Starting /dee2/code/volunteer_pipeline.sh SRR24886713 current disk space = 1543198703616 free memory = 1600337216 SRR24886713 SRAfilesize 38384b0ad83509ab87120b2619b43bd4 SRR24886713.sra SRR24886713.sra file validated SRR24886713 is paired end SRR24886713 is conventional basespace SRR24886713 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886713_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5065 37.0 37.0 37.0 37.0 37.0 2 36.43 37.0 37.0 37.0 37.0 37.0 3 36.5545 37.0 37.0 37.0 37.0 37.0 4 36.6675 37.0 37.0 37.0 37.0 37.0 5 36.6415 37.0 37.0 37.0 37.0 37.0 6 36.6195 37.0 37.0 37.0 37.0 37.0 7 36.538 37.0 37.0 37.0 37.0 37.0 8 36.5525 37.0 37.0 37.0 37.0 37.0 9 36.61 37.0 37.0 37.0 37.0 37.0 10-14 36.5901 37.0 37.0 37.0 37.0 37.0 15-19 36.5302 37.0 37.0 37.0 37.0 37.0 20-24 36.498099999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.5176 37.0 37.0 37.0 37.0 37.0 30-34 36.424400000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4023 37.0 37.0 37.0 37.0 37.0 40-44 36.36560000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3925 37.0 37.0 37.0 37.0 37.0 50-54 36.3351 37.0 37.0 37.0 37.0 37.0 55-59 36.3181 37.0 37.0 37.0 37.0 37.0 60-64 36.3206 37.0 37.0 37.0 37.0 37.0 65-69 36.24679999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2735 37.0 37.0 37.0 37.0 37.0 75-79 36.2083 37.0 37.0 37.0 37.0 37.0 80-84 36.160900000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.1383 37.0 37.0 37.0 37.0 37.0 90-94 35.9946 37.0 37.0 37.0 37.0 37.0 95-99 36.125800000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0136 37.0 37.0 37.0 37.0 37.0 105-109 35.9589 37.0 37.0 37.0 37.0 37.0 110-114 35.909200000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.9406 37.0 37.0 37.0 37.0 37.0 120-124 35.88440000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.9102 37.0 37.0 37.0 37.0 37.0 130-134 35.772299999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.700599999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.6634 37.0 37.0 37.0 37.0 37.0 145-149 35.6009 37.0 37.0 37.0 37.0 37.0 150-151 35.52275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 5.0 24 6.0 25 1.0 26 5.0 27 7.0 28 18.0 29 26.0 30 18.0 31 44.0 32 49.0 33 103.0 34 130.0 35 362.0 36 2784.0 37 440.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.5062656641604 11.052631578947368 5.3884711779448615 41.05263157894737 2 19.125 11.125 36.075 33.675 3 17.8 13.65 26.450000000000003 42.1 4 21.75 22.125 22.225 33.900000000000006 5 25.6 27.35 24.45 22.6 6 23.799999999999997 31.424999999999997 21.825 22.95 7 18.625 27.224999999999998 36.625 17.525 8 19.55 25.95 29.275000000000002 25.224999999999998 9 19.75 21.275 33.425 25.55 10-14 22.485 26.97 25.83 24.715 15-19 22.384999999999998 26.015 25.995 25.605 20-24 22.11 25.779999999999998 27.060000000000002 25.05 25-29 22.225 25.919999999999998 26.32 25.535000000000004 30-34 22.06 26.174999999999997 26.064999999999998 25.7 35-39 22.16 26.5 25.53 25.81 40-44 22.63 25.8 26.22 25.35 45-49 22.32 25.740000000000002 26.284999999999997 25.655 50-54 22.470000000000002 26.245 26.064999999999998 25.22 55-59 22.34 25.995 26.334999999999997 25.330000000000002 60-64 22.720000000000002 25.775 26.200000000000003 25.305 65-69 22.400000000000002 25.509999999999998 26.295 25.795 70-74 23.085 25.629999999999995 25.995 25.290000000000003 75-79 