Starting /dee2/code/volunteer_pipeline.sh SRR24886712 current disk space = 1543164207104 free memory = 1599094984 SRR24886712 SRAfilesize b68cfecc8f14df90846735ed2f64698d SRR24886712.sra SRR24886712.sra file validated SRR24886712 is paired end SRR24886712 is conventional basespace SRR24886712 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886712_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.493 37.0 37.0 37.0 37.0 37.0 2 36.3995 37.0 37.0 37.0 37.0 37.0 3 36.553 37.0 37.0 37.0 37.0 37.0 4 36.583 37.0 37.0 37.0 37.0 37.0 5 36.599 37.0 37.0 37.0 37.0 37.0 6 36.627 37.0 37.0 37.0 37.0 37.0 7 36.5365 37.0 37.0 37.0 37.0 37.0 8 36.6335 37.0 37.0 37.0 37.0 37.0 9 36.668 37.0 37.0 37.0 37.0 37.0 10-14 36.6548 37.0 37.0 37.0 37.0 37.0 15-19 36.58670000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.568 37.0 37.0 37.0 37.0 37.0 25-29 36.5351 37.0 37.0 37.0 37.0 37.0 30-34 36.4748 37.0 37.0 37.0 37.0 37.0 35-39 36.4524 37.0 37.0 37.0 37.0 37.0 40-44 36.4303 37.0 37.0 37.0 37.0 37.0 45-49 36.423899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.376099999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.344300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.349900000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.3284 37.0 37.0 37.0 37.0 37.0 70-74 36.248000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.24549999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.196600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1568 37.0 37.0 37.0 37.0 37.0 90-94 36.09250000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.098400000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0237 37.0 37.0 37.0 37.0 37.0 105-109 35.991 37.0 37.0 37.0 37.0 37.0 110-114 35.949 37.0 37.0 37.0 37.0 37.0 115-119 35.9143 37.0 37.0 37.0 37.0 37.0 120-124 35.8645 37.0 37.0 37.0 37.0 37.0 125-129 35.825500000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.7747 37.0 37.0 37.0 37.0 37.0 135-139 35.6656 37.0 37.0 37.0 37.0 37.0 140-144 35.5977 37.0 37.0 37.0 37.0 37.0 145-149 35.53 37.0 37.0 37.0 37.0 37.0 150-151 35.3545 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 2.0 21 1.0 22 1.0 23 3.0 24 2.0 25 4.0 26 7.0 27 7.0 28 15.0 29 23.0 30 29.0 31 39.0 32 64.0 33 91.0 34 133.0 35 304.0 36 2783.0 37 491.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.072536268134066 11.330665332666333 5.052526263131566 38.54427213606804 2 20.1 10.925 36.325 32.65 3 17.4 14.2 27.0 41.4 4 21.75 21.675 22.8 33.775 5 25.0 28.15 23.825 23.025000000000002 6 25.224999999999998 29.825000000000003 23.35 21.6 7 19.3 25.8 35.9 19.0 8 20.05 24.575 30.5 24.875 9 20.175 21.675 33.825 24.325 10-14 22.575 27.060000000000002 25.82 24.545 15-19 22.415 24.975 26.195 26.415 20-24 22.73 25.665 25.855 25.75 25-29 22.58 25.89 25.580000000000002 25.95 30-34 22.34 25.619999999999997 26.365 25.674999999999997 35-39 22.994999999999997 25.215 26.615 25.174999999999997 40-44 23.24 26.179999999999996 25.174999999999997 25.405 45-49 22.835 25.885 25.77 25.509999999999998 50-54 22.36 25.635 25.75 26.255 55-59 22.925 25.615 25.779999999999998 25.679999999999996 60-64 22.814999999999998 25.555 26.185000000000002 25.445 65-69 22.650000000000002 25.28 25.865 26.205000000000002 70-74 22.425 25.580000000000002 25.650000000000002 26.345000000000002 75-79 22.705000000000002 25.405 25.679999999999996 26.21 80-84 23.075000000000003 25.729999999999997 26.355 24.84 85-89 23.375 25.55 25.31 25.765 90-94 23.294999999999998 25.2 25.424999999999997 26.08 95-99 23.244999999999997 25.295 25.85 25.61 100-104 23.285 25.895000000000003 24.975 25.845000000000002 105-109 23.48 26.58 24.779999999999998 25.16 110-114 23.02 26.0 25.324999999999996 25.655 115-119 23.385 26.265 24.88 25.47 120-124 23.835 26.08 24.72 25.365 125-129 23.625 26.02 24.98 25.374999999999996 130-134 23.73 25.945 24.834999999999997 25.490000000000002 135-139 23.68 26.5 24.58 25.240000000000002 140-144 23.47 25.635 24.77 26.125 145-149 23.535 25.6 24.395 26.47 150-151 24.3125 24.75 24.3875 26.