Starting /dee2/code/volunteer_pipeline.sh SRR24886711 current disk space = 1543131537408 free memory = 1593594584 SRR24886711 SRAfilesize 5c1dec21373ebfedfb156a44bdab3a82 SRR24886711.sra SRR24886711.sra file validated SRR24886711 is paired end SRR24886711 is conventional basespace SRR24886711 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886711_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42375 37.0 37.0 37.0 37.0 37.0 2 36.5165 37.0 37.0 37.0 37.0 37.0 3 36.497 37.0 37.0 37.0 37.0 37.0 4 36.608 37.0 37.0 37.0 37.0 37.0 5 36.606 37.0 37.0 37.0 37.0 37.0 6 36.625 37.0 37.0 37.0 37.0 37.0 7 36.643 37.0 37.0 37.0 37.0 37.0 8 36.6185 37.0 37.0 37.0 37.0 37.0 9 36.59 37.0 37.0 37.0 37.0 37.0 10-14 36.5895 37.0 37.0 37.0 37.0 37.0 15-19 36.505100000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4769 37.0 37.0 37.0 37.0 37.0 25-29 36.4636 37.0 37.0 37.0 37.0 37.0 30-34 36.4172 37.0 37.0 37.0 37.0 37.0 35-39 36.4199 37.0 37.0 37.0 37.0 37.0 40-44 36.386900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3771 37.0 37.0 37.0 37.0 37.0 50-54 36.367000000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.268100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.265299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2257 37.0 37.0 37.0 37.0 37.0 70-74 36.185599999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.2107 37.0 37.0 37.0 37.0 37.0 80-84 36.1629 37.0 37.0 37.0 37.0 37.0 85-89 36.1964 37.0 37.0 37.0 37.0 37.0 90-94 36.0058 37.0 37.0 37.0 37.0 37.0 95-99 36.0702 37.0 37.0 37.0 37.0 37.0 100-104 36.0061 37.0 37.0 37.0 37.0 37.0 105-109 35.979699999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.9286 37.0 37.0 37.0 37.0 37.0 115-119 35.923500000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.876200000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.853899999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.79780000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7198 37.0 37.0 37.0 37.0 37.0 140-144 35.70399999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.6186 37.0 37.0 37.0 37.0 37.0 150-151 35.41575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 1.0 25 10.0 26 7.0 27 16.0 28 15.0 29 27.0 30 29.0 31 33.0 32 63.0 33 66.0 34 135.0 35 315.0 36 2882.0 37 397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.060636431971936 9.095464795790528 4.585316963167126 48.258581809070414 2 17.849999999999998 12.325 39.25 30.575000000000003 3 17.474999999999998 12.625 26.05 43.85 4 22.25 21.75 22.1 33.900000000000006 5 25.224999999999998 27.175 24.45 23.150000000000002 6 23.95 31.95 23.925 20.175 7 18.975 24.975 37.75 18.3 8 20.3 23.825 31.65 24.224999999999998 9 18.9 21.4 35.85 23.849999999999998 10-14 21.795 26.029999999999998 27.425 24.75 15-19 21.805 25.69 26.805 25.7 20-24 22.835 26.009999999999998 26.755000000000003 24.4 25-29 22.145 26.1 26.13 25.624999999999996 30-34 21.975 25.985000000000003 26.25 25.790000000000003 35-39 22.375 25.509999999999998 26.395000000000003 25.72 40-44 22.23 25.605 26.27 25.895000000000003 45-49 22.830000000000002 24.985 26.665 25.52 50-54 22.439999999999998 25.590000000000003 26.715 25.255 55-59 22.2 25.85 26.58 25.369999999999997 60-64 22.615 25.905 25.865 25.615 65-69 23.135 26.06 25.814999999999998 24.990000000000002 70-74 22.994999999999997 25.705 25.88 25.419999999999998 75-79 22.61 25.590000000000003 26.284999999999997 25.515 80-84 22.99 25.685000000000002 26.31 25.014999999999997 85-89 22.400000000000002 25.995 25.805 25.8 90-94 22.8 25.44 26.58 25.180000000000003 95-99 22.78 25.53 25.96 25.729999999999997 100-104 22.53 26.08 26.11 25.28 105-109 22.384999999999998 25.840000000000003 26.045 25.729999999999997 110-114 23.235 25.86 25.669999999999998 25.235000000000003 115-119 22.965 26.200000000000003 25.674999999999997 25.16 120-124 23.01 26.090000000000003 25.39 25.509999999999998 125-129 23.105 25.845000000000002 25.740000000000002 25.31 130-134 22.865 26.479999999999997 25.590000000000003 25.064999999999998 135-139 23.485 26.26 25.27 24.985 140-144 23.44 26.0 25.115 25.445 145-149 22.96 26.68 24.705 25.655 150-151 