Starting /dee2/code/volunteer_pipeline.sh SRR24886715 current disk space = 1543307223040 free memory = 1606498084 SRR24886715 SRAfilesize 0c37f97519b75ddd7e1bb9ce8cfc06f6 SRR24886715.sra SRR24886715.sra file validated SRR24886715 is paired end SRR24886715 is conventional basespace SRR24886715 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886715_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.53 37.0 37.0 37.0 37.0 37.0 2 36.499 37.0 37.0 37.0 37.0 37.0 3 36.564 37.0 37.0 37.0 37.0 37.0 4 36.602 37.0 37.0 37.0 37.0 37.0 5 36.661 37.0 37.0 37.0 37.0 37.0 6 36.6185 37.0 37.0 37.0 37.0 37.0 7 36.5725 37.0 37.0 37.0 37.0 37.0 8 36.6175 37.0 37.0 37.0 37.0 37.0 9 36.626 37.0 37.0 37.0 37.0 37.0 10-14 36.6034 37.0 37.0 37.0 37.0 37.0 15-19 36.5629 37.0 37.0 37.0 37.0 37.0 20-24 36.5195 37.0 37.0 37.0 37.0 37.0 25-29 36.4839 37.0 37.0 37.0 37.0 37.0 30-34 36.4568 37.0 37.0 37.0 37.0 37.0 35-39 36.3865 37.0 37.0 37.0 37.0 37.0 40-44 36.389599999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.321799999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3593 37.0 37.0 37.0 37.0 37.0 55-59 36.2904 37.0 37.0 37.0 37.0 37.0 60-64 36.2606 37.0 37.0 37.0 37.0 37.0 65-69 36.241 37.0 37.0 37.0 37.0 37.0 70-74 36.2145 37.0 37.0 37.0 37.0 37.0 75-79 36.168800000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.156400000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.1289 37.0 37.0 37.0 37.0 37.0 90-94 36.0381 37.0 37.0 37.0 37.0 37.0 95-99 36.134699999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.0629 37.0 37.0 37.0 37.0 37.0 105-109 36.0263 37.0 37.0 37.0 37.0 37.0 110-114 35.9113 37.0 37.0 37.0 37.0 37.0 115-119 35.8912 37.0 37.0 37.0 37.0 37.0 120-124 35.916700000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.9002 37.0 37.0 37.0 37.0 37.0 130-134 35.8464 37.0 37.0 37.0 37.0 37.0 135-139 35.7209 37.0 37.0 37.0 37.0 37.0 140-144 35.5646 37.0 37.0 37.0 37.0 37.0 145-149 35.456 37.0 37.0 37.0 37.0 37.0 150-151 35.40975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 2.0 22 0.0 23 0.0 24 8.0 25 7.0 26 7.0 27 11.0 28 8.0 29 23.0 30 38.0 31 46.0 32 48.0 33 83.0 34 134.0 35 326.0 36 2769.0 37 488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.41941941941942 11.736736736736738 8.008008008008009 35.83583583583583 2 19.675 11.65 35.425000000000004 33.25 3 17.424999999999997 17.125 28.025 37.425000000000004 4 21.275 24.575 24.474999999999998 29.675 5 23.175 29.625 24.625 22.575 6 22.775000000000002 31.55 23.799999999999997 21.875 7 17.05 25.900000000000002 38.800000000000004 18.25 8 18.75 25.275 30.475 25.5 9 18.925 22.2 34.125 24.75 10-14 21.63 26.855 26.715 24.8 15-19 21.965 26.38 26.395000000000003 25.259999999999998 20-24 22.42 26.605 25.874999999999996 25.1 25-29 21.81 26.75 26.205000000000002 25.235000000000003 30-34 21.94 26.125 26.255 25.679999999999996 35-39 21.7 26.340000000000003 26.634999999999998 25.324999999999996 40-44 21.85 26.724999999999998 26.05 25.374999999999996 45-49 21.91 25.645 26.55 25.895000000000003 50-54 21.94 26.215 26.064999999999998 25.779999999999998 55-59 22.8 26.3 25.75 25.15 60-64 22.13 26.715 25.845000000000002 25.31 65-69 22.5 26.240000000000002 26.224999999999998 25.035 70-74 22.54 26.52 26.14 24.8 75-79 22.220000000000002 26.724999999999998 25.985000000000003 25.069999999999997 80-84 21.98 26.619999999999997 25.805 25.595000000000002 85-89 22.400000000000002 26.135 25.635 25.83 90-94 22.905 26.275 25.69 25.130000000000003 95-99 22.14 