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 3.5 27 3.5 28 3.0 29 4.0 30 5.5 31 7.0 32 12.0 33 27.5 34 31.5 35 36.0 36 51.0 37 58.0 38 72.0 39 97.5 40 134.5 41 151.5 42 149.0 43 169.5 44 190.5 45 193.5 46 185.0 47 194.0 48 201.5 49 195.0 50 174.5 51 164.5 52 168.0 53 137.5 54 119.0 55 118.5 56 116.0 57 107.5 58 103.5 59 94.5 60 75.0 61 64.5 62 56.0 63 48.5 64 47.5 65 48.0 66 45.0 67 36.5 68 30.5 69 24.5 70 17.0 71 11.0 72 3.0 73 3.0 74 4.0 75 2.0 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.59639389736476 81.65 2 8.099861303744799 14.6 3 1.1095700416088765 3.0 4 0.1664355062413315 0.6 5 0.0 0.0 6 0.027739251040221912 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTGTCGGAAAATAACTAGTCCCGGGCCGACGAGATCCCGAACAAAGGC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 1.1125 0.0 0.0 0.0 0.0 90-91 1.325 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.6375000000000002 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.1375 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.75 0.0 0.0 0.0 0.0 104-105 3.1 0.0 0.0 0.0 0.0 106-107 3.4 0.0 0.0 0.0 0.0 108-109 3.8 0.0 0.0 0.0 0.0 110-111 4.0875 0.0 0.0 0.0 0.0 112-113 4.5 0.0 0.0 0.0 0.0 114-115 5.137499999999999 0.0 0.0 0.0 0.0 116-117 5.9625 0.0 0.0 0.0 0.0 118-119 6.5375 0.0 0.0 0.0 0.0 120-121 7.0875 0.0 0.0 0.0 0.0 122-123 7.55 0.0 0.0 0.0 0.0 124-125 8.1375 0.0 0.0 0.0 0.0 126-127 9.024999999999999 0.0 0.0 0.0 0.0 128-129 10.024999999999999 0.0 0.0 0.0 0.0 130-131 10.75 0.0 0.0 0.0 0.0 132-133 11.5375 0.0 0.0 0.0 0.0 134-135 12.25 0.0 0.0 0.0 0.0 136-137 13.025 0.0 0.0 0.0 0.0 138-139 14.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATTT 10 0.006830828 145.0 9 ATGGGGC 10 0.006830828 145.0 2 TTGAAGA 10 0.006830828 145.0 145 >>END_MODULE SRR24886712 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886712_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.17075 37.0 37.0 37.0 37.0 37.0 2 36.3485 37.0 37.0 37.0 37.0 37.0 3 36.386 37.0 37.0 37.0 37.0 37.0 4 36.353 37.0 37.0 37.0 37.0 37.0 5 36.358 37.0 37.0 37.0 37.0 37.0 6 36.2975 37.0 37.0 37.0 37.0 37.0 7 36.234 37.0 37.0 37.0 37.0 37.0 8 36.378 37.0 37.0 37.0 37.0 37.0 9 36.281 37.0 37.0 37.0 37.0 37.0 10-14 36.373999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2742 37.0 37.0 37.0 37.0 37.0 20-24 36.2419 37.0 37.0 37.0 37.0 37.0 25-29 36.1804 37.0 37.0 37.0 37.0 37.0 30-34 36.153999999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.106399999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.111399999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.103699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.0569 37.0 37.0 37.0 37.0 37.0 55-59 36.0696 37.0 37.0 37.0 37.0 37.0 60-64 35.9412 37.0 37.0 37.0 37.0 37.0 65-69 35.9012 37.0 37.0 37.0 37.0 37.0 70-74 35.9616 37.0 37.0 37.0 37.0 37.0 75-79 35.906099999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.9714 37.0 37.0 37.0 37.0 37.0 85-89 35.9511 37.0 37.0 37.0 37.0 37.0 90-94 35.7883 37.0 37.0 37.0 37.0 37.0 95-99 35.824200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.8108 37.0 37.0 37.0 37.0 37.0 105-109 35.71210000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.711 37.0 37.0 37.0 37.0 37.0 115-119 