23.150000000000002 26.575 24.8625 25.412499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 3.0 29 4.5 30 7.5 31 13.5 32 16.5 33 17.0 34 25.0 35 42.5 36 54.5 37 66.5 38 87.0 39 115.0 40 133.0 41 164.5 42 195.5 43 190.0 44 203.5 45 216.5 46 206.0 47 198.0 48 199.0 49 196.5 50 167.0 51 144.5 52 132.5 53 122.5 54 128.0 55 111.0 56 90.5 57 87.0 58 90.0 59 79.0 60 65.0 61 68.0 62 60.0 63 52.0 64 46.5 65 43.5 66 39.0 67 31.0 68 24.5 69 18.0 70 14.5 71 10.0 72 6.0 73 4.0 74 3.0 75 2.0 76 1.0 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.125 #Duplication Level Percentage of deduplicated Percentage of total 1 93.55704697986577 87.125 2 5.718120805369128 10.65 3 0.5637583892617449 1.575 4 0.1342281879194631 0.5 5 0.0 0.0 6 0.026845637583892613 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTAATTAATTTACATCATCATCGTGGTAGTACAAGTGAAACCAGCTA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2874999999999996 0.0 0.0 0.0 0.0 122-123 3.8625 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.5875 0.0 0.0 0.0 0.0 128-129 5.074999999999999 0.0 0.0 0.0 0.0 130-131 5.5625 0.0 0.0 0.0 0.0 132-133 6.05 0.0 0.0 0.0 0.0 134-135 6.575 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTGG 10 0.006830828 145.0 4 AACATCT 10 0.006830828 145.0 7 >>END_MODULE SRR24886711 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886711_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23 37.0 37.0 37.0 37.0 37.0 2 36.271 37.0 37.0 37.0 37.0 37.0 3 36.2685 37.0 37.0 37.0 37.0 37.0 4 36.3555 37.0 37.0 37.0 37.0 37.0 5 36.365 37.0 37.0 37.0 37.0 37.0 6 36.2865 37.0 37.0 37.0 37.0 37.0 7 36.25 37.0 37.0 37.0 37.0 37.0 8 36.313 37.0 37.0 37.0 37.0 37.0 9 36.1835 37.0 37.0 37.0 37.0 37.0 10-14 36.381600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.319 37.0 37.0 37.0 37.0 37.0 20-24 36.2981 37.0 37.0 37.0 37.0 37.0 25-29 36.2866 37.0 37.0 37.0 37.0 37.0 30-34 36.212900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.160700000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.1777 37.0 37.0 37.0 37.0 37.0 45-49 36.123099999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.073699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.062 37.0 37.0 37.0 37.0 37.0 60-64 36.028999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.0092 37.0 37.0 37.0 37.0 37.0 70-74 36.0268 37.0 37.0 37.0 37.0 37.0 75-79 35.9382 37.0 37.0 37.0 37.0 37.0 80-84 35.995599999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9559 37.0 37.0 37.0 37.0 37.0 90-94 35.8021 37.0 37.0 37.0 37.0 37.0 95-99 35.8351 37.0 37.0 37.0 37.0 37.0 100-104 35.838300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.75450000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.7812 37.0 37.0 37.0 37.0 37.0 115-119 35.694599999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.689800000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7469 37.0 37.0 37.0 37.0 37.0 130-134 35.6259 37.0 37.0 37.0 37.0 37.0 135-139 35.621300000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.468599999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.6183 37.0 37.0 37.0 37.0 37.0 150-151 35.15 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 4.0 23 3.0 24 0.0 25 6.0 26 7.0 27 15.0 28 20.0 29 15.0 30 27.0 31 53.0 32 51.0 33 100.0 34 200.0 35 523.0 36 2643.0 37 323.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.525 19.45 8.7 36.325 2 28.675 22.6 30.325000000000003 18.4 3 21.224999999999998 25.374999999999996 29.9 23.5 4 26.950000000000003 30.25 21.025 21.775 5 28.449999999999996 33.0 19.375 19.175 6 22.25 38.025 20.674999999999997 19.05 7 23.1 20.075000000000003 33.825 23.0 8 22.900000000000002 23.325000000000003 26.700000000000003 27.075 9 23.549999999999997 21.099999999999998 29.849999999999998 25.5 10-14 25.985000000000003 26.39 23.65 23.974999999999998 15-19 24.41 25.650000000000002 25.665 24.275 20-24 25.275 26.265 24.625 23.835 25-29 25.874999999999996 25.679999999999996 24.779999999999998 23.665 30-34 25.074999999999996 25.66 25.27 23.995 35-39 25.580000000000002 26.075 24.765 23.580000000000002 40-44 25.61 25.775 25.295 23.32 45-49 