Starting /dee2/code/volunteer_pipeline.sh SRR26060477 current disk space = 1548832624640 free memory = 1390301128 SRR26060477 SRAfilesize e82c23ae2d41a3793f9b5348261cff4d SRR26060477.sra SRR26060477.sra file validated SRR26060477 is paired end SRR26060477 is conventional basespace SRR26060477 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26060477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.27375 37.0 37.0 37.0 37.0 37.0 2 36.2825 37.0 37.0 37.0 37.0 37.0 3 36.4805 37.0 37.0 37.0 37.0 37.0 4 36.369 37.0 37.0 37.0 37.0 37.0 5 36.46425 37.0 37.0 37.0 37.0 37.0 6 36.412 37.0 37.0 37.0 37.0 37.0 7 36.406 37.0 37.0 37.0 37.0 37.0 8 36.487 37.0 37.0 37.0 37.0 37.0 9 36.307 37.0 37.0 37.0 37.0 37.0 10-14 36.41945 37.0 37.0 37.0 37.0 37.0 15-19 36.4091 37.0 37.0 37.0 37.0 37.0 20-24 36.335699999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.2756 37.0 37.0 37.0 37.0 37.0 30-34 36.270799999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.2384 37.0 37.0 37.0 37.0 37.0 40-44 36.2518 37.0 37.0 37.0 37.0 37.0 45-49 36.1318 37.0 37.0 37.0 37.0 37.0 50-54 36.074200000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.0284 37.0 37.0 37.0 37.0 37.0 60-64 36.0829 37.0 37.0 37.0 37.0 37.0 65-69 36.0234 37.0 37.0 37.0 37.0 37.0 70-74 35.999199999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.0002 37.0 37.0 37.0 37.0 37.0 80-84 36.0122 37.0 37.0 37.0 37.0 37.0 85-89 35.970600000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.87140000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.745099999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.7383 37.0 37.0 37.0 37.0 37.0 105-109 35.6586 37.0 37.0 37.0 37.0 37.0 110-114 35.6099 37.0 37.0 37.0 37.0 37.0 115-119 35.582899999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.581999999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.5569 37.0 37.0 37.0 37.0 37.0 130-134 35.2617 37.0 37.0 37.0 34.6 37.0 135-139 35.1981 37.0 37.0 37.0 32.2 37.0 140-144 35.0318 37.0 37.0 37.0 29.8 37.0 145-149 34.827999999999996 37.0 37.0 37.0 25.0 37.0 150 34.867 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 4.0 24 5.0 25 7.0 26 11.0 27 16.0 28 28.0 29 32.0 30 41.0 31 61.0 32 71.0 33 133.0 34 203.0 35 373.0 36 2813.0 37 199.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.892365456821025 8.560700876095119 10.738423028785983 46.808510638297875 2 20.8 9.825000000000001 34.949999999999996 34.425 3 19.85 11.225 22.7 46.225 4 26.900000000000002 16.075 19.85 37.175000000000004 5 28.732183045761438 22.455613903475868 22.380595148787197 26.431607901975497 6 27.500000000000004 27.725 24.4 20.375 7 20.549999999999997 22.025 36.825 20.599999999999998 8 23.1 22.075 29.599999999999998 25.224999999999998 9 21.75 21.375 32.5 24.375 10-14 24.17620881044052 24.88124406220311 25.131256562828142 25.81129056452823 15-19 24.905 23.195 25.119999999999997 26.779999999999998 20-24 25.009999999999998 23.555 24.560000000000002 26.875 25-29 24.25 23.695 24.095 27.96 30-34 24.9 23.630000000000003 24.490000000000002 26.979999999999997 