Starting /dee2/code/volunteer_pipeline.sh SRR24628919 current disk space = 1549579759616 free memory = 1595277616 SRR24628919 SRAfilesize 21edca42428d9673ca0b1e0dbf0bff25 SRR24628919.sra SRR24628919.sra file validated SRR24628919 is single end SRR24628919 is conventional basespace SRR24628919 read1 length is 45-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24628919_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 45-76 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.66 32.0 32.0 32.0 32.0 32.0 2 31.03975 32.0 32.0 32.0 32.0 32.0 3 31.089 32.0 32.0 32.0 32.0 32.0 4 31.10575 32.0 32.0 32.0 32.0 32.0 5 31.25625 32.0 32.0 32.0 32.0 32.0 6 34.37925 36.0 36.0 36.0 32.0 36.0 7 34.1855 36.0 36.0 36.0 32.0 36.0 8 34.113 36.0 36.0 36.0 32.0 36.0 9 34.371 36.0 36.0 36.0 32.0 36.0 10-11 34.352875 36.0 36.0 36.0 32.0 36.0 12-13 34.397 36.0 36.0 36.0 32.0 36.0 14-15 34.400625000000005 36.0 36.0 36.0 32.0 36.0 16-17 34.343 36.0 36.0 36.0 32.0 36.0 18-19 34.280125 36.0 36.0 36.0 32.0 36.0 20-21 34.369249999999994 36.0 36.0 36.0 32.0 36.0 22-23 34.179625 36.0 36.0 36.0 32.0 36.0 24-25 34.157375 36.0 36.0 36.0 32.0 36.0 26-27 34.181875 36.0 36.0 36.0 32.0 36.0 28-29 34.19725 36.0 36.0 36.0 32.0 36.0 30-31 34.119749999999996 36.0 36.0 36.0 32.0 36.0 32-33 34.09625 36.0 36.0 36.0 32.0 36.0 34-35 33.977999999999994 36.0 36.0 36.0 32.0 36.0 36-37 33.863375000000005 36.0 36.0 36.0 29.5 36.0 38-39 33.801500000000004 36.0 36.0 36.0 27.0 36.0 40-41 33.603375 36.0 36.0 36.0 27.0 36.0 42-43 33.729 36.0 36.0 36.0 27.0 36.0 44-45 33.700500000000005 36.0 36.0 36.0 27.0 36.0 46-47 33.43323330832708 36.0 36.0 36.0 27.0 36.0 48-49 33.19367341835459 36.0 36.0 36.0 21.0 36.0 50-51 33.23743435858965 36.0 34.0 36.0 24.0 36.0 52-53 33.002005785338284 36.0 32.0 36.0 21.0 36.0 54-55 33.08493870402802 36.0 34.0 36.0 24.0 36.0 56-57 32.9776131262677 36.0 34.0 36.0 17.5 36.0 58-59 32.91786926321899 36.0 34.0 36.0 17.5 36.0 60-61 32.831846567747945 36.0 32.0 36.0 17.5 36.0 62-63 32.9280881984465 36.0 34.0 36.0 17.5 36.0 64-65 32.6556561457636 36.0 32.0 36.0 14.0 36.0 66-67 32.60893984689061 36.0 32.0 36.0 14.0 36.0 68-69 32.46977304351543 36.0 32.0 36.0 14.0 36.0 70-71 32.37176777603332 36.0 32.0 36.0 14.0 36.0 72-73 32.31836741955403 36.0 32.0 36.0 14.0 36.0 74-75 32.11361449900025 36.0 32.0 36.0 14.0 36.0 76 31.082259287338893 36.0 32.0 36.0 14.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 3.0 23 9.0 24 14.0 25 36.0 26 48.0 27 86.0 28 101.0 29 122.0 30 213.0 31 269.0 32 357.0 33 497.0 34 992.0 35 1250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.525 16.975 38.6 16.900000000000002 2 31.674999999999997 19.025 29.925 19.375 3 33.800000000000004 17.599999999999998 29.725 18.875 4 33.575 19.1 27.775 19.55 5 30.75 17.9 31.724999999999998 19.625 6 33.700275206404804 15.911933950462847 29.09682261696272 21.290968226169625 7 31.5 16.775000000000002 29.849999999999998 21.875 8 30.8 16.150000000000002 30.825000000000003 22.225 9 29.225 15.075 32.824999999999996 22.875 10-11 28.762500000000003 16.8625 32.9375 21.4375 12-13 27.425 20.525 35.025 17.025000000000002 14-15 24.8125 22.775000000000002 36.775000000000006 15.6375 16-17 24.425 23.3125 35.6625 16.6 18-19 24.0625 23.150000000000002 35.2375 17.549999999999997 20-21 24.575 22.287499999999998 34.75 18.387500000000003 22-23 23.7125 22.6375 35.025 18.625 24-25 23.8625 23.0375 34.4 18.7 26-27 24.099999999999998 22.912499999999998 34.0875 18.9 28-29 23.05 23.8375 34.55 18.5625 30-31 23.25 23.5125 34.4375 18.8 32-33 24.0625 23.599999999999998 34.425 17.9125 34-35 24.0 23.875 34.5 17.625 36-37 23.075000000000003 23.3875 34.775 18.7625 38-39 23.5125 23.75 34.1875 18.55 40-41 22.8875 23.724999999999998 34.875 