Starting /dee2/code/volunteer_pipeline.sh SRR24886714 current disk space = 1543241801728 free memory = 1606198816 SRR24886714 SRAfilesize d67f3638984c29a13a14980eb03dda4e SRR24886714.sra SRR24886714.sra file validated SRR24886714 is paired end SRR24886714 is conventional basespace SRR24886714 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886714_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5565 37.0 37.0 37.0 37.0 37.0 2 36.4155 37.0 37.0 37.0 37.0 37.0 3 36.447 37.0 37.0 37.0 37.0 37.0 4 36.632 37.0 37.0 37.0 37.0 37.0 5 36.6425 37.0 37.0 37.0 37.0 37.0 6 36.707 37.0 37.0 37.0 37.0 37.0 7 36.544 37.0 37.0 37.0 37.0 37.0 8 36.642 37.0 37.0 37.0 37.0 37.0 9 36.578 37.0 37.0 37.0 37.0 37.0 10-14 36.614999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5692 37.0 37.0 37.0 37.0 37.0 20-24 36.499100000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.4757 37.0 37.0 37.0 37.0 37.0 30-34 36.419399999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.402 37.0 37.0 37.0 37.0 37.0 40-44 36.3731 37.0 37.0 37.0 37.0 37.0 45-49 36.311099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3148 37.0 37.0 37.0 37.0 37.0 55-59 36.3144 37.0 37.0 37.0 37.0 37.0 60-64 36.2286 37.0 37.0 37.0 37.0 37.0 65-69 36.2048 37.0 37.0 37.0 37.0 37.0 70-74 36.241499999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.231700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1902 37.0 37.0 37.0 37.0 37.0 85-89 36.1136 37.0 37.0 37.0 37.0 37.0 90-94 36.0801 37.0 37.0 37.0 37.0 37.0 95-99 36.087900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9911 37.0 37.0 37.0 37.0 37.0 105-109 35.978 37.0 37.0 37.0 37.0 37.0 110-114 35.9534 37.0 37.0 37.0 37.0 37.0 115-119 35.852700000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.9035 37.0 37.0 37.0 37.0 37.0 125-129 35.8856 37.0 37.0 37.0 37.0 37.0 130-134 35.80400000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.6465 37.0 37.0 37.0 37.0 37.0 140-144 35.5274 37.0 37.0 37.0 37.0 37.0 145-149 35.527 37.0 37.0 37.0 37.0 37.0 150-151 35.3585 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 5.0 22 1.0 23 3.0 24 2.0 25 7.0 26 9.0 27 11.0 28 17.0 29 18.0 30 30.0 31 42.0 32 55.0 33 85.0 34 124.0 35 334.0 36 2798.0 37 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.275 12.049999999999999 6.775 36.9 2 21.099999999999998 12.15 33.675 33.074999999999996 3 17.549999999999997 17.349999999999998 26.900000000000002 38.2 4 21.775 23.200000000000003 23.65 31.374999999999996 5 23.925 28.575 24.75 22.75 6 23.75 32.225 22.75 21.275 7 17.825 25.4 38.475 18.3 8 22.675 23.95 27.700000000000003 25.674999999999997 9 19.175 23.200000000000003 33.15 24.474999999999998 10-14 21.98 27.255000000000003 25.665 25.1 15-19 21.795 26.08 26.384999999999998 25.740000000000002 20-24 22.68 25.96 26.02 25.34 25-29 22.52 26.11 25.835 25.535000000000004 30-34 22.325 26.1 25.785000000000004 25.790000000000003 35-39 22.42 25.575 26.39 25.615 40-44 22.145 26.255 25.825 25.775 45-49 21.895 25.97 26.305 25.83 50-54 22.2 26.555 25.88 25.365 55-59 22.365 26.11 26.005 25.52 60-64 22.59 25.665 26.150000000000002 25.595000000000002 65-69 23.035 26.165 25.445 25.355 70-74 23.025000000000002 26.21 25.374999999999996 25.39 75-79 22.919999999999998 25.85 25.679999999999996 25.55 80-84 22.314999999999998 26.27 25.740000000000002 25.674999999999997 85-89 22.84 25.34 26.39 25.430000000000003 90-94 23.07 25.765 25.545 