35-39 25.705 23.28 23.91 27.105 40-44 25.4 23.255 24.175 27.169999999999998 45-49 25.56 23.53 23.89 27.02 50-54 24.985 23.365 24.08 27.57 55-59 25.569999999999997 23.47 23.474999999999998 27.485 60-64 25.14 23.150000000000002 24.2 27.51 65-69 25.885 22.805 23.89 27.42 70-74 25.705 22.86 23.91 27.525 75-79 25.645 24.035 23.085 27.235 80-84 25.96 22.975 23.294999999999998 27.77 85-89 26.224999999999998 23.255 23.380000000000003 27.139999999999997 90-94 26.865 22.425 23.275000000000002 27.435 95-99 26.705000000000002 23.56 22.705000000000002 27.029999999999998 100-104 26.35 23.13 23.494999999999997 27.025 105-109 26.884999999999998 22.91 23.575 26.63 110-114 26.085 23.9 22.8 27.215 115-119 26.229999999999997 23.485 22.925 27.36 120-124 26.775 23.3 23.085 26.840000000000003 125-129 27.275 23.74 21.85 27.134999999999998 130-134 26.86 23.73 22.3 27.11 135-139 27.16 23.794999999999998 22.470000000000002 26.575 140-144 27.125 23.919999999999998 22.0 26.955000000000002 145-149 27.13 23.9 22.17 26.8 150 26.375 25.424999999999997 21.7 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.5 9 1.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 1.5 28 4.0 29 4.5 30 3.0 31 7.0 32 12.5 33 11.0 34 13.0 35 21.0 36 40.5 37 59.5 38 58.5 39 72.5 40 93.5 41 96.0 42 116.0 43 128.0 44 126.5 45 141.5 46 151.5 47 150.5 48 160.0 49 158.5 50 138.0 51 125.0 52 123.5 53 140.0 54 136.5 55 121.0 56 110.5 57 103.0 58 104.0 59 100.0 60 99.0 61 89.5 62 79.5 63 85.0 64 77.0 65 69.0 66 74.0 67 76.5 68 82.0 69 76.0 70 61.5 71 48.5 72 43.0 73 41.0 74 27.5 75 20.5 76 27.0 77 29.5 78 16.0 79 9.5 80 9.5 81 5.0 82 5.5 83 4.0 84 1.5 85 0.5 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.95 #Duplication Level Percentage of deduplicated Percentage of total 1 85.11018463371055 71.45 2 12.09053007742704 20.3 3 1.9952352590827873 5.025 4 0.5062537224538416 1.7000000000000002 5 0.08933889219773675 0.375 6 0.11911852293031568 0.6 7 0.05955926146515784 0.35000000000000003 8 0.02977963073257892 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 8 0.2 No Hit CTCGTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGG 7 0.17500000000000002 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 7 0.17500000000000002 No Hit GTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCT 6 0.15 No Hit CCCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTAT 6 0.15 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 6 0.15 No Hit ATCCAGAGCGATGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGA 6 0.15 No Hit GTCAAATTAAGCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTC 5 0.125 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 5 0.125 No Hit CCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.2375 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.2625 0.0 0.0 0.0 0.0 60-61 0.275 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.3125 0.0 0.0 0.0 0.0 66-67 0.4375 0.0 0.0 0.0 0.0 68-69 0.6375 0.0 0.0 0.0 0.0 70-71 0.6875 0.0 0.0 0.0 0.0 72-73 0.725 0.0 0.0 0.0 0.0 74-75 0.825 0.0 0.0 0.0 