22.84 25.615 26.195 25.35 80-84 22.875 25.814999999999998 26.05 25.259999999999998 85-89 23.285 25.395 26.0 25.319999999999997 90-94 23.16 26.07 25.645 25.124999999999996 95-99 22.605 25.5 26.340000000000003 25.555 100-104 22.935 25.900000000000002 25.71 25.455 105-109 22.88 26.245 25.72 25.155 110-114 23.185 25.7 25.885 25.230000000000004 115-119 23.365 26.150000000000002 25.2 25.285000000000004 120-124 22.6 25.94 25.735000000000003 25.724999999999998 125-129 23.18 25.645 25.985000000000003 25.19 130-134 22.994999999999997 26.02 25.435000000000002 25.55 135-139 23.425 25.840000000000003 25.035 25.7 140-144 23.255 25.145 25.465 26.135 145-149 23.03 26.115 25.014999999999997 25.840000000000003 150-151 23.075000000000003 25.887500000000003 24.0 27.037499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.0 29 3.5 30 6.5 31 12.0 32 14.0 33 15.5 34 24.0 35 44.0 36 52.0 37 62.5 38 88.5 39 105.5 40 136.5 41 157.0 42 169.5 43 181.0 44 197.0 45 221.0 46 230.0 47 225.5 48 205.5 49 190.0 50 173.5 51 155.5 52 138.5 53 118.5 54 118.0 55 112.5 56 90.5 57 85.0 58 91.0 59 81.0 60 62.0 61 57.0 62 64.0 63 63.5 64 52.5 65 48.5 66 37.5 67 25.0 68 20.5 69 17.5 70 14.0 71 9.5 72 6.0 73 4.0 74 4.0 75 2.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.08593962469405 84.65 2 7.152570029915692 13.15 3 0.6527060103345118 1.7999999999999998 4 0.10878433505575197 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.2249999999999996 0.0 0.0 0.0 0.0 112-113 2.5375 0.0 0.0 0.0 0.0 114-115 2.8875 0.0 0.0 0.0 0.0 116-117 3.0875 0.0 0.0 0.0 0.0 118-119 3.375 0.0 0.0 0.0 0.0 120-121 3.75 0.0 0.0 0.0 0.0 122-123 4.3 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.8 0.0 0.0 0.0 0.0 130-131 6.325 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.4 0.0 0.0 0.0 0.0 136-137 8.0125 0.0 0.0 0.0 0.0 138-139 8.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACCTC 10 0.006830828 145.0 8 GCTGTCT 10 0.006830828 145.0 1 TCAGAAA 10 0.006830828 145.0 2 GTCAGAA 10 0.006830828 145.0 1 CACCTGC 30 0.0017973486 72.5 145 >>END_MODULE SRR24886713 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886713_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1765 37.0 37.0 37.0 37.0 37.0 2 36.399 37.0 37.0 37.0 37.0 37.0 3 36.2815 37.0 37.0 37.0 37.0 37.0 4 36.2965 37.0 37.0 37.0 37.0 37.0 5 36.327 37.0 37.0 37.0 37.0 37.0 6 36.2165 37.0 37.0 37.0 37.0 37.0 7 36.253 37.0 37.0 37.0 37.0 37.0 8 36.3905 37.0 37.0 37.0 37.0 37.0 9 36.397 37.0 37.0 37.0 37.0 37.0 10-14 36.27040000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.266400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2132 37.0 37.0 37.0 37.0 37.0 25-29 36.1985 37.0 37.0 37.0 37.0 37.0 30-34 36.1477 37.0 37.0 37.0 37.0 37.0 35-39 36.050200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.0841 37.0 37.0 37.0 37.0 37.0 45-49 36.0967 37.0 37.0 37.0 37.0 37.0 50-54 36.05 37.0 37.0 37.0 37.0 37.0 55-59 35.9787 37.0 37.0 37.0 37.0 37.0 60-64 35.9501 37.0 37.0 37.0 37.0 37.0 65-69 35.8885 37.0 37.0 37.0 37.0 37.0 70-74 35.87330000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.8882 37.0 37.0 37.0 37.0 37.0 80-84 35.8888 37.0 37.0 37.0 37.0 37.0 85-89 35.8744 37.0 37.0 37.0 37.0 37.0 90-94 35.7462 37.0 37.0 37.0 37.0 37.0 95-99 35.792199999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.780899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.6717 