25.619999999999997 95-99 22.650000000000002 25.869999999999997 26.0 25.480000000000004 100-104 23.27 25.740000000000002 26.174999999999997 24.815 105-109 23.29 26.665 25.0 25.045 110-114 23.075000000000003 25.52 25.674999999999997 25.729999999999997 115-119 23.14 26.155 25.56 25.145 120-124 24.035 25.72 25.064999999999998 25.180000000000003 125-129 22.785 26.0 25.555 25.66 130-134 23.205000000000002 25.779999999999998 25.385 25.629999999999995 135-139 23.665 25.490000000000002 24.990000000000002 25.855 140-144 23.674999999999997 26.21 24.895 25.22 145-149 23.695 25.595000000000002 24.97 25.740000000000002 150-151 23.525 25.7875 25.4625 25.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 1.0 26 1.5 27 1.0 28 5.0 29 9.0 30 9.5 31 14.0 32 19.5 33 26.0 34 33.5 35 41.0 36 53.0 37 84.5 38 109.0 39 114.5 40 128.5 41 157.0 42 166.5 43 163.0 44 187.0 45 193.0 46 195.0 47 202.0 48 193.5 49 189.5 50 164.0 51 136.5 52 138.5 53 136.0 54 124.5 55 108.5 56 95.0 57 96.0 58 91.0 59 79.5 60 75.5 61 72.5 62 62.0 63 55.0 64 49.5 65 48.0 66 44.5 67 38.5 68 32.0 69 21.0 70 10.5 71 6.5 72 7.0 73 4.0 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 91.69171904892048 83.875 2 7.43372506149221 13.600000000000001 3 0.7652364033889041 2.1 4 0.08198961464881116 0.3 5 0.027329871549603715 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGTAATGTCCTCAAAATGCTACGTTCAACGACCATCTGTAATGTACAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.2874999999999996 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.4625000000000004 0.0 0.0 0.0 0.0 118-119 3.9125 0.0 0.0 0.0 0.0 120-121 4.112500000000001 0.0 0.0 0.0 0.0 122-123 4.475 0.0 0.0 0.0 0.0 124-125 5.0125 0.0 0.0 0.0 0.0 126-127 5.5 0.0 0.0 0.0 0.0 128-129 5.9875 0.0 0.0 0.0 0.0 130-131 6.5 0.0 0.0 0.0 0.0 132-133 7.3 0.0 0.0 0.0 0.0 134-135 7.987500000000001 0.0 0.0 0.0 0.0 136-137 8.537500000000001 0.0 0.0 0.0 0.0 138-139 9.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGCGT 10 0.006830828 145.0 1 TAACTTT 10 0.006830828 145.0 9 GATAGAA 10 0.006830828 145.0 5 >>END_MODULE SRR24886714 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886714_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0695 37.0 37.0 37.0 37.0 37.0 2 36.3465 37.0 37.0 37.0 37.0 37.0 3 36.2595 37.0 37.0 37.0 37.0 37.0 4 36.2885 37.0 37.0 37.0 37.0 37.0 5 36.2875 37.0 37.0 37.0 37.0 37.0 6 36.1455 37.0 37.0 37.0 37.0 37.0 7 36.13 37.0 37.0 37.0 37.0 37.0 8 36.285 37.0 37.0 37.0 37.0 37.0 9 36.2545 37.0 37.0 37.0 37.0 37.0 10-14 36.192499999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.1743 37.0 37.0 37.0 37.0 37.0 20-24 36.132400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.0981 37.0 37.0 37.0 37.0 37.0 30-34 36.0501 37.0 37.0 37.0 37.0 37.0 35-39 35.945 37.0 37.0 37.0 37.0 37.0 40-44 35.943400000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9097 37.0 37.0 37.0 37.0 37.0 50-54 35.92399999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.9391 37.0 37.0 37.0 37.0 37.0 60-64 35.851099999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.807900000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.804899999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7498 37.0 37.0 37.0 37.0 37.0 80-84 35.751200000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.801399999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.6091 37.0 37.0 37.0 37.0 37.0 95-99 35.6709 37.0 37.0 37.0 37.0 37.0 100-104 