Starting /dee2/code/volunteer_pipeline.sh SRR24886710 current disk space = 1542994903040 free memory = 1599141428 SRR24886710 SRAfilesize f5c48be48bcd668dd6da032c371d1a0f SRR24886710.sra SRR24886710.sra file validated SRR24886710 is paired end SRR24886710 is conventional basespace SRR24886710 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886710_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47975 37.0 37.0 37.0 37.0 37.0 2 36.406 37.0 37.0 37.0 37.0 37.0 3 36.6115 37.0 37.0 37.0 37.0 37.0 4 36.65 37.0 37.0 37.0 37.0 37.0 5 36.63 37.0 37.0 37.0 37.0 37.0 6 36.575 37.0 37.0 37.0 37.0 37.0 7 36.515 37.0 37.0 37.0 37.0 37.0 8 36.5505 37.0 37.0 37.0 37.0 37.0 9 36.565 37.0 37.0 37.0 37.0 37.0 10-14 36.559999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5183 37.0 37.0 37.0 37.0 37.0 20-24 36.5221 37.0 37.0 37.0 37.0 37.0 25-29 36.483399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.431400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.433499999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.3666 37.0 37.0 37.0 37.0 37.0 45-49 36.31230000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.2981 37.0 37.0 37.0 37.0 37.0 55-59 36.2035 37.0 37.0 37.0 37.0 37.0 60-64 36.2092 37.0 37.0 37.0 37.0 37.0 65-69 36.1929 37.0 37.0 37.0 37.0 37.0 70-74 36.093399999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.193400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1813 37.0 37.0 37.0 37.0 37.0 85-89 36.0773 37.0 37.0 37.0 37.0 37.0 90-94 36.007 37.0 37.0 37.0 37.0 37.0 95-99 36.054 37.0 37.0 37.0 37.0 37.0 100-104 36.00599999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.940099999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.823 37.0 37.0 37.0 37.0 37.0 115-119 35.8158 37.0 37.0 37.0 37.0 37.0 120-124 35.874399999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.794200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.6772 37.0 37.0 37.0 37.0 37.0 135-139 35.514799999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.493700000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.2893 37.0 37.0 37.0 37.0 37.0 150-151 35.04625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 3.0 24 2.0 25 7.0 26 9.0 27 19.0 28 22.0 29 25.0 30 24.0 31 52.0 32 66.0 33 86.0 34 144.0 35 340.0 36 2763.0 37 436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.60325406758448 11.8648310387985 6.207759699624531 39.32415519399249 2 19.075 12.2 36.75 31.974999999999998 3 16.525000000000002 16.75 27.975 38.75 4 21.9 22.15 23.65 32.300000000000004 5 24.5 26.825 24.7 23.974999999999998 6 23.799999999999997 31.05 23.775 21.375 7 17.65 24.925 39.550000000000004 17.875 8 20.05 22.3 30.9 26.75 9 19.3 22.1 33.800000000000004 24.8 10-14 22.525000000000002 27.22 26.25 24.005000000000003 15-19 22.61 25.945 26.26 25.185000000000002 20-24 22.255 25.995 26.235000000000003 25.515 25-29 22.56 25.635 26.14 25.665 30-34 22.37 25.615 25.795 26.22 35-39 22.58 25.91 25.650000000000002 25.86 40-44 21.94 26.155 26.025 25.88 45-49 23.275000000000002 25.779999999999998 25.490000000000002 25.455 50-54 22.67 26.57 25.5 25.259999999999998 55-59 22.325 25.650000000000002 25.965 26.06 60-64 22.725 25.835 25.590000000000003 25.85 65-69 23.515 25.624999999999996 25.814999999999998 25.045 70-74 22.805 25.095 25.855 26.245 75-79 22.66 25.669999999999998 25.655 26.015 80-84 22.215 26.150000000000002 25.629999999999995 26.005 85-89 23.115 25.745 25.035 26.105 90-94 23.05 