0.0 76-77 0.8625 0.0 0.0 0.0 0.0 78-79 0.9375 0.0 0.0 0.0 0.0 80-81 1.0625 0.0 0.0 0.0 0.0 82-83 1.15 0.0 0.0 0.0 0.0 84-85 1.375 0.0 0.0 0.0 0.0 86-87 1.6625 0.0 0.0 0.0 0.0 88-89 2.1 0.0 0.0 0.0 0.0 90-91 2.4375 0.0 0.0 0.0 0.0 92-93 2.6625 0.0 0.0 0.0 0.0 94-95 2.9875 0.0 0.0 0.0 0.0 96-97 3.3 0.0 0.0 0.0 0.0 98-99 3.8625 0.0 0.0 0.0 0.0 100-101 4.525 0.0 0.0 0.0 0.0 102-103 5.15 0.0 0.0 0.0 0.0 104-105 5.8875 0.0 0.0 0.0 0.0 106-107 6.5875 0.0 0.0 0.0 0.0 108-109 7.3125 0.0 0.0 0.0 0.0 110-111 8.0125 0.0 0.0 0.0 0.0 112-113 8.8125 0.0 0.0 0.0 0.0 114-115 9.4125 0.0 0.0 0.0 0.0 116-117 10.287500000000001 0.0 0.0 0.0 0.0 118-119 11.3875 0.0 0.0 0.0 0.0 120-121 12.5 0.0 0.0 0.0 0.0 122-123 14.024999999999999 0.0 0.0 0.0 0.0 124-125 15.325 0.0 0.0 0.0 0.0 126-127 16.549999999999997 0.0 0.0 0.0 0.0 128-129 17.975 0.0 0.0 0.0 0.0 130-131 19.4875 0.0 0.0 0.0 0.0 132-133 20.575 0.0 0.0 0.0 0.0 134-135 22.125 0.0 0.0 0.0 0.0 136-137 23.375 0.0 0.0 0.0 0.0 138 24.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAATT 10 0.006973645 144.0 7 TTGATAA 10 0.006973645 144.0 5 CTGCCTC 10 0.006973645 144.0 8 >>END_MODULE SRR26060477 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26060477_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.78325 37.0 37.0 37.0 37.0 37.0 2 36.0045 37.0 37.0 37.0 37.0 37.0 3 36.226 37.0 37.0 37.0 37.0 37.0 4 36.2525 37.0 37.0 37.0 37.0 37.0 5 36.2255 37.0 37.0 37.0 37.0 37.0 6 36.107 37.0 37.0 37.0 37.0 37.0 7 36.2125 37.0 37.0 37.0 37.0 37.0 8 36.192 37.0 37.0 37.0 37.0 37.0 9 36.1815 37.0 37.0 37.0 37.0 37.0 10-14 36.1573 37.0 37.0 37.0 37.0 37.0 15-19 36.1051 37.0 37.0 37.0 37.0 37.0 20-24 36.083549999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.0191 37.0 37.0 37.0 37.0 37.0 30-34 36.0402 37.0 37.0 37.0 37.0 37.0 35-39 35.997499999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.933049999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.924549999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9581 37.0 37.0 37.0 37.0 37.0 55-59 35.9218 37.0 37.0 37.0 37.0 37.0 60-64 35.8584 37.0 37.0 37.0 37.0 37.0 65-69 35.7976 37.0 37.0 37.0 37.0 37.0 70-74 35.75894999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.736450000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.66955 37.0 37.0 37.0 37.0 37.0 85-89 35.5417 37.0 37.0 37.0 37.0 37.0 90-94 35.571000000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.652699999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.522800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.47205 37.0 37.0 37.0 37.0 37.0 110-114 35.4708 37.0 37.0 37.0 37.0 37.0 115-119 35.383 37.0 37.0 37.0 37.0 37.0 120-124 35.263250000000006 37.0 37.0 37.0 29.8 37.0 125-129 35.225300000000004 37.0 37.0 37.0 29.8 37.0 130-134 35.082550000000005 37.0 37.0 37.0 25.0 37.0 135-139 34.97975 37.0 37.0 37.0 27.4 37.0 140-144 35.008300000000006 37.0 37.0 37.0 25.0 37.0 145-149 34.75635 37.0 37.0 37.0 25.0 37.0 150 34.446 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 8.0 16 4.0 17 1.0 18 1.0 19 1.0 