37.0 37.0 37.0 37.0 37.0 110-114 35.6879 37.0 37.0 37.0 37.0 37.0 115-119 35.6074 37.0 37.0 37.0 37.0 37.0 120-124 35.6203 37.0 37.0 37.0 37.0 37.0 125-129 35.669200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.5484 37.0 37.0 37.0 37.0 37.0 135-139 35.517100000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.30929999999999 37.0 37.0 37.0 32.2 37.0 145-149 35.4799 37.0 37.0 37.0 37.0 37.0 150-151 35.164 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 2.0 15 5.0 16 0.0 17 1.0 18 1.0 19 2.0 20 2.0 21 6.0 22 2.0 23 7.0 24 13.0 25 12.0 26 12.0 27 9.0 28 18.0 29 20.0 30 28.0 31 40.0 32 50.0 33 90.0 34 165.0 35 470.0 36 2736.0 37 304.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.15 19.5 8.875 30.475 2 30.025000000000002 22.575 26.974999999999998 20.424999999999997 3 21.125 25.474999999999998 29.65 23.75 4 25.55 29.099999999999998 23.05 22.3 5 30.349999999999998 30.575000000000003 20.925 18.15 6 22.825 36.975 20.4 19.8 7 23.0 21.675 33.300000000000004 22.025 8 23.0 22.825 26.35 27.825 9 23.599999999999998 22.175 27.375 26.85 10-14 26.290000000000003 26.229999999999997 24.23 23.25 15-19 25.919999999999998 26.179999999999996 24.565 23.335 20-24 26.155 25.735000000000003 24.555 23.555 25-29 26.265 24.865000000000002 24.745 24.125 30-34 25.52 25.619999999999997 25.11 23.75 35-39 25.555 26.400000000000002 24.535 23.51 40-44 25.785000000000004 26.119999999999997 24.884999999999998 23.21 45-49 25.674999999999997 26.424999999999997 24.79 23.11 50-54 25.945 25.779999999999998 24.93 23.345 55-59 25.495 26.33 25.005 23.169999999999998 60-64 25.045 26.314999999999998 25.019999999999996 23.62 65-69 25.474999999999998 25.765 25.28 23.48 70-74 26.155 25.669999999999998 24.91 23.265 75-79 25.624999999999996 26.325 25.16 22.89 80-84 25.825 25.96 25.230000000000004 22.985 85-89 25.264999999999997 26.25 25.074999999999996 23.41 90-94 25.345000000000002 26.13 25.455 23.07 95-99 25.180000000000003 26.334999999999997 25.41 23.075000000000003 100-104 26.279999999999998 25.995 24.45 23.275000000000002 105-109 26.235000000000003 26.205000000000002 24.955 22.605 110-114 26.314999999999998 26.07 25.290000000000003 22.325 115-119 26.645000000000003 25.619999999999997 24.98 22.755 120-124 26.479999999999997 26.435 24.945 22.14 125-129 26.979999999999997 26.565 24.795 21.66 130-134 26.419999999999998 26.86 24.73 21.990000000000002 135-139 26.905 26.47 25.06 21.565 140-144 27.485 26.665 24.615000000000002 21.235 145-149 27.694999999999997 25.919999999999998 24.75 21.634999999999998 150-151 27.8375 27.025 24.3 20.837500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 2.0 26 2.0 27 4.5 28 6.5 29 6.0 30 6.0 31 11.0 32 14.5 33 12.5 34 22.5 35 37.0 36 45.5 37 59.0 38 81.5 39 113.0 40 140.0 41 146.0 42 158.0 43 171.0 44 184.5 45 201.5 46 200.5 47 192.5 48 174.5 49 177.0 50 189.5 51 171.0 52 137.0 53 125.0 54 121.5 55 98.0 56 93.5 57 93.0 58 80.0 59 87.0 60 95.5 61 76.5 62 61.5 63 57.0 64 47.0 65 58.5 66 60.0 67 43.5 68 39.5 69 26.5 70 14.5 71 14.0 72 10.5 73 5.5 74 3.5 75 2.5 76 2.5 77 2.5 78 1.0 79 0.5 80 1.0 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.20532319391636 84.875 2 7.1156979902227055 13.100000000000001 3 0.5431830526887561 1.5 4 0.10863661053775121 0.4 5 0.027159152634437803 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.9249999999999998 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9625 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.9000000000000004 0.0 0.0 0.0 0.0 122-123 4.45 0.0 0.0 0.0 0.0 124-125 5.0 0.0 0.0 0.0 0.0 126-127 5.3875 0.0 0.0 0.0 0.0 128-129 5.925 0.0 0.0 0.0 0.0 130-131 6.475 0.0 0.0 0.0 0.0 132-133 6.975 0.0 0.0 0.0 0.0 134-135 7.574999999999999 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138-139 8.