25.985000000000003 26.05 25.825 100-104 22.939999999999998 25.595000000000002 25.779999999999998 25.685000000000002 105-109 22.975 26.724999999999998 25.3 25.0 110-114 23.400000000000002 26.43 25.85 24.32 115-119 22.45 26.085 25.545 25.919999999999998 120-124 23.43 25.509999999999998 25.869999999999997 25.19 125-129 23.34 25.814999999999998 25.15 25.695 130-134 22.865 26.055 25.52 25.56 135-139 22.485 26.39 25.169999999999998 25.955000000000002 140-144 23.305 26.445 24.57 25.679999999999996 145-149 23.09 25.655 25.275 25.979999999999997 150-151 22.375 27.0625 24.925 25.637500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 2.0 24 2.0 25 0.5 26 2.0 27 3.0 28 2.0 29 4.5 30 8.0 31 12.0 32 15.5 33 24.5 34 40.0 35 48.5 36 63.0 37 78.5 38 90.0 39 116.0 40 142.0 41 153.0 42 168.0 43 187.5 44 196.5 45 198.0 46 207.0 47 212.5 48 199.5 49 189.5 50 170.0 51 152.0 52 149.0 53 135.5 54 130.0 55 122.0 56 113.0 57 109.5 58 89.0 59 72.5 60 66.5 61 61.0 62 49.5 63 40.5 64 34.5 65 32.0 66 31.0 67 20.5 68 11.5 69 10.0 70 10.5 71 8.0 72 3.0 73 0.5 74 1.0 75 1.5 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.82619508151423 82.175 2 7.90273556231003 14.299999999999999 3 1.1881735285990604 3.225 4 0.08289582757667864 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.825 0.0 0.0 0.0 0.0 110-111 3.0875 0.0 0.0 0.0 0.0 112-113 3.525 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.550000000000001 0.0 0.0 0.0 0.0 118-119 5.050000000000001 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 6.25 0.0 0.0 0.0 0.0 124-125 6.6375 0.0 0.0 0.0 0.0 126-127 7.1125 0.0 0.0 0.0 0.0 128-129 7.775 0.0 0.0 0.0 0.0 130-131 8.25 0.0 0.0 0.0 0.0 132-133 8.7875 0.0 0.0 0.0 0.0 134-135 9.225 0.0 0.0 0.0 0.0 136-137 9.8625 0.0 0.0 0.0 0.0 138-139 10.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACATAA 10 0.006830828 145.0 4 ATAAAGG 10 0.006830828 145.0 7 CAGAAGA 10 0.006830828 145.0 4 ATACATA 10 0.006830828 145.0 3 >>END_MODULE SRR24886715 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR24886715_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0025 37.0 37.0 37.0 37.0 37.0 2 36.023 37.0 37.0 37.0 37.0 37.0 3 36.089 37.0 37.0 37.0 37.0 37.0 4 36.218 37.0 37.0 37.0 37.0 37.0 5 36.2065 37.0 37.0 37.0 37.0 37.0 6 36.1685 37.0 37.0 37.0 37.0 37.0 7 36.1535 37.0 37.0 37.0 37.0 37.0 8 36.268 37.0 37.0 37.0 37.0 37.0 9 36.171 37.0 37.0 37.0 37.0 37.0 10-14 36.113 37.0 37.0 37.0 37.0 37.0 15-19 36.0716 37.0 37.0 37.0 37.0 37.0 20-24 36.0527 37.0 37.0 37.0 37.0 37.0 25-29 35.993399999999994 37.0 37.0 37.0 37.0 37.0 30-34 35.9514 37.0 37.0 37.0 37.0 37.0 35-39 35.8294 37.0 37.0 37.0 37.0 37.0 40-44 35.8365 37.0 37.0 37.0 37.0 37.0 45-49 35.8442 37.0 37.0 37.0 37.0 37.0 50-54 35.793800000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.7897 37.0 37.0 37.0 37.0 37.0 60-64 35.7248 37.0 37.0 37.0 37.0 37.0 65-69 35.713100000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.703700000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.63719999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.660399999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.648 37.0 37.0 37.0 37.0 37.0 90-94 35.488299999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.516400000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.5104 37.0 37.0 37.0 37.0 37.0 105-109 35.409000000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.4393 37.0 37.0 37.0 37.0 37.0 115-119 35.3542 37.0 37.0 37.0 37.0 37.0 120-124 