20 0.0 21 5.0 22 4.0 23 14.0 24 8.0 25 16.0 26 10.0 27 16.0 28 23.0 29 24.0 30 29.0 31 56.0 32 54.0 33 93.0 34 207.0 35 712.0 36 2538.0 37 171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.9827456864216 15.503875968992247 12.503125781445362 41.01025256314079 2 26.875 25.25 27.125 20.75 3 24.675 25.424999999999997 23.275000000000002 26.625 4 28.9 27.55 17.150000000000002 26.400000000000002 5 30.575000000000003 27.325 19.175 22.925 6 25.124999999999996 34.525 18.8 21.55 7 26.400000000000002 18.5 30.0 25.1 8 27.625 22.6 22.55 27.224999999999998 9 27.125 21.825 24.75 26.3 10-14 27.4977497749775 24.677467746774678 21.03710371037104 26.787678767876788 15-19 27.455491098219643 24.114822964592918 22.994598919783957 25.43508701740348 20-24 27.721930482620653 24.116029007251814 22.34058514628657 25.82145536384096 25-29 27.760552110422083 24.08981796359272 21.949389877975594 26.200240048009604 30-34 27.555511102220443 24.32986597319464 22.554510902180436 25.56011202240448 35-39 27.408222466740025 25.087526257877364 21.466439931979593 26.03781134340302 40-44 27.45686421605401 24.34108527131783 21.815453863465866 26.386596649162293 45-49 26.976744186046513 24.14603650912728 22.575643910977742 26.301575393848463 50-54 28.078423527058117 24.73742122636791 21.80154046213864 25.382614784435333 55-59 27.423226968090425 23.812143643092927 22.676803040912276 26.087826347904368 60-64 27.2108843537415 23.714485794317728 22.74409763905562 26.330532212885156 65-69 27.696078431372552 24.26970788315326 21.963785514205682 26.070428171268507 70-74 28.072632684708122 23.845730578760442 22.064929218148166 26.016707518383274 75-79 27.837526887099195 23.730678805462457 22.27502376069231 26.15677054674603 80-84 27.972587664449 23.700665299384724 22.92531639237657 25.40143064378971 85-89 28.36418209104552 23.601800900450225 21.940970485242623 26.09304652326163 90-94 28.209104552276138 24.262131065532767 22.826413206603302 24.702351175587793 95-99 28.519259629814908 24.73736868434217 21.980990495247624 24.7623811905953 100-104 28.616446578631454 24.499799919967987 21.89875950380152 24.98499399759904 105-109 28.792956830573758 24.521034465509477 22.315041768795957 24.370966935120805 110-114 28.769384692346172 24.862431215607803 21.465732866433214 24.902451225612808 115-119 29.72486243121561 24.20210105052526 21.295647823911956 24.777388694347174 120-124 29.841412777027365 24.803642003101707 21.29171044074241 24.06323477912852 125-129 30.73536768384192 25.10755377688844 21.100550275137568 23.056528264132066 130-134 31.127119915953777 24.998749312121667 20.876482065135825 22.997648706788734 135-139 31.307218970433738 24.378408124468457 21.36174896192906 22.952623943168742 140-144 32.159295577346406 25.445267160296176 20.662397438463078 21.733039823894337 145-149 32.82305267897343 25.198859372654958 20.826454550002502 21.151633398369103 150 33.691845922961484 25.287643821910955 20.460230115057527 20.560280140070038 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.5 8 1.0 9 1.0 10 1.