25.174999999999997 25.740000000000002 25.540000000000003 23.544999999999998 50-54 25.230000000000004 26.450000000000003 25.275 23.044999999999998 55-59 25.77 26.150000000000002 24.62 23.46 60-64 26.025 26.655 24.18 23.14 65-69 25.83 25.685000000000002 25.480000000000004 23.005 70-74 25.7 25.455 25.040000000000003 23.805 75-79 25.995 25.915 24.51 23.580000000000002 80-84 25.174999999999997 25.545 25.635 23.645 85-89 25.895000000000003 25.94 25.165 23.0 90-94 25.624999999999996 26.165 24.98 23.23 95-99 25.724999999999998 26.715 24.69 22.869999999999997 100-104 26.400000000000002 26.035000000000004 24.5 23.064999999999998 105-109 25.319999999999997 26.91 24.98 22.79 110-114 25.740000000000002 26.900000000000002 25.1 22.259999999999998 115-119 26.384999999999998 26.56 24.48 22.575 120-124 26.135 26.314999999999998 25.040000000000003 22.509999999999998 125-129 26.279999999999998 26.419999999999998 25.105 22.195 130-134 26.619999999999997 26.69 24.805 21.884999999999998 135-139 26.51 27.125 24.495 21.87 140-144 26.44 26.995 25.195 21.37 145-149 27.37 26.474999999999998 24.57 21.584999999999997 150-151 27.237499999999997 27.0125 23.724999999999998 22.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.0 27 1.0 28 7.0 29 7.5 30 4.5 31 8.0 32 14.0 33 18.5 34 27.0 35 39.0 36 42.5 37 51.5 38 76.5 39 110.0 40 128.0 41 158.0 42 178.5 43 188.0 44 192.0 45 187.0 46 201.5 47 204.0 48 182.0 49 178.0 50 184.0 51 153.0 52 124.0 53 115.0 54 109.0 55 107.5 56 94.5 57 97.0 58 102.5 59 79.0 60 78.0 61 77.5 62 63.5 63 58.5 64 59.5 65 54.5 66 46.5 67 47.0 68 44.0 69 34.0 70 20.5 71 12.0 72 8.0 73 6.0 74 6.0 75 2.0 76 0.5 77 1.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.38709677419355 86.85000000000001 2 5.913978494623656 11.0 3 0.5376344086021506 1.5 4 0.10752688172043011 0.4 5 0.053763440860215055 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 6.125 0.0 0.0 0.0 0.0 134-135 6.6875 0.0 0.0 0.0 0.0 136-137 7.325 0.0 0.0 0.0 0.0 138-139 7.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769524 spots for SRR24886711.sra Written 3769524 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra Read 3769521 spots for SRR24886711.sra Written 3769521 spots for SRR24886711.sra SRR ids: ['SRR24886711.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_errn0m25 SRR24886711.sra spots: 75390423 blocks: [[1, 3769521], [3769522, 7539042], [7539043, 11308563], [11308564, 15078084], [15078085, 18847605], [18847606, 22617126], [22617127, 26386647], [26386648, 30156168], [30156169, 33925689], [33925690, 37695210], [37695211, 41464731], [41464732, 45234252], [45234253, 49003773], [49003774, 52773294], [52773295, 56542815], [56542816, 60312336], [60312337, 64081857], [64081858, 67851378], [67851379, 71620899], [71620900, 75390423]] SRR24886711 file size 27853062 SRR24886711 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24886711 SRR24886711_1.fastq SRR24886711_2.fastq Input file: SRR24886711_1.fastq Paired file: SRR24886711_2.fastq trimmed: SRR24886711-trimmed-pair1.fastq, SRR24886711-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:55:09 2024 >> started Sat Dec 7 12:56:48 2024 >> done (98.508s) 75390423 read pairs processed; of these: 396 ( 0.00%) short read pairs filtered out after trimming by size control 1297 ( 0.00%) empty read pairs filtered out after trimming by size control 75388730 (100.00%) read pairs available; of these: 8627683 (11.44%) trimmed read pairs available after processing 66761047 (88.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 31 0.00% 19 20 0.00% 20 25 0.00% 21 28 0.00% 22 34 0.00% 23 38 0.00% 24 44 0.00% 25 50 0.00% 26 43 0.00% 27 67 0.00% 28 59 0.00% 29 70 0.00% 30 80 0.00% 31 90 0.00% 32 90 0.00% 33 81 0.00% 34 83 0.00% 35 110 0.00% 36 99 0.00% 37 104 0.00% 38 132 0.00% 39 123 0.00% 40 129 0.00% 41 156 0.00% 42 159 0.00% 43 165 0.00% 44 153 0.00% 45 153 0.00% 46 181 0.00% 47 201 0.00% 48 234 0.00% 49 265 0.00% 50 292 0.00% 51 302 0.00% 52 381 0.00% 53 414 0.00% 54 401 0.00% 55 409 0.00% 56 469 0.00% 57 570 0.00% 58 612 0.00% 59 681 0.00% 60 794 0.00% 61 892 0.00% 62 1039 0.00% 63 1078 0.00% 64 