35.685199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.595499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.642100000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.55159999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.465199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.3271 37.0 37.0 37.0 32.2 37.0 145-149 35.397000000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.08575 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 6.0 15 7.0 16 1.0 17 5.0 18 2.0 19 3.0 20 1.0 21 1.0 22 6.0 23 8.0 24 12.0 25 12.0 26 9.0 27 13.0 28 14.0 29 17.0 30 29.0 31 31.0 32 44.0 33 80.0 34 146.0 35 400.0 36 2715.0 37 431.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.086021505376344 21.155288822205552 7.62690672668167 27.131782945736433 2 30.349999999999998 23.125 26.900000000000002 19.625 3 22.25 24.8 29.599999999999998 23.35 4 26.85 30.275000000000002 20.65 22.225 5 28.849999999999998 32.025 19.55 19.575 6 24.6 35.525 19.8 20.075000000000003 7 23.525 20.575 34.0 21.9 8 24.15 23.225 25.55 27.075 9 23.9 21.65 28.825 25.624999999999996 10-14 26.68 25.35 23.669999999999998 24.3 15-19 25.995 25.635 24.685000000000002 23.685000000000002 20-24 26.55 26.06 23.880000000000003 23.51 25-29 26.32 25.895000000000003 24.495 23.29 30-34 26.064999999999998 25.435000000000002 25.245 23.255 35-39 25.755 26.21 24.305 23.73 40-44 26.064999999999998 25.345000000000002 24.94 23.65 45-49 25.145 25.755 25.47 23.630000000000003 50-54 25.695 25.319999999999997 25.435000000000002 23.549999999999997 55-59 25.94 26.015 24.57 23.474999999999998 60-64 25.72 26.39 25.395 22.495 65-69 26.090000000000003 26.179999999999996 24.9 22.830000000000002 70-74 25.735000000000003 25.55 25.540000000000003 23.175 75-79 25.929999999999996 25.445 25.259999999999998 23.365 80-84 25.71 25.840000000000003 25.585 22.865 85-89 26.150000000000002 25.95 24.905 22.994999999999997 90-94 26.229999999999997 26.840000000000003 24.355 22.575 95-99 26.045 26.290000000000003 25.245 22.42 100-104 26.595000000000002 26.845000000000002 24.335 22.225 105-109 26.245 26.39 24.695 22.67 110-114 26.33 26.22 24.47 22.98 115-119 27.08 26.44 24.43 22.05 120-124 27.224999999999998 26.415 24.245 22.115000000000002 125-129 27.29 26.58 23.880000000000003 22.25 130-134 27.250000000000004 25.97 24.675 22.105 135-139 27.785 26.325 24.685000000000002 21.205 140-144 28.470000000000002 26.729999999999997 24.12 20.68 145-149 28.360000000000003 26.290000000000003 24.915000000000003 20.435 150-151 29.475 25.900000000000002 24.65 19.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 1.0 11 1.0 12 0.5 13 1.5 14 1.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 0.5 24 0.0 25 1.0 26 1.0 27 2.5 28 5.5 29 5.0 30 5.5 31 11.0 32 16.0 33 20.0 34 26.5 35 29.0 36 36.5 37 62.0 38 77.5 39 85.5 40 105.5 41 142.5 42 169.0 43 178.0 44 188.5 45 181.5 46 184.0 47 202.0 48 194.5 49 179.0 50 170.0 51 155.5 52 141.0 53 138.5 54 142.5 55 128.5 56 108.0 57 100.0 58 95.5 59 84.5 60 82.0 61 78.0 62 71.5 63 70.5 64 58.0 65 48.0 66 42.5 67 35.0 68 32.0 69 25.0 70 20.5 71 15.5 72 6.0 73 3.0 74 2.5 75 1.0 76 0.5 77 1.5 78 1.0 79 0.5 80 1.0 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 1.0 96 1.0 97 1.0 98 1.