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 0.5 25 0.5 26 3.5 27 3.5 28 1.0 29 3.5 30 5.5 31 6.5 32 12.0 33 13.5 34 15.5 35 29.0 36 43.0 37 50.0 38 52.5 39 64.0 40 90.5 41 99.5 42 109.0 43 114.5 44 122.5 45 136.0 46 130.5 47 136.5 48 139.0 49 143.0 50 130.5 51 126.0 52 140.0 53 133.5 54 119.0 55 120.0 56 117.0 57 101.5 58 104.5 59 103.5 60 97.0 61 97.5 62 85.5 63 81.5 64 89.5 65 80.5 66 72.5 67 83.0 68 78.0 69 68.5 70 77.5 71 69.0 72 57.0 73 44.0 74 36.0 75 36.5 76 27.0 77 15.5 78 13.5 79 18.0 80 12.0 81 3.0 82 2.5 83 2.5 84 0.5 85 0.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.5 91 1.0 92 1.0 93 1.0 94 1.0 95 1.5 96 2.0 97 1.0 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.02 20-24 0.025 25-29 0.02 30-34 0.02 35-39 0.03 40-44 0.025 45-49 0.025 50-54 0.03 55-59 0.03 60-64 0.04 65-69 0.04 70-74 0.045 75-79 0.045 80-84 0.045 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.04 105-109 0.045 110-114 0.05 115-119 0.05 120-124 0.055 125-129 0.05 130-134 0.055 135-139 0.055 140-144 0.06 145-149 0.055 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.56640047323278 72.32499999999999 2 12.09701271813073 20.45 3 1.6267376515823722 4.125 4 0.47323277136941727 1.6 5 0.05915409642117716 0.25 6 0.08873114463176575 0.44999999999999996 7 0.0 0.0 8 0.02957704821058858 0.2 9 0.0 0.0 >10 0.05915409642117716 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 13 0.325 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit CGAGTATATAGCCTTGGCCGACAGGCCCGGGTAATCTTGGGAAATTTCAT 8 0.2 No Hit CTTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCG 6 0.15 No Hit CGCGGGCTTTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGC 6 0.15 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 6 0.15 No Hit GGCCCGGGTAATCTTGGGAAATTTCATCGTGATGGGGATAGATCATTGCA 5 0.125 No Hit AACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.0875 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.2375 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.2625 0.0 0.0 0.0 0.0 60-61 0.275 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.3125 0.0 0.0 0.0 0.0 66-67 0.4375 0.0 0.0 0.0 0.0 68-69 0.6125 0.0 0.0 0.0 0.0 70-71 0.6875 0.0 0.0 0.0 0.0 72-73 0.725 0.0 0.0 0.0 0.0 74-75 0.825 0.0 0.0 0.0 0.0 76-77 0.8875 0.0 0.0 0.0 0.0 78-79 0.975 0.0 0.0 0.0 0.0 80-81 1.125 0.0 0.0 0.0 0.0 82-83 1.225 0.0 0.0 0.0 0.0 84-85 1.45 0.0 0.0 0.0 0.0 86-87 1.7375 0.0 0.0 0.0 0.0 88-89 2.2 0.0 0.0 0.0 0.0 90-91 2.5375 0.0 0.0 0.0 0.0 92-93 2.7625 0.0 0.0 0.0 0.0 94-95 3.0999999999999996 0.0 0.0 0.0 0.0 96-97 3.425 0.0 0.0 0.0 0.0 98-99 3.9875 0.0 0.0 0.0 0.0 100-101 4.65 0.0 0.0 0.0 0.0 102-103 5.275 0.0 0.0 0.0 0.0 104-105 6.0125 0.0 0.0 0.0 0.0 106-107 6.7125 0.0 0.0 0.0 0.0 108-109 7.4375 0.0 0.0 0.0 0.0 110-111 8.162500000000001 0.0 0.0 0.0 0.0 112-113 8.9625 0.0 0.0 0.0 0.0 114-115 9.6125 0.0 0.0 0.0 0.0 116-117 10.462499999999999 0.0125 0.0 0.0 0.0 118-119 11.575 0.025 0.0 0.0 0.0 120-121 12.712499999999999 0.025 0.0 0.0 0.0 122-123 14.274999999999999 0.025 0.0 0.0 0.0 124-125 15.55 0.025 0.0 0.0 0.0 