35.300700000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.3392 37.0 37.0 37.0 37.0 37.0 130-134 35.262 37.0 37.0 37.0 34.6 37.0 135-139 35.2106 37.0 37.0 37.0 29.8 37.0 140-144 35.0031 37.0 37.0 37.0 27.4 37.0 145-149 35.0213 37.0 37.0 37.0 25.0 37.0 150-151 34.792 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150-151 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 8.0 14 12.0 15 13.0 16 4.0 17 1.0 18 4.0 19 5.0 20 3.0 21 8.0 22 9.0 23 9.0 24 12.0 25 8.0 26 13.0 27 11.0 28 22.0 29 16.0 30 25.0 31 42.0 32 46.0 33 108.0 34 173.0 35 487.0 36 2634.0 37 324.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.474999999999994 20.349999999999998 9.525 25.650000000000002 2 32.7 22.900000000000002 24.5 19.900000000000002 3 24.075 26.174999999999997 28.7 21.05 4 25.874999999999996 30.875000000000004 21.65 21.6 5 28.9 32.175 19.875 19.05 6 25.0 35.55 19.8 19.650000000000002 7 22.875 19.025 35.325 22.775000000000002 8 24.9 24.3 23.724999999999998 27.075 9 23.65 23.775 28.499999999999996 24.075 10-14 27.395000000000003 25.979999999999997 23.405 23.22 15-19 26.255 26.375 23.9 23.47 20-24 26.575 25.945 24.42 23.06 25-29 26.040000000000003 26.255 24.32 23.385 30-34 25.595000000000002 25.790000000000003 24.884999999999998 23.73 35-39 26.200000000000003 26.834999999999997 23.97 22.994999999999997 40-44 25.985000000000003 26.205000000000002 24.595 23.215 45-49 25.790000000000003 26.305 24.86 23.044999999999998 50-54 25.590000000000003 26.395000000000003 25.535000000000004 22.48 55-59 25.765 26.93 24.89 22.415 60-64 26.465 26.125 24.785 22.625 65-69 25.45 26.615 25.650000000000002 22.285 70-74 25.629999999999995 26.5 25.069999999999997 22.8 75-79 25.6 26.974999999999998 25.395 22.03 80-84 26.07 27.134999999999998 25.005 21.790000000000003 85-89 26.14 26.534999999999997 24.925 22.400000000000002 90-94 25.88 26.825 25.665 21.63 95-99 25.745 26.490000000000002 25.55 22.215 100-104 26.314999999999998 26.525 25.455 21.705 105-109 26.369999999999997 26.805 24.884999999999998 21.94 110-114 26.305 27.345000000000002 24.725 21.625 115-119 26.669999999999998 26.625 24.675 22.03 120-124 26.784999999999997 26.645000000000003 24.95 21.62 125-129 26.729999999999997 27.98 24.015 21.275 130-134 26.865 26.955000000000002 25.27 20.91 135-139 26.619999999999997 27.125 24.959999999999997 21.295 140-144 27.544999999999998 27.529999999999998 24.7 20.225 145-149 27.439999999999998 27.015 24.865000000000002 20.68 150-151 26.674999999999997 26.625 24.9875 21.712500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.5 4 1.5 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 1.0 11 1.0 12 0.5 13 0.5 14 1.0 15 1.5 16 1.5 17 1.5 18 1.0 19 0.5 20 2.0 21 1.5 22 1.0 23 1.5 24 1.0 25 2.5 26 3.5 27 2.5 28 2.0 29 3.5 30 8.0 31 10.0 32 10.5 33 17.0 34 23.0 35 29.5 36 46.0 37 56.0 38 75.0 39 105.0 40 128.5 41 141.0 42 156.0 43 168.5 44 198.0 45 216.5 46 213.0 47 208.5 48 189.5 49 185.5 50 172.0 51 158.5 52 144.0 53 132.5 54 125.5 55 117.0 56 116.0 57 110.5 58 93.5 59 80.5 60 89.0 61 74.5 62 53.5 63 54.0 64 49.5 65 44.0 66 35.5 67 28.5 68 23.0 69 15.5 70 9.5 71 7.5 72 7.0 73 4.5 74 3.0 75 1.5 76 0.5 77 0.5 78 1.0 79 1.0 80 1.5 81 1.5 82 1.0 83 1.0 84 1.0 85 0.5 86 0.5 87 0.5 88 1.0 89 1.0 90 0.5 91 1.5 92 1.5 93 0.5 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.48056244830438 82.95 2 7.278742762613731 13.200000000000001 3 1.1028398125172318 3.0 4 0.055141990625861594 0.2 5 0.0 0.0 6 0.027570995312930797 0.15 7 0.0 0.0 8 0.0 0.0 9 0.027570995312930797 