25.455 26.105 25.39 95-99 23.055 26.029999999999998 25.314999999999998 25.6 100-104 23.26 26.135 25.235000000000003 25.369999999999997 105-109 23.09 25.490000000000002 25.314999999999998 26.105 110-114 23.02 26.040000000000003 25.145 25.795 115-119 23.27 25.695 24.785 26.25 120-124 23.75 25.46 24.995 25.795 125-129 22.97 26.135 24.785 26.11 130-134 22.88 25.36 25.28 26.479999999999997 135-139 23.035 25.945 25.095 25.924999999999997 140-144 23.615 24.945 25.635 25.805 145-149 22.775000000000002 25.590000000000003 25.83 25.805 150-151 23.425 25.650000000000002 24.975 25.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 3.5 29 6.0 30 6.5 31 8.0 32 12.5 33 18.0 34 28.0 35 40.5 36 49.0 37 72.0 38 88.0 39 107.0 40 130.5 41 148.5 42 160.0 43 180.0 44 195.0 45 204.0 46 219.5 47 219.0 48 196.0 49 170.5 50 172.5 51 159.0 52 138.0 53 131.0 54 117.5 55 112.5 56 111.5 57 101.0 58 98.0 59 87.0 60 75.0 61 72.0 62 70.0 63 61.0 64 47.0 65 45.0 66 36.0 67 21.0 68 19.0 69 16.0 70 13.0 71 9.5 72 10.0 73 8.5 74 2.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.5 #Duplication Level Percentage of deduplicated Percentage of total 1 90.77348066298343 82.15 2 8.093922651933703 14.649999999999999 3 0.9944751381215469 2.7 4 0.13812154696132595 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.3125 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.1125 0.0 0.0 0.0 0.0 102-103 2.4375 0.0 0.0 0.0 0.0 104-105 2.8 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.6500000000000004 0.0 0.0 0.0 0.0 110-111 3.9 0.0 0.0 0.0 0.0 112-113 4.2375 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.0375 0.0 0.0 0.0 0.0 118-119 5.525 0.0 0.0 0.0 0.0 120-121 6.2 0.0 0.0 0.0 0.0 122-123 6.9125 0.0 0.0 0.0 0.0 124-125 7.575 0.0 0.0 0.0 0.0 126-127 8.087499999999999 0.0 0.0 0.0 0.0 128-129 8.7125 0.0 0.0 0.0 0.0 130-131 9.5 0.0 0.0 0.0 0.0 132-133 10.0 0.0 0.0 0.0 0.0 134-135 10.587499999999999 0.0 0.0 0.0 0.0 136-137 11.2375 0.0 0.0 0.0 0.0 138-139 11.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCTCT 10 0.006830828 145.0 145 GTGCCAT 10 0.006830828 145.0 1 >>END_MODULE SRR24886710 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886710_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.10275 37.0 37.0 37.0 37.0 37.0 2 36.282 37.0 37.0 37.0 37.0 37.0 3 36.276 37.0 37.0 37.0 37.0 37.0 4 36.316 37.0 37.0 37.0 37.0 37.0 5 36.3185 37.0 37.0 37.0 37.0 37.0 6 36.2135 37.0 37.0 37.0 37.0 37.0 7 36.2655 37.0 37.0 37.0 37.0 37.0 8 36.34 37.0 37.0 37.0 37.0 37.0 9 36.2255 37.0 37.0 37.0 37.0 37.0 10-14 36.2209 37.0 37.0 37.0 37.0 37.0 15-19 36.2009 37.0 37.0 37.0 37.0 37.0 20-24 36.1361 37.0 37.0 37.0 37.0 37.0 25-29 36.166700000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.08239999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.0023 37.0 37.0 37.0 37.0 37.0 40-44 36.018899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0287 37.0 37.0 37.0 37.0 37.0 50-54 35.992799999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.9447 37.0 37.0 37.0 37.0 37.0 60-64 35.8972 37.0 37.0 37.0 37.0 37.0 65-69 35.8333 37.0 37.0 37.0 37.0 37.0 70-74 35.838100000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.8293 37.0 37.0 37.0 37.0 37.0 80-84 35.863 37.0 37.0 37.0 37.0 37.0 85-89 35.7366 37.0 37.0 37.0 37.0 37.0 90-94 35.7084 37.0 37.0 37.0 37.0 37.0 95-99 35.7724 37.0 37.0 37.0 37.0 37.0 100-104 35.7187 37.0 37.0 37.0 37.0 37.0 105-109 35.6323 37.0 37.0 37.0 37.0 37.0 110-114 