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCTAG 10 0.006830828 145.0 5 GTCTGCA 40 0.005621335 54.375 145 >>END_MODULE Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050223 spots for SRR24886713.sra Written 3050223 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra Read 3050205 spots for SRR24886713.sra Written 3050205 spots for SRR24886713.sra SRR ids: ['SRR24886713.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dt3fbgul SRR24886713.sra spots: 61004118 blocks: [[1, 3050205], [3050206, 6100410], [6100411, 9150615], [9150616, 12200820], [12200821, 15251025], [15251026, 18301230], [18301231, 21351435], [21351436, 24401640], [24401641, 27451845], [27451846, 30502050], [30502051, 33552255], [33552256, 36602460], [36602461, 39652665], [39652666, 42702870], [42702871, 45753075], [45753076, 48803280], [48803281, 51853485], [51853486, 54903690], [54903691, 57953895], [57953896, 61004118]] SRR24886713 file size 22535960 SRR24886713 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24886713 SRR24886713_1.fastq SRR24886713_2.fastq Input file: SRR24886713_1.fastq Paired file: SRR24886713_2.fastq trimmed: SRR24886713-trimmed-pair1.fastq, SRR24886713-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:55:05 2024 >> started Sat Dec 7 12:56:24 2024 >> done (78.607s) 61004118 read pairs processed; of these: 254 ( 0.00%) short read pairs filtered out after trimming by size control 3645 ( 0.01%) empty read pairs filtered out after trimming by size control 61000219 (99.99%) read pairs available; of these: 8277950 (13.57%) trimmed read pairs available after processing 52722269 (86.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 32 0.00% 20 20 0.00% 21 26 0.00% 22 34 0.00% 23 23 0.00% 24 41 0.00% 25 55 0.00% 26 42 0.00% 27 39 0.00% 28 49 0.00% 29 44 0.00% 30 60 0.00% 31 72 0.00% 32 73 0.00% 33 77 0.00% 34 69 0.00% 35 82 0.00% 36 89 0.00% 37 98 0.00% 38 128 0.00% 39 108 0.00% 40 129 0.00% 41 145 0.00% 42 139 0.00% 43 125 0.00% 44 146 0.00% 45 144 0.00% 46 160 0.00% 47 212 0.00% 48 216 0.00% 49 282 0.00% 50 321 0.00% 51 332 0.00% 52 395 0.00% 53 405 0.00% 54 387 0.00% 55 426 0.00% 56 526 0.00% 57 601 0.00% 58 652 0.00% 59 809 0.00% 60 920 0.00% 61 1047 0.00% 62 1179 0.00% 63 1208 0.00% 64 1464 0.00% 65 1595 0.00% 66 1782 0.00% 67 1952 0.00% 68 2274 0.00% 69 2514 0.00% 70 2882 0.00% 71 3340 0.01% 72 3755 0.01% 73 4470 0.01% 74 4886 0.01% 75 5595 0.01% 76 6153 0.01% 77 6943 0.01% 78 7558 0.01% 79 8793 0.01% 80 9734 0.02% 81 10845 0.02% 82 12424 0.02% 83 13835 0.02% 84 15647 0.03% 85 17251 0.03% 86 18999 0.03% 87 20710 0.03% 88 22612 0.04% 89 24445 0.04% 90 26644 0.04% 91 29418 0.05% 92 32424 0.05% 93 34947 0.06% 94 38115 0.06% 95 41490 0.07% 96 44482 0.07% 97 48092 0.08% 98 50448 0.08% 99 53378 0.09% 100 57546 0.09% 101 60176 0.10% 102 64126 0.11% 103 68147 0.11% 104 72205 0.12% 105 75713 0.12% 106 79490 0.13% 107 83175 0.14% 