0.22499999999999998 >10 0.027570995312930797 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 9 0.22499999999999998 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.225 0.0 0.0 0.0 0.0 98-99 1.325 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.0875 0.0 0.0 0.0 0.0 112-113 3.525 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.550000000000001 0.0 0.0 0.0 0.0 118-119 5.050000000000001 0.0 0.0 0.0 0.0 120-121 5.5625 0.0 0.0 0.0 0.0 122-123 6.199999999999999 0.0 0.0 0.0 0.0 124-125 6.5875 0.0 0.0 0.0 0.0 126-127 7.075 0.0 0.0 0.0 0.0 128-129 7.737500000000001 0.0 0.0 0.0 0.0 130-131 8.212499999999999 0.0 0.0 0.0 0.0 132-133 8.7375 0.0 0.0 0.0 0.0 134-135 9.162500000000001 0.0 0.0 0.0 0.0 136-137 9.7875 0.0 0.0 0.0 0.0 138-139 10.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGAG 95 0.004191872 30.526318 145 >>END_MODULE Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014927 spots for SRR24886715.sra Written 1014927 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra Read 1014921 spots for SRR24886715.sra Written 1014921 spots for SRR24886715.sra SRR ids: ['SRR24886715.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ypa6f0x SRR24886715.sra spots: 20298426 blocks: [[1, 1014921], [1014922, 2029842], [2029843, 3044763], [3044764, 4059684], [4059685, 5074605], [5074606, 6089526], [6089527, 7104447], [7104448, 8119368], [8119369, 9134289], [9134290, 10149210], [10149211, 11164131], [11164132, 12179052], [12179053, 13193973], [13193974, 14208894], [14208895, 15223815], [15223816, 16238736], [16238737, 17253657], [17253658, 18268578], [18268579, 19283499], [19283500, 20298426]] SRR24886715 file size 7491324 SRR24886715 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR24886715 SRR24886715_1.fastq SRR24886715_2.fastq Input file: SRR24886715_1.fastq Paired file: SRR24886715_2.fastq trimmed: SRR24886715-trimmed-pair1.fastq, SRR24886715-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:57:14 2024 >> started Sat Dec 7 12:57:43 2024 >> done (29.184s) 20298426 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 8725 ( 0.04%) empty read pairs filtered out after trimming by size control 20289606 (99.96%) read pairs available; of these: 3130371 (15.43%) trimmed read pairs available after processing 17159235 (84.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 11 0.00% 21 8 0.00% 22 11 0.00% 23 14 0.00% 24 18 0.00% 25 18 0.00% 26 18 0.00% 27 24 0.00% 28 25 0.00% 29 24 0.00% 30 20 0.00% 31 30 0.00% 32 42 0.00% 33 34 0.00% 34 36 0.00% 35 38 0.00% 36 44 0.00% 37 43 0.00% 38 60 0.00% 39 56 0.00% 40 61 0.00% 41 69 0.00% 42 76 0.00% 43 51 0.00% 44 74 0.00% 45 78 0.00% 46 93 0.00% 47 102 0.00% 48 116 0.00% 49 135 0.00% 50 161 0.00% 51 153 0.00% 52 156 0.00% 53 190 0.00% 54 193 0.00% 55 243 0.00% 56 264 0.00% 57 310 0.00% 58 335 0.00% 59 423 0.00% 60 513 0.00% 61 550 0.00% 62 619 0.00% 63 636 0.00% 64 758 0.00% 65 759 0.00% 66 825 0.00% 67 970 0.00% 68 1161 0.01% 69 1294 0.01% 70 1455 0.01% 71 1632 0.01% 72 1925 0.01% 73 2208 0.01% 74 2366 0.01% 75 2541 0.01% 76 2784 0.01% 77 3155 0.02% 78 3451 0.02% 79 4062 0.02% 80 4491 0.02% 81 5046 0.02% 82 5908 0.03% 83 6422 0.03% 84 7152 0.04% 85 7745 0.04% 86 8330 0.04% 87 8763 0.04% 88 9687 0.05% 89 10409 0.05% 90 11509 0.06% 91 13155 0.06% 92 14285 0.07% 93 15592 0.08% 94 16894 0.08% 95 17562 0.09% 96 18710 0.09% 97 19599 0.10% 98 20638 0.10% 99 21741 0.11% 100 23328 0.11% 101 24751 0.12% 102 26576 0.13% 103 28199 0.14% 104 