35.689299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.5856 37.0 37.0 37.0 37.0 37.0 120-124 35.553399999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.5621 37.0 37.0 37.0 37.0 37.0 130-134 35.4444 37.0 37.0 37.0 37.0 37.0 135-139 35.4806 37.0 37.0 37.0 37.0 37.0 140-144 35.25789999999999 37.0 37.0 37.0 32.2 37.0 145-149 35.3994 37.0 37.0 37.0 37.0 37.0 150-151 35.1125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 7.0 14 2.0 15 3.0 16 4.0 17 2.0 18 1.0 19 2.0 20 4.0 21 3.0 22 7.0 23 11.0 24 10.0 25 17.0 26 16.0 27 11.0 28 17.0 29 23.0 30 27.0 31 31.0 32 52.0 33 70.0 34 163.0 35 472.0 36 2652.0 37 390.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.835708927231806 20.305076269067268 8.30207551887972 28.557139284821204 2 28.999999999999996 22.775000000000002 27.85 20.375 3 23.45 24.925 29.25 22.375 4 26.5 30.5 21.125 21.875 5 28.849999999999998 33.625 17.849999999999998 19.675 6 24.675 35.075 18.725 21.525 7 23.674999999999997 19.625 34.8 21.9 8 23.724999999999998 22.675 24.575 29.025000000000002 9 23.075000000000003 23.599999999999998 26.775 26.55 10-14 26.479999999999997 25.424999999999997 23.630000000000003 24.465 15-19 26.655 25.77 23.955000000000002 23.62 20-24 25.915 26.115 24.525 23.445 25-29 25.814999999999998 25.775 24.42 23.990000000000002 30-34 26.029999999999998 25.885 24.55 23.535 35-39 25.814999999999998 25.724999999999998 24.62 23.84 40-44 25.919999999999998 26.115 24.86 23.105 45-49 26.355 26.085 24.58 22.98 50-54 26.075 25.915 24.709999999999997 23.3 55-59 26.619999999999997 25.81 24.615000000000002 22.955000000000002 60-64 25.345000000000002 26.179999999999996 24.87 23.605 65-69 26.375 25.55 24.73 23.345 70-74 26.405 26.32 24.985 22.29 75-79 26.155 25.95 24.83 23.064999999999998 80-84 26.884999999999998 26.305 24.425 22.384999999999998 85-89 25.900000000000002 26.56 24.4 23.14 90-94 25.835 26.229999999999997 24.755 23.18 95-99 26.525 25.935000000000002 25.224999999999998 22.314999999999998 100-104 26.619999999999997 25.745 24.490000000000002 23.145 105-109 26.765 26.009999999999998 25.4 21.825 110-114 26.755000000000003 26.445 24.065 22.735 115-119 26.96 25.790000000000003 24.905 22.345000000000002 120-124 26.845000000000002 26.245 24.695 22.215 125-129 27.11 27.255000000000003 24.215 21.42 130-134 27.389999999999997 26.77 24.11 21.73 135-139 27.93 26.169999999999998 24.54 21.36 140-144 27.91 25.745 24.9 21.445 145-149 28.305000000000003 26.125 24.565 21.005 150-151 28.512500000000003 26.375 24.2625 20.849999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.0 27 3.0 28 2.5 29 1.5 30 3.5 31 7.0 32 14.0 33 20.0 34 24.0 35 30.5 36 37.5 37 45.5 38 68.5 39 108.0 40 135.5 41 141.0 42 152.0 43 166.5 44 177.5 45 192.0 46 201.5 47 204.0 48 186.5 49 181.5 50 168.0 51 147.0 52 147.5 53 134.5 54 124.0 55 123.5 56 111.0 57 91.0 58 92.5 59 103.0 60 91.5 61 82.0 62 77.5 63 64.5 64 61.5 65 56.5 66 44.5 67 33.0 68 33.0 69 33.5 70 20.0 71 12.5 72 7.0 73 2.0 74 1.0 75 0.0 76 0.0 77 1.0 78 2.0 79 1.5 80 0.5 81 1.5 82 1.5 83 0.5 84 1.0 85 1.5 86 1.5 87 0.5 88 0.5 89 0.5 90 1.0 91 1.