35.6301 37.0 37.0 37.0 37.0 37.0 105-109 35.586299999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.5581 37.0 37.0 37.0 37.0 37.0 115-119 35.4848 37.0 37.0 37.0 37.0 37.0 120-124 35.51 37.0 37.0 37.0 37.0 37.0 125-129 35.3943 37.0 37.0 37.0 37.0 37.0 130-134 35.394 37.0 37.0 37.0 37.0 37.0 135-139 35.30499999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.2395 37.0 37.0 37.0 32.2 37.0 145-149 35.2884 37.0 37.0 37.0 32.2 37.0 150-151 35.0025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 9.0 15 5.0 16 3.0 17 3.0 18 1.0 19 3.0 20 5.0 21 5.0 22 9.0 23 10.0 24 12.0 25 8.0 26 12.0 27 14.0 28 15.0 29 20.0 30 21.0 31 42.0 32 63.0 33 95.0 34 173.0 35 488.0 36 2700.0 37 280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.725 20.575 9.3 26.400000000000002 2 31.75 21.4 26.924999999999997 19.925 3 22.85 24.175 30.5 22.475 4 28.999999999999996 30.5 19.0 21.5 5 26.974999999999998 33.85 19.475 19.7 6 24.375 36.7 20.025000000000002 18.9 7 23.425 19.125 33.675 23.775 8 23.400000000000002 24.8 23.525 28.275 9 24.75 22.925 26.75 25.575 10-14 26.82 25.619999999999997 23.505000000000003 24.055 15-19 26.169999999999998 25.8 24.355 23.674999999999997 20-24 26.16 25.855 24.044999999999998 23.94 25-29 25.96 25.89 24.560000000000002 23.59 30-34 26.47 25.645 24.95 22.935 35-39 26.155 26.21 24.27 23.365 40-44 26.105 25.729999999999997 24.63 23.535 45-49 26.25 25.585 24.705 23.46 50-54 24.705 25.645 25.215 24.435000000000002 55-59 26.145000000000003 25.624999999999996 24.86 23.369999999999997 60-64 25.869999999999997 25.979999999999997 24.83 23.32 65-69 26.155 25.374999999999996 24.91 23.56 70-74 25.77 26.215 24.85 23.165 75-79 25.924999999999997 25.56 25.16 23.355 80-84 25.91 25.96 25.35 22.78 85-89 26.46 26.445 24.5 22.595000000000002 90-94 26.150000000000002 26.69 24.535 22.625 95-99 26.479999999999997 25.635 24.695 23.189999999999998 100-104 26.179999999999996 26.3 24.66 22.86 105-109 26.284999999999997 26.745 24.435000000000002 22.535 110-114 26.235000000000003 26.5 24.42 22.845 115-119 26.295 26.345000000000002 25.230000000000004 22.13 120-124 26.450000000000003 26.765 24.215 22.57 125-129 26.88 26.685 23.73 22.705000000000002 130-134 27.46 25.740000000000002 24.565 22.235 135-139 27.284999999999997 25.974999999999998 24.6 22.14 140-144 27.389999999999997 26.35 24.54 21.72 145-149 27.644999999999996 26.0 24.42 21.935 150-151 26.987499999999997 26.9125 24.825 21.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.5 23 1.0 24 0.0 25 0.5 26 3.0 27 5.0 28 6.0 29 6.5 30 11.5 31 16.5 32 17.0 33 19.5 34 24.5 35 34.5 36 38.0 37 56.5 38 83.5 39 100.0 40 115.0 41 130.5 42 154.0 43 164.5 44 174.0 45 189.0 46 187.0 47 178.5 48 180.5 49 165.0 50 155.5 51 157.0 52 146.5 53 137.0 54 124.0 55 119.5 56 107.5 57 99.5 58 99.0 59 103.5 60 96.0 61 82.0 62 86.0 63 75.5 64 55.0 65 53.0 66 44.5 67 44.0 68 45.0 69 26.5 70 19.5 71 11.5 72 5.5 73 6.0 74 4.5 75 2.5 76 3.0 77 1.5 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 1.5 94 1.5 95 0.5 96 0.0 97 0.5 98 1.0 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.4 #Duplication Level Percentage of deduplicated Percentage of total 1 91.95842450765865 84.05 2 7.0568927789934355 12.9 3 0.8205689277899343 2.25 4 0.10940919037199125 0.4 5 0.02735229759299781 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02735229759299781 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit GGCATGCATGCCCCTGTCCCAGGAACTGTAGTGCCCCGTGCTCCGATAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.6124999999999998 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.3375000000000004 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 3.15 0.0 0.0 0.0 0.0 116-117 3.5374999999999996 0.0 0.0 0.0 0.0 118-119 3.9875 0.0 0.0 0.0 0.0 120-121 4.199999999999999 0.0 0.0 0.0 0.0 122-123 4.575 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.625 0.0 0.0 0.0 0.0 128-129 6.1375 0.0 0.0 0.0 0.0 130-131 6.65 0.0 0.0 0.0 0.0 132-133 7.45 0.0 0.0 0.0 0.0 134-135 8.175 0.0 0.0 0.0 0.0 136-137 8.7375 0.0 0.0 0.0 0.0 138-139 9.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTTTAC 10 0.006830828 145.0 1 >>END_MODULE Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra Read 1131026 spots for SRR24886714.sra Written 1131026 spots for SRR24886714.sra Read 1131017 spots for SRR24886714.sra Written 1131017 spots for SRR24886714.sra SRR ids: ['SRR24886714.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u0l4lnt7 SRR24886714.sra spots: 22620349 blocks: [[1, 1131017], [1131018, 2262034], [2262035, 3393051], [3393052, 4524068], [4524069, 5655085], [5655086, 6786102], [6786103, 7917119], [7917120, 9048136], [9048137, 10179153], [10179154, 11310170], [11310171, 12441187], [12441188, 13572204], [13572205, 14703221], [14703222, 15834238], [15834239, 16965255], [16965256, 18096272], [18096273, 19227289], [19227290, 20358306], [20358307, 21489323], [21489324, 22620349]] SRR24886714 file size 8349511 SRR24886714 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24886714 SRR24886714_1.fastq SRR24886714_2.fastq Input file: SRR24886714_1.fastq Paired file: SRR24886714_2.fastq trimmed: SRR24886714-trimmed-pair1.fastq, SRR24886714-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:54:28 2024 >> started Sat Dec 7 12:55:08 2024 >> done (40.313s) 22620349 read pairs processed; of these: 93 ( 0.00%) short read pairs filtered out after trimming by size control 4572 ( 0.02%) empty read pairs filtered out after trimming by size control 22615684 (99.98%) read pairs available; of these: 3057358 (13.52%) trimmed read pairs available after processing 19558326 (86.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 1 0.00% 20 10 0.00% 21 13 0.00% 22 10 0.00% 23 21 0.00% 24 17 0.00% 25 17 0.00% 26 14 0.00% 27 19 0.00% 28 29 0.00% 29 25 0.00% 30 30 0.00% 31 30 0.00% 32 30 0.00% 33 21 0.00% 34 30 0.00% 35 22 0.00% 36 43 0.00% 37 38 0.00% 38 38 0.00% 39 45 0.00% 40 41 0.00% 41 48 0.00% 42 61 0.00% 43 60 0.00% 44 86 0.00% 45 60 0.00% 46 73 0.00% 47 79 0.00% 48 92 0.00% 49 116 0.00% 50 117 0.00% 51 158 0.00% 52 142 0.00% 53 173 0.00% 54 132 0.00% 55 190 0.00% 56 209 0.00% 57 229 0.00% 58 253 0.00% 59 348 0.00% 60 375 0.00% 61 474 0.00% 62 481 0.00% 63 479 0.00% 64 537 0.00% 65 690 0.00% 66 727 0.00% 67 694 0.00% 68 880 0.00% 69 903 0.00% 70 1140 0.01% 71 1386 0.01% 72 1522 0.01% 73 1662 0.01% 74 1897 0.01% 75 2106 0.01% 76 2233 0.01% 77 2531 0.01% 78 2896 0.01% 79 3238 0.01% 80 3697 0.02% 81 4439 0.02% 82 4693 0.02% 83 5208 0.02% 84 6181 0.03% 85 6533 0.03% 86 7175 0.03% 87 7722 0.03% 88 8487 0.04% 89 9154 0.04% 90 10035 0.04% 91 11228 0.05% 92 12066 0.05% 93 13421 0.06% 94 14546 0.06% 95 15415 0.07% 96 16757 0.07% 97 17601 0.08% 98 18541 0.08% 99 19369 0.09% 100 21202 0.09% 101 22411 0.10% 102 23903 0.11% 103 25469 0.11% 104 27186 0.12% 105 28047 0.12% 106 29574 