29982 0.15% 105 31122 0.15% 106 32147 0.16% 107 32939 0.16% 108 34201 0.17% 109 35083 0.17% 110 36771 0.18% 111 38027 0.19% 112 40542 0.20% 113 41823 0.21% 114 43929 0.22% 115 45911 0.23% 116 47304 0.23% 117 47357 0.23% 118 47931 0.24% 119 48797 0.24% 120 49799 0.25% 121 51620 0.25% 122 53321 0.26% 123 55609 0.27% 124 57560 0.28% 125 59172 0.29% 126 60416 0.30% 127 60576 0.30% 128 61039 0.30% 129 61434 0.30% 130 62135 0.31% 131 62551 0.31% 132 64495 0.32% 133 66726 0.33% 134 68401 0.34% 135 70348 0.35% 136 71523 0.35% 137 71535 0.35% 138 70642 0.35% 139 72313 0.36% 140 72142 0.36% 141 72718 0.36% 142 74626 0.37% 143 76477 0.38% 144 78078 0.38% 145 79867 0.39% 146 80663 0.40% 147 82017 0.40% 148 81984 0.40% 149 81285 0.40% 150 81404 0.40% 151 17159235 84.57% 20289606 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=19 prefix-density=0.25 prefix-fanout=2.8 sequence=TTTCCTCTGGCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=173.25 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=26.5 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=27 prefix-density=0.41 prefix-fanout=2.6 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=110.63 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.5 sequence=CTTCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTCTAAAACTTTAACTGCTTCCCAAATTTCCCCAATATCAGACATTCCTGT SRR24886715 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:58:45 Started mapping on | Dec 07 12:58:45 Finished on | Dec 07 13:03:11 Mapping speed, Million of reads per hour | 274.60 Number of input reads | 20289606 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17733271 Uniquely mapped reads % | 87.40% Average mapped length | 293.02 Number of splices: Total | 17973084 Number of splices: Annotated (sjdb) | 16911880 Number of splices: GT/AG | 17732683 Number of splices: GC/AG | 213823 Number of splices: AT/AC | 8316 Number of splices: Non-canonical | 18262 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 508176 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 65638 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.75% % of reads unmapped: other | 2.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2048159 2048159 2048159 N_multimapping 508176 508176 508176 N_noFeature 858224 17191953 987033 N_ambiguous 473461 2272 63034 UnstrandedReadsAssigned:16401586 PositiveStrandReadsAssigned:539046 NegativeStrandReadsAssigned:16683204 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR24886715 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR24886715-trimmed-pair1.fastq SRR24886715-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,289,606 reads, 17,211,254 reads pseudoaligned [quant] estimated average fragment length: 243.84 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR24886715.ke.tsv 35125 SRR24886715.se.tsv 88098 total ==> SRR24886715.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 693.524 0 0 PNS24247 1044 801.16 68.5741 7.11012 PNS24249 1928 1685.16 9.59057 0.472759 PNS24246 1044 801.16 68.5741 7.11012 PNS24248 1044 801.16 68.5741 7.11012 PNS24244 1471 1228.16 262.687 17.7672 PNS24243 293 104.166 0 0 KQK14069 1603 1360.16 2067.16 126.247 KQK14071 474 249.626 15.4931 5.15566 ==> SRR24886715.se.tsv <== BRADI_1g14170v3 2102 BRADI_1g53295v3 140 BRADI_1g59795v3 645 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 535 BRADI_1g74790v3 159 BRADI_1g09890v3 0 BRADI_1g77505v3 365 BRADI_1g48960v3 0 SRR24886715 completed mapping pipeline successfully