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.90154867256636 82.175 2 7.8816371681415935 14.249999999999998 3 1.0785398230088494 2.9250000000000003 4 0.08296460176991151 0.3 5 0.02765486725663717 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02765486725663717 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GCCCAGGGTAACGGAAACTTCAGCTACAGCCGGTTCTTTGCAGTTGGCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.6000000000000001 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.8624999999999998 0.0 0.0 0.0 0.0 100-101 2.1375 0.0 0.0 0.0 0.0 102-103 2.525 0.0 0.0 0.0 0.0 104-105 2.975 0.0 0.0 0.0 0.0 106-107 3.3499999999999996 0.0 0.0 0.0 0.0 108-109 3.825 0.0 0.0 0.0 0.0 110-111 4.075 0.0 0.0 0.0 0.0 112-113 4.4375 0.0 0.0 0.0 0.0 114-115 4.824999999999999 0.0 0.0 0.0 0.0 116-117 5.2875 0.0 0.0 0.0 0.0 118-119 5.775 0.0 0.0 0.0 0.0 120-121 6.425 0.0 0.0 0.0 0.0 122-123 7.125 0.0 0.0 0.0 0.0 124-125 7.7625 0.0 0.0 0.0 0.0 126-127 8.35 0.0 0.0 0.0 0.0 128-129 9.0375 0.0 0.0 0.0 0.0 130-131 9.837499999999999 0.0 0.0 0.0 0.0 132-133 10.3375 0.0 0.0 0.0 0.0 134-135 10.912500000000001 0.0 0.0 0.0 0.0 136-137 11.5625 0.0 0.0 0.0 0.0 138-139 12.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011966 spots for SRR24886710.sra Written 1011966 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra Read 1011950 spots for SRR24886710.sra Written 1011950 spots for SRR24886710.sra SRR ids: ['SRR24886710.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gdjq8i89 SRR24886710.sra spots: 20239016 blocks: [[1, 1011950], [1011951, 2023900], [2023901, 3035850], [3035851, 4047800], [4047801, 5059750], [5059751, 6071700], [6071701, 7083650], [7083651, 8095600], [8095601, 9107550], [9107551, 10119500], [10119501, 11131450], [11131451, 12143400], [12143401, 13155350], [13155351, 14167300], [14167301, 15179250], [15179251, 16191200], [16191201, 17203150], [17203151, 18215100], [18215101, 19227050], [19227051, 20239016]] SRR24886710 file size 7469382 SRR24886710 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24886710 SRR24886710_1.fastq SRR24886710_2.fastq Input file: SRR24886710_1.fastq Paired file: SRR24886710_2.fastq trimmed: SRR24886710-trimmed-pair1.fastq, SRR24886710-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:45:21 2024 >> started Sat Dec 7 12:45:45 2024 >> done (24.666s) 20239016 read pairs processed; of these: 119 ( 0.00%) short read pairs filtered out after trimming by size control 10211 ( 0.05%) empty read pairs filtered out after trimming by size control 20228686 (99.95%) read pairs available; of these: 3313781 (16.38%) trimmed read pairs available after processing 16914905 (83.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 9 0.00% 21 17 0.00% 22 9 0.00% 23 17 0.00% 24 13 0.00% 25 20 0.00% 26 27 0.00% 27 32 0.00% 28 22 0.00% 29 19 0.00% 30 41 0.00% 31 36 0.00% 32 42 0.00% 33 55 0.00% 34 35 0.00% 35 53 0.00% 36 52 0.00% 37 49 0.00% 38 57 0.00% 39 61 0.00% 40 77 0.00% 41 75 0.00% 42 77 0.00% 43 71 0.00% 44 92 0.00% 45 79 0.00% 46 96 0.00% 47 117 0.00% 48 147 0.00% 49 167 0.00% 50 197 0.00% 51 218 0.00% 52 211 0.00% 53 217 0.00% 54 212 0.00% 55 261 0.00% 56 301 0.00% 57 333 0.00% 58 360 0.00% 59 467 0.00% 60 546 0.00% 61 620 0.00% 62 709 0.00% 63 808 0.00% 64 822 0.00% 65 864 0.00% 66 1015 0.01% 67 1095 0.01% 68 1346 0.01% 69 1508 0.01% 70 1732 0.01% 71 1954 0.01% 72 2295 0.01% 73 2602 0.01% 74 2741 0.01% 75 3187 0.02% 76 3376 0.02% 77 3746 0.02% 78 4094 0.02% 79 4715 0.02% 80 5329 0.03% 81 5865 0.03% 82 6659 0.03% 83 7491 0.04% 84 8100 0.04% 85 9064 0.04% 86 9755 0.05% 87 10258 0.05% 88 11237 0.06% 89 12145 0.06% 90 13491 0.07% 91 14968 0.07% 92 16024 0.08% 93 17577 0.09% 94 18748 0.09% 95 20051 0.10% 96 21365 0.11% 97 22553 0.11% 98 23629 0.12% 99 24720 0.12% 100 25987 0.13% 101 28122 0.14% 102 29148 0.14% 