0.13% 107 30291 0.13% 108 31870 0.14% 109 33627 0.15% 110 34296 0.15% 111 35705 0.16% 112 38366 0.17% 113 39515 0.17% 114 41878 0.19% 115 42976 0.19% 116 44503 0.20% 117 45151 0.20% 118 46361 0.20% 119 46975 0.21% 120 48284 0.21% 121 50071 0.22% 122 51263 0.23% 123 53267 0.24% 124 56502 0.25% 125 56788 0.25% 126 59024 0.26% 127 58925 0.26% 128 59834 0.26% 129 61724 0.27% 130 61416 0.27% 131 63007 0.28% 132 64699 0.29% 133 66758 0.30% 134 67897 0.30% 135 69925 0.31% 136 72043 0.32% 137 71477 0.32% 138 71590 0.32% 139 73743 0.33% 140 73458 0.32% 141 74502 0.33% 142 76568 0.34% 143 77383 0.34% 144 80101 0.35% 145 81999 0.36% 146 82836 0.37% 147 85375 0.38% 148 84931 0.38% 149 84978 0.38% 150 85388 0.38% 151 19558326 86.48% 22615684 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=24 prefix-density=0.40 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.15 sequence-density-rank=19 fanout-score=126.30 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=21.6 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.65 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.22 sequence-density-rank=13 fanout-score=53.08 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=14.6 sequence=CAAGAAGAAGGT SRR24886714 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:57:09 Started mapping on | Dec 07 12:57:10 Finished on | Dec 07 12:59:03 Mapping speed, Million of reads per hour | 720.50 Number of input reads | 22615684 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21165261 Uniquely mapped reads % | 93.59% Average mapped length | 294.35 Number of splices: Total | 21644457 Number of splices: Annotated (sjdb) | 20287411 Number of splices: GT/AG | 21356688 Number of splices: GC/AG | 256791 Number of splices: AT/AC | 9421 Number of splices: Non-canonical | 21557 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.52 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403340 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 36590 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.36% % of reads unmapped: other | 1.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1047083 1047083 1047083 N_multimapping 403340 403340 403340 N_noFeature 1078559 20505137 1251452 N_ambiguous 575006 3213 89678 UnstrandedReadsAssigned:19511696 PositiveStrandReadsAssigned:656911 NegativeStrandReadsAssigned:19824131 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR24886714 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR24886714-trimmed-pair1.fastq SRR24886714-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,615,684 reads, 20,265,434 reads pseudoaligned [quant] estimated average fragment length: 248.279 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR24886714.ke.tsv 35125 SRR24886714.se.tsv 88098 total ==> SRR24886714.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.152 0 0 PNS24247 1044 796.721 112.77 9.8142 PNS24249 1928 1680.72 39.1063 1.61331 PNS24246 1044 796.721 112.77 9.8142 PNS24248 1044 796.721 112.77 9.8142 PNS24244 1471 1223.72 228.582 12.9517 PNS24243 293 101.071 0 0 KQK14069 1603 1355.72 14852.8 759.635 KQK14071 474 246.447 251.422 70.7367 ==> SRR24886714.se.tsv <== BRADI_1g14170v3 16629 BRADI_1g53295v3 92 BRADI_1g59795v3 1466 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 244 BRADI_1g74790v3 112 BRADI_1g09890v3 0 BRADI_1g77505v3 510 BRADI_1g48960v3 1 SRR24886714 completed mapping pipeline successfully