1292 0.00% 65 1331 0.00% 66 1471 0.00% 67 1731 0.00% 68 1916 0.00% 69 2257 0.00% 70 2639 0.00% 71 2895 0.00% 72 3403 0.00% 73 3920 0.01% 74 4366 0.01% 75 4756 0.01% 76 5422 0.01% 77 6023 0.01% 78 6718 0.01% 79 7469 0.01% 80 8320 0.01% 81 9089 0.01% 82 10945 0.01% 83 11975 0.02% 84 13405 0.02% 85 15089 0.02% 86 16454 0.02% 87 17846 0.02% 88 19426 0.03% 89 21224 0.03% 90 23167 0.03% 91 26092 0.03% 92 28377 0.04% 93 30825 0.04% 94 33719 0.04% 95 36533 0.05% 96 38704 0.05% 97 42407 0.06% 98 44758 0.06% 99 48395 0.06% 100 51670 0.07% 101 54943 0.07% 102 58070 0.08% 103 62085 0.08% 104 65711 0.09% 105 69115 0.09% 106 73092 0.10% 107 77052 0.10% 108 80474 0.11% 109 85168 0.11% 110 89213 0.12% 111 92155 0.12% 112 98519 0.13% 113 102045 0.14% 114 105694 0.14% 115 112564 0.15% 116 117400 0.16% 117 119939 0.16% 118 125711 0.17% 119 128468 0.17% 120 133727 0.18% 121 137856 0.18% 122 141156 0.19% 123 146749 0.19% 124 153354 0.20% 125 157142 0.21% 126 162004 0.21% 127 167347 0.22% 128 170327 0.23% 129 176037 0.23% 130 179378 0.24% 131 184169 0.24% 132 189836 0.25% 133 194672 0.26% 134 198044 0.26% 135 202314 0.27% 136 209223 0.28% 137 211690 0.28% 138 213450 0.28% 139 222543 0.30% 140 225892 0.30% 141 229550 0.30% 142 238398 0.32% 143 240797 0.32% 144 244566 0.32% 145 251552 0.33% 146 251355 0.33% 147 257531 0.34% 148 263608 0.35% 149 266346 0.35% 150 271992 0.36% 151 66761047 88.56% 75388730 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=29 prefix-density=0.27 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=32.75 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.6 sequence=TCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCGGTTGAGCTGACCCACTTGCG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=28 prefix-density=0.31 prefix-fanout=2.4 sequence=ATGTCGAGCGGC criterion=fanout-score sequence-density=0.22 sequence-density-rank=2 fanout-score=46.10 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=13.0 sequence=CAAGAAGAAGGT SRR24886711 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:58:10 Started mapping on | Dec 07 12:58:10 Finished on | Dec 07 13:05:32 Mapping speed, Million of reads per hour | 614.03 Number of input reads | 75388730 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 71260851 Uniquely mapped reads % | 94.52% Average mapped length | 295.94 Number of splices: Total | 78011809 Number of splices: Annotated (sjdb) | 73002205 Number of splices: GT/AG | 76975004 Number of splices: GC/AG | 925657 Number of splices: AT/AC | 34915 Number of splices: Non-canonical | 76233 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1132849 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 155046 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 1.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2995030 2995030 2995030 N_multimapping 1132849 1132849 1132849 N_noFeature 3539236 69284352 4091370 N_ambiguous 1693094 9579 272113 UnstrandedReadsAssigned:66028521 PositiveStrandReadsAssigned:1966920 NegativeStrandReadsAssigned:66897368 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR24886711 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR24886711-trimmed-pair1.fastq SRR24886711-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 75,388,730 reads, 67,900,640 reads pseudoaligned [quant] estimated average fragment length: 251.849 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52973 SRR24886711.ke.tsv 35125 SRR24886711.se.tsv 88098 total ==> SRR24886711.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 685.594 0 0 PNS24247 1044 793.151 270.861 7.62666 PNS24249 1928 1677.15 113.073 1.50567 PNS24246 1044 793.151 270.861 7.62666 PNS24248 1044 793.151 270.861 7.62666 PNS24244 1471 1220.15 529.343 9.68873 PNS24243 293 96.337 0 0 KQK14069 1603 1352.15 16440.8 271.544 KQK14071 474 242.592 439.919 40.4986 ==> SRR24886711.se.tsv <== BRADI_1g14170v3 20961 BRADI_1g53295v3 717 BRADI_1g59795v3 3632 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 1586 BRADI_1g74790v3 315 BRADI_1g09890v3 0 BRADI_1g77505v3 1137 BRADI_1g48960v3 0 SRR24886711 completed mapping pipeline successfully