108 86658 0.14% 109 91283 0.15% 110 94854 0.16% 111 97090 0.16% 112 102220 0.17% 113 105886 0.17% 114 110579 0.18% 115 115716 0.19% 116 118881 0.19% 117 123424 0.20% 118 126854 0.21% 119 130687 0.21% 120 133016 0.22% 121 137954 0.23% 122 140342 0.23% 123 143480 0.24% 124 149586 0.25% 125 151025 0.25% 126 156262 0.26% 127 160446 0.26% 128 163314 0.27% 129 167697 0.27% 130 170410 0.28% 131 173372 0.28% 132 177343 0.29% 133 181392 0.30% 134 182777 0.30% 135 186968 0.31% 136 191148 0.31% 137 192938 0.32% 138 194730 0.32% 139 201250 0.33% 140 202871 0.33% 141 206564 0.34% 142 212162 0.35% 143 213552 0.35% 144 216338 0.35% 145 220754 0.36% 146 219850 0.36% 147 225453 0.37% 148 228895 0.38% 149 232395 0.38% 150 234882 0.39% 151 52722269 86.43% 61000219 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=14 prefix-density=0.42 prefix-fanout=3.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=12 fanout-score=158.57 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=25.6 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=34 prefix-density=0.30 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=81.51 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR24886713 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:58:14 Started mapping on | Dec 07 12:58:15 Finished on | Dec 07 13:06:02 Mapping speed, Million of reads per hour | 470.24 Number of input reads | 61000219 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 57383377 Uniquely mapped reads % | 94.07% Average mapped length | 294.56 Number of splices: Total | 59275369 Number of splices: Annotated (sjdb) | 55607297 Number of splices: GT/AG | 58486584 Number of splices: GC/AG | 701518 Number of splices: AT/AC | 26684 Number of splices: Non-canonical | 60583 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 802780 % of reads mapped to multiple loci | 1.32% Number of reads mapped to too many loci | 102818 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 1.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2814062 2814062 2814062 N_multimapping 802780 802780 802780 N_noFeature 2916185 55784840 3393457 N_ambiguous 1330258 7995 211963 UnstrandedReadsAssigned:53136934 PositiveStrandReadsAssigned:1590542 NegativeStrandReadsAssigned:53777957 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR24886713 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR24886713-trimmed-pair1.fastq SRR24886713-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,000,219 reads, 54,655,443 reads pseudoaligned [quant] estimated average fragment length: 244.728 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52973 SRR24886713.ke.tsv 35125 SRR24886713.se.tsv 88098 total ==> SRR24886713.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 692.696 0 0 PNS24247 1044 800.272 210.869 7.42695 PNS24249 1928 1684.27 105.547 1.76633 PNS24246 1044 800.272 210.869 7.42695 PNS24248 1044 800.272 210.869 7.42695 PNS24244 1471 1227.27 451.846 10.3773 PNS24243 293 99.4023 0 0 KQK14069 1603 1359.27 22517.2 466.921 KQK14071 474 247.868 42.1374 4.79162 ==> SRR24886713.se.tsv <== BRADI_1g14170v3 23028 BRADI_1g53295v3 246 BRADI_1g59795v3 2286 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 853 BRADI_1g74790v3 167 BRADI_1g09890v3 0 BRADI_1g77505v3 1046 BRADI_1g48960v3 0 SRR24886713 completed mapping pipeline successfully