103 31376 0.16% 104 32699 0.16% 105 34283 0.17% 106 35664 0.18% 107 36566 0.18% 108 38129 0.19% 109 39152 0.19% 110 40109 0.20% 111 41974 0.21% 112 43658 0.22% 113 44876 0.22% 114 47034 0.23% 115 49150 0.24% 116 49910 0.25% 117 50621 0.25% 118 51749 0.26% 119 52351 0.26% 120 53916 0.27% 121 54848 0.27% 122 56042 0.28% 123 58060 0.29% 124 60311 0.30% 125 61408 0.30% 126 62694 0.31% 127 63609 0.31% 128 64034 0.32% 129 65242 0.32% 130 65533 0.32% 131 66373 0.33% 132 67644 0.33% 133 69172 0.34% 134 71502 0.35% 135 72195 0.36% 136 73035 0.36% 137 72510 0.36% 138 73012 0.36% 139 74212 0.37% 140 74961 0.37% 141 75255 0.37% 142 77548 0.38% 143 78513 0.39% 144 80582 0.40% 145 82667 0.41% 146 81551 0.40% 147 82878 0.41% 148 82651 0.41% 149 82359 0.41% 150 83648 0.41% 151 16914905 83.62% 20228686 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=4.27 fanout-score-rank=14 prefix-density=0.60 prefix-fanout=3.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=25.90 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.6 sequence=GTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=9.30 fanout-score-rank=7 prefix-density=0.63 prefix-fanout=5.7 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=46.32 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.8 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR24886710 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:46:26 Started mapping on | Dec 07 12:46:26 Finished on | Dec 07 12:48:39 Mapping speed, Million of reads per hour | 547.54 Number of input reads | 20228686 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18669641 Uniquely mapped reads % | 92.29% Average mapped length | 292.35 Number of splices: Total | 19406010 Number of splices: Annotated (sjdb) | 18263471 Number of splices: GT/AG | 19138008 Number of splices: GC/AG | 239923 Number of splices: AT/AC | 8253 Number of splices: Non-canonical | 19826 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396078 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 57609 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 1.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1162967 1162967 1162967 N_multimapping 396078 396078 396078 N_noFeature 813600 18116987 932647 N_ambiguous 509611 2273 77681 UnstrandedReadsAssigned:17346430 PositiveStrandReadsAssigned:550381 NegativeStrandReadsAssigned:17659313 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR24886710 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR24886710-trimmed-pair1.fastq SRR24886710-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,228,686 reads, 18,025,623 reads pseudoaligned [quant] estimated average fragment length: 239.417 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52973 SRR24886710.ke.tsv 35125 SRR24886710.se.tsv 88098 total ==> SRR24886710.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.93 9.53047 1.07182 PNS24247 1044 805.583 43.6061 4.24873 PNS24249 1928 1689.58 16.837 0.782178 PNS24246 1044 805.583 43.6061 4.24873 PNS24248 1044 805.583 43.6061 4.24873 PNS24244 1471 1232.58 192.814 12.2785 PNS24243 293 105.597 0 0 KQK14069 1603 1364.58 5600.06 322.118 KQK14071 474 253.489 42.4923 13.1575 ==> SRR24886710.se.tsv <== BRADI_1g14170v3 6060 BRADI_1g53295v3 83 BRADI_1g59795v3 843 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 255 BRADI_1g74790v3 95 BRADI_1g09890v3 0 BRADI_1g77505v3 422 BRADI_1g48960v3 0 SRR24886710 completed mapping pipeline successfully