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.25 #Duplication Level Percentage of deduplicated Percentage of total 1 90.94182825484765 82.075 2 7.839335180055401 14.149999999999999 3 0.9418282548476453 2.55 4 0.16620498614958448 0.6 5 0.02770083102493075 0.125 6 0.02770083102493075 0.15 7 0.0554016620498615 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCT 7 0.17500000000000002 No Hit GAGAGGAGTCGGGTTCCTGTTGTGGCCTTTGTCGATATGGTTCCCCCCAC 6 0.15 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.3 0.0 0.0 0.0 0.0 92-93 1.4500000000000002 0.0 0.0 0.0 0.0 94-95 1.6375000000000002 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.1625 0.0 0.0 0.0 0.0 100-101 2.45 0.0 0.0 0.0 0.0 102-103 2.775 0.0 0.0 0.0 0.0 104-105 3.125 0.0 0.0 0.0 0.0 106-107 3.425 0.0 0.0 0.0 0.0 108-109 3.825 0.0 0.0 0.0 0.0 110-111 4.1125 0.0 0.0 0.0 0.0 112-113 4.525 0.0 0.0 0.0 0.0 114-115 5.137499999999999 0.0 0.0 0.0 0.0 116-117 5.95 0.0 0.0 0.0 0.0 118-119 6.525 0.0 0.0 0.0 0.0 120-121 7.0875 0.0 0.0 0.0 0.0 122-123 7.55 0.0 0.0 0.0 0.0 124-125 8.1375 0.0 0.0 0.0 0.0 126-127 9.05 0.0 0.0 0.0 0.0 128-129 10.05 0.0 0.0 0.0 0.0 130-131 10.8375 0.0 0.0 0.0 0.0 132-133 11.6375 0.0 0.0 0.0 0.0 134-135 12.3625 0.0 0.0 0.0 0.0 136-137 13.15 0.0 0.0 0.0 0.0 138-139 14.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGAT 10 0.006830828 145.0 7 TAAGATA 10 0.006830828 145.0 8 AAGATAT 10 0.006830828 145.0 9 AATAAGA 10 0.006830828 145.0 6 GGAATAA 10 0.006830828 145.0 4 >>END_MODULE Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100259 spots for SRR24886712.sra Written 1100259 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra Read 1100255 spots for SRR24886712.sra Written 1100255 spots for SRR24886712.sra SRR ids: ['SRR24886712.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e7da4w8p SRR24886712.sra spots: 22005104 blocks: [[1, 1100255], [1100256, 2200510], [2200511, 3300765], [3300766, 4401020], [4401021, 5501275], [5501276, 6601530], [6601531, 7701785], [7701786, 8802040], [8802041, 9902295], [9902296, 11002550], [11002551, 12102805], [12102806, 13203060], [13203061, 14303315], [14303316, 15403570], [15403571, 16503825], [16503826, 17604080], [17604081, 18704335], [18704336, 19804590], [19804591, 20904845], [20904846, 22005104]] SRR24886712 file size 8122114 SRR24886712 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24886712 SRR24886712_1.fastq SRR24886712_2.fastq Input file: SRR24886712_1.fastq Paired file: SRR24886712_2.fastq trimmed: SRR24886712-trimmed-pair1.fastq, SRR24886712-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:50:47 2024 >> started Sat Dec 7 12:51:14 2024 >> done (26.913s) 22005104 read pairs processed; of these: 155 ( 0.00%) short read pairs filtered out after trimming by size control 5780 ( 0.03%) empty read pairs filtered out after trimming by size control 21999169 (99.97%) read pairs available; of these: 4550242 (20.68%) trimmed read pairs available after processing 17448927 (79.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 10 0.00% 21 8 0.00% 22 7 0.00% 23 14 0.00% 24 34 0.00% 25 22 0.00% 26 28 0.00% 27 31 0.00% 28 31 0.00% 29 40 0.00% 30 39 0.00% 31 56 0.00% 32 36 0.00% 33 54 0.00% 34 48 0.00% 35 54 0.00% 36 71 0.00% 37 65 0.00% 38 78 0.00% 39 96 0.00% 40 109 0.00% 41 91 0.00% 42 130 0.00% 43 130 0.00% 44 121 0.00% 45 150 0.00% 46 153 0.00% 47 169 0.00% 48 222 0.00% 49 256 0.00% 50 313 0.00% 51 366 0.00% 52 395 0.00% 53 403 0.00% 54 421 0.00% 55 459 0.00% 56 536 0.00% 57 671 0.00% 58 772 0.00% 59 861 0.00% 60 1021 0.00% 61 1151 0.01% 62 1273 0.01% 63 1524 0.01% 64 1533 0.01% 65 1815 0.01% 66 2003 0.01% 67 2254 0.01% 68 2581 0.01% 69 3003 0.01% 70 3280 0.01% 71 3873 0.02% 72 4356 0.02% 73 5107 0.02% 74 5670 0.03% 75 6079 0.03% 76 6782 0.03% 77 7473 0.03% 78 8154 0.04% 79 8926 0.04% 80 10296 0.05% 81 11240 0.05% 82 12740 0.06% 83 14146 0.06% 84 15663 0.07% 85 17137 0.08% 86 18063 0.08% 87 19565 0.09% 88 20895 0.09% 89 22071 0.10% 90 23626 0.11% 91 26112 0.12% 92 27712 0.13% 93 29906 0.14% 