hour | 3991.40 Number of input reads | 25500640 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 24950630 Uniquely mapped reads % | 97.84% Average mapped length | 75.63 Number of splices: Total | 6256137 Number of splices: Annotated (sjdb) | 5983655 Number of splices: GT/AG | 6173697 Number of splices: GC/AG | 73233 Number of splices: AT/AC | 2952 Number of splices: Non-canonical | 6255 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.71 Insertion rate per base | 0.00% Insertion average length | 1.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385282 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 2109 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 164728 164728 164728 N_multimapping 385282 385282 385282 N_noFeature 572107 24436619 719890 N_ambiguous 409310 1734 44130 UnstrandedReadsAssigned:23969213 PositiveStrandReadsAssigned:512277 NegativeStrandReadsAssigned:24186610 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=76 echo kmer=71 SRR24195894 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24195894-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,500,640 reads, 24,346,268 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 SRR24195894.ke.tsv 35125 SRR24195894.se.tsv 88098 total ==> SRR24195894.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0.000261474 1.914e-05 PNS24247 1044 945 52.1022 3.37803 PNS24249 1928 1829 256.862 8.6045 PNS24246 1044 945 52.1022 3.37803 PNS24248 1044 945 52.1022 3.37803 PNS24244 1471 1372 8.83072 0.394349 PNS24243 293 194 0 0 KQK14069 1603 1504 3163.28 128.863 KQK14071 474 375 678.989 110.935 ==> SRR24195894.se.tsv <== BRADI_1g14170v3 3927 BRADI_1g53295v3 13 BRADI_1g59795v3 191 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 3312 BRADI_1g74790v3 220 BRADI_1g09890v3 10 BRADI_1g77505v3 396 BRADI_1g48960v3 0 SRR24195894 completed mapping pipeline successfully