18.512500000000003 42-43 22.35 23.9375 34.6625 19.05 44-45 21.890236279534943 24.30303787973497 34.966870858857355 18.839854981872733 46-47 22.405601400350086 23.80595148787197 35.27131782945737 18.517129282320578 48-49 22.693173293323333 24.643660915228807 34.733683420855215 17.92948237059265 50-51 22.295860947855445 24.721770663999 35.363261222958606 17.619107165186946 52-53 22.295860947855445 24.759284731774414 34.61297986745029 18.331874452919845 54-55 21.4491302715555 25.190839694656486 34.71405330997372 18.645976723814293 56-57 21.812038543361282 24.94055812789388 34.75159554498811 18.495807783756728 58-59 22.2806358743272 26.311177869570663 33.408436600325444 17.999749655776693 60-61 21.998247151621385 26.16752222361337 33.69224990609741 18.141980718667835 62-63 21.272863943873716 26.45953395139063 34.089200701578555 18.178401403157103 64-65 21.29153605015674 26.194357366771158 35.14733542319749 17.36677115987461 66-67 20.956805625313912 26.883475640381715 34.84429934706178 17.315419387242592 68-69 21.124811273276293 27.579265223955712 33.84499245093105 17.45093105183694 70-71 21.317878291545924 28.234849439334763 33.70291041955399 16.744361849565326 72-73 21.650006326711377 27.82487662912818 33.06339364798178 17.461723396178666 74-75 20.33741926980361 27.507578753130357 34.63819691577699 17.51680506128905 76 24.109173616376044 0.0 49.01440485216072 26.87642153146323 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 2.5 19 4.5 20 5.0 21 5.0 22 4.0 23 8.5 24 17.0 25 20.5 26 23.0 27 32.5 28 37.5 29 39.5 30 59.0 31 84.0 32 109.5 33 126.0 34 139.0 35 171.0 36 216.0 37 243.0 38 252.0 39 287.0 40 316.0 41 309.5 42 297.0 43 295.5 44 267.0 45 239.0 46 243.0 47 216.5 48 192.0 49 159.0 50 119.5 51 120.5 52 120.0 53 95.0 54 73.0 55 59.5 56 49.5 57 43.0 58 35.5 59 32.5 60 24.5 61 13.5 62 9.5 63 10.5 64 11.0 65 11.5 66 8.5 67 4.5 68 3.5 69 3.5 70 1.5 71 0.0 72 0.5 73 1.5 74 1.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.012503125781445362 52-53 0.0 54-55 0.03752814610958219 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.012554927809165096 68-69 0.0 70-71 0.0 72-73 0.037945863900834806 74-75 0.05269397971281781 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 45 1.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 1.0 53 1.0 54 0.0 55 1.0 56 1.0 57 0.0 58 1.0 59 0.0 60 1.0 61 2.0 62 0.0 63 3.0 64 1.0 65 1.0 66 7.0 67 4.0 68 2.0 69 2.0 70 5.0 71 3.0 72 20.0 73 62.0 74 171.0 75 1072.0 76 2638.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.025 0.0 0.0 0.0 0.0 53 0.025 0.0 0.0 0.0 0.0 54 0.025 0.0 0.0 0.0 0.0 55 0.025 0.0 0.0 0.0 0.0 56 0.025 0.0 0.0 0.0 0.0 57 0.05 0.0 0.0 0.0 0.0 58 0.05 0.0 0.0 0.0 0.0 59 0.05 0.0 0.0 0.0 0.0 60 0.05 0.0 0.0 0.0 0.0 61 0.05 0.0 0.0 0.0 0.0 62 0.05 0.0 0.0 0.0 0.0 63 0.05 0.0 0.0 0.0 0.0 64 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra Rejected 3278342 READS because READLEN < 1 Read 3278342 spots for SRR24628919.sra Written 3278342 spots for SRR24628919.sra SRR ids: ['SRR24628919.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_stha3mpi SRR24628919.sra spots: 65566840 blocks: [[1, 3278342], [3278343, 6556684], [6556685, 9835026], [9835027, 13113368], [13113369, 16391710], [16391711, 19670052], [19670053, 22948394], [22948395, 26226736], [26226737, 29505078], [29505079, 32783420], [32783421, 36061762], [36061763, 39340104], [39340105, 42618446], [42618447, 45896788], [45896789, 49175130], [49175131, 52453472], [52453473, 55731814], [55731815, 59010156], [59010157, 62288498], [62288499, 65566840]] SRR24628919 file size 12527713 SRR24628919 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24628919 SRR24628919_1.fastq Input file: SRR24628919_1.fastq trimmed: SRR24628919-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 20:18:09 2024 >> started Fri Dec 6 20:18:39 2024 >> done (30.602s) 65566840 reads processed; of these: 557 ( 0.00%) short reads filtered out after trimming by size control 2635 ( 0.00%) empty reads filtered out after trimming by size control 65563648 (100.00%) reads available; of these: 10678 ( 0.02%) trimmed reads available after processing 65552970 (99.98%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 94 0.00% 19 195 0.00% 20 137 0.00% 21 143 0.00% 22 190 0.00% 23 205 0.00% 24 212 0.00% 25 194 0.00% 26 208 0.00% 27 250 0.00% 28 283 0.00% 29 349 0.00% 30 367 0.00% 31 368 0.00% 32 456 0.00% 33 522 0.00% 34 538 0.00% 35 636 0.00% 36 667 0.00% 37 765 0.00% 38 804 0.00% 39 874 0.00% 40 917 0.00% 41 1020 0.00% 42 1165 0.00% 43 795 0.00% 44 1017 0.00% 45 1042 0.00% 46 1721 0.00% 47 941 0.00% 48 1370 0.00% 49 1565 0.00% 50 1268 0.00% 51 2940 0.00% 52 3181 0.00% 53 3994 0.01% 54 4990 0.01% 55 4616 0.01% 56 5652 0.01% 57 3660 0.01% 58 7641 0.01% 59 8574 0.01% 60 6400 0.01% 61 14565 0.02% 62 10742 0.02% 63 22913 0.03% 64 21825 0.03% 65 23789 0.04% 66 43811 0.07% 67 23851 0.04% 68 23755 0.04% 69 28104 0.04% 70 38422 0.06% 71 67384 0.10% 72 282440 0.43% 73 899512 1.37% 74 3052688 4.66% 75 18586058 28.35% 76 42350863 64.60% 65563648 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=37 prefix-density=0.30 prefix-fanout=2.2 sequence=CTGTCGTTTAAAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=134.43 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=10.0 sequence=TTGTTGTTGTTCGTGGAGTGGAGCGTTCGTGTGGGTAGCGGTTGTTTGGTTGCGTGTGTGTTTTGGGTCCGTGCCGCGTGTTGTGTTGTGGGGGAAGCATCGAGTTGCCTCCTGATTCTATTGCGGGGAATAATAAAGGCTTTGCCGTTTTGGT Started job on | Dec 06 20:19:02 Started mapping on | Dec 06 20:19:02 Finished on | Dec 06 20:20:35 Mapping speed, Million of reads per hour | 2537.95 Number of input reads | 65563648 Average input read length | 75 UNIQUE READS: Uniquely mapped reads number | 60771907 Uniquely mapped reads % | 92.69% Average mapped length | 73.61 Number of splices: Total | 1100138 Number of splices: Annotated (sjdb) | 783378 Number of splices: GT/AG | 942016 Number of splices: GC/AG | 21526 Number of splices: AT/AC | 474 Number of splices: Non-canonical | 136122 Mismatch rate per base, % | 0.73% Deletion rate per base | 0.00% Deletion average length | 1.28 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1575189 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 270352 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.46% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3216552 3216552 3216552 N_multimapping 1575189 1575189 1575189 N_noFeature 2711995 3414888 58960046 N_ambiguous 1171129 67035 3114 UnstrandedReadsAssigned:56888783 PositiveStrandReadsAssigned:57289984 NegativeStrandReadsAssigned:1808747 Dataset is classified positive stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR24628919 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR24628919-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 65,563,648 reads, 55,602,850 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52973 SRR24628919.ke.tsv 35125 SRR24628919.se.tsv 88098 total ==> SRR24628919.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 12.0066 0.1521 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 1419.99 23.9804 PNS24243 293 194 0 0 KQK14069 1603 1504 836.866 12.8924 KQK14071 474 375 2 0.123573 ==> SRR24628919.se.tsv <== BRADI_1g14170v3 898 BRADI_1g53295v3 54 BRADI_1g59795v3 184 BRADI_1g07683v3 0 BRADI_1g00485v3 51 BRADI_1g20270v3 4133 BRADI_1g74790v3 206 BRADI_1g09890v3 0 BRADI_1g77505v3 575 BRADI_1g48960v3 0 SRR24628919 completed mapping pipeline successfully