94 31723 0.14% 95 33991 0.15% 96 35067 0.16% 97 37005 0.17% 98 38440 0.17% 99 40251 0.18% 100 42044 0.19% 101 43742 0.20% 102 45354 0.21% 103 47716 0.22% 104 49232 0.22% 105 50865 0.23% 106 53019 0.24% 107 54362 0.25% 108 55869 0.25% 109 57632 0.26% 110 58158 0.26% 111 60203 0.27% 112 62050 0.28% 113 63353 0.29% 114 65284 0.30% 115 68246 0.31% 116 69226 0.31% 117 70946 0.32% 118 71815 0.33% 119 72191 0.33% 120 74670 0.34% 121 74854 0.34% 122 75630 0.34% 123 78363 0.36% 124 80602 0.37% 125 81588 0.37% 126 83010 0.38% 127 83340 0.38% 128 83980 0.38% 129 85941 0.39% 130 86487 0.39% 131 87371 0.40% 132 88454 0.40% 133 90363 0.41% 134 90523 0.41% 135 92143 0.42% 136 93417 0.42% 137 92773 0.42% 138 93824 0.43% 139 95950 0.44% 140 95374 0.43% 141 97308 0.44% 142 98562 0.45% 143 98514 0.45% 144 100785 0.46% 145 101335 0.46% 146 101195 0.46% 147 102603 0.47% 148 102308 0.47% 149 103010 0.47% 150 103586 0.47% 151 17448927 79.32% 21999169 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=11.97 fanout-score-rank=5 prefix-density=0.47 prefix-fanout=5.7 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=103.42 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=3.4 sequence=GCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=28 prefix-density=0.47 prefix-fanout=2.5 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.19 sequence-density-rank=5 fanout-score=56.31 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=14.3 sequence=CAAGAAGAAGGT SRR24886712 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:51:54 Started mapping on | Dec 07 12:51:54 Finished on | Dec 07 12:54:09 Mapping speed, Million of reads per hour | 586.64 Number of input reads | 21999169 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 20083834 Uniquely mapped reads % | 91.29% Average mapped length | 289.45 Number of splices: Total | 20746102 Number of splices: Annotated (sjdb) | 19438252 Number of splices: GT/AG | 20464172 Number of splices: GC/AG | 251041 Number of splices: AT/AC | 9277 Number of splices: Non-canonical | 21612 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 580618 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 92376 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.59% % of reads unmapped: other | 2.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1334717 1334717 1334717 N_multimapping 580618 580618 580618 N_noFeature 1143705 19500117 1309738 N_ambiguous 490825 2563 74706 UnstrandedReadsAssigned:18449304 PositiveStrandReadsAssigned:581154 NegativeStrandReadsAssigned:18699390 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR24886712 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR24886712-trimmed-pair1.fastq SRR24886712-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,999,169 reads, 19,187,090 reads pseudoaligned [quant] estimated average fragment length: 228.172 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR24886712.ke.tsv 35125 SRR24886712.se.tsv 88098 total ==> SRR24886712.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 709.373 0 0 PNS24247 1044 816.828 75.2984 7.15676 PNS24249 1928 1700.83 18.5868 0.84841 PNS24246 1044 816.828 75.2984 7.15676 PNS24248 1044 816.828 75.2984 7.15676 PNS24244 1471 1243.83 196.518 12.266 PNS24243 293 112.019 0 0 KQK14069 1603 1375.83 4470.63 252.27 KQK14071 474 263.605 85.4012 25.1519 ==> SRR24886712.se.tsv <== BRADI_1g14170v3 5099 BRADI_1g53295v3 160 BRADI_1g59795v3 922 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 330 BRADI_1g74790v3 158 BRADI_1g09890v3 0 BRADI_1g77505v3 306 BRADI_1g48960v3 0 SRR24886712 completed mapping pipeline successfully