126-127 16.75 0.025 0.0 0.0 0.0 128-129 18.0875 0.025 0.0 0.0 0.0 130-131 19.5625 0.025 0.0 0.0 0.0 132-133 20.675 0.025 0.0 0.0 0.0 134-135 22.25 0.025 0.0 0.0 0.0 136-137 23.475 0.025 0.0 0.0 0.0 138 24.525 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACAC 10 0.006973645 144.0 5 CACACAA 10 0.006973645 144.0 7 AGTAGTC 10 0.006973645 144.0 7 CCAGTAG 10 0.006973645 144.0 5 GAAGCTA 10 0.006973645 144.0 2 CAGTAGT 10 0.006973645 144.0 6 CACAAGC 10 0.006973645 144.0 9 TAGTCAT 10 0.006973645 144.0 9 ACACACA 10 0.006973645 144.0 6 AGCACAC 10 0.006973645 144.0 3 CTTGATC 10 0.006973645 144.0 1 GCACACA 10 0.006973645 144.0 4 GTAGTCA 10 0.006973645 144.0 8 TTTTTTT 20 0.006139246 28.8 95-99 >>END_MODULE Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942313 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942313 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra Read 942304 spots for SRR26060477.sra Written 942304 spots for SRR26060477.sra SRR ids: ['SRR26060477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b8fk_yfi SRR26060477.sra spots: 18846089 blocks: [[1, 942304], [942305, 1884608], [1884609, 2826912], [2826913, 3769216], [3769217, 4711520], [4711521, 5653824], [5653825, 6596128], [6596129, 7538432], [7538433, 8480736], [8480737, 9423040], [9423041, 10365344], [10365345, 11307648], [11307649, 12249952], [12249953, 13192256], [13192257, 14134560], [14134561, 15076864], [15076865, 16019168], [16019169, 16961472], [16961473, 17903776], [17903777, 18846089]] SRR26060477 file size 6936166 SRR26060477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26060477 SRR26060477_1.fastq SRR26060477_2.fastq Input file: SRR26060477_1.fastq Paired file: SRR26060477_2.fastq trimmed: SRR26060477-trimmed-pair1.fastq, SRR26060477-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:46:56 2024 >> started Fri Dec 6 21:47:20 2024 >> done (23.666s) 18846089 read pairs processed; of these: 543 ( 0.00%) short read pairs filtered out after trimming by size control 30260 ( 0.16%) empty read pairs filtered out after trimming by size control 18815286 (99.84%) read pairs available; of these: 6302995 (33.50%) trimmed read pairs available after processing 12512291 (66.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 422 0.00% 19 106 0.00% 20 317 0.00% 21 204 0.00% 22 241 0.00% 23 249 0.00% 24 295 0.00% 25 358 0.00% 26 479 0.00% 27 586 0.00% 28 668 0.00% 29 900 0.00% 30 912 0.00% 31 980 0.01% 32 1234 0.01% 33 1237 0.01% 34 2355 0.01% 35 1337 0.01% 36 1334 0.01% 37 1476 0.01% 38 1562 0.01% 39 1711 0.01% 40 1701 0.01% 41 1952 0.01% 42 2004 0.01% 43 2083 0.01% 44 2199 0.01% 45 2367 0.01% 46 2534 0.01% 47 2799 0.01% 48 3593 0.02% 49 2762 0.01% 50 3051 0.02% 51 3132 0.02% 52 3485 0.02% 53 3452 0.02% 54 3855 0.02% 55 4201 0.02% 56 4181 0.02% 57 4307 0.02% 58 4858 0.03% 59 4939 0.03% 60 4884 0.03% 61 5360 0.03% 62 5777 0.03% 63 6357 0.03% 64 6429 0.03% 65 6923 0.04% 66 7210 0.04% 67 7888 0.04% 68 8089 0.04% 69 8210 0.04% 70 9038 0.05% 71 9540 0.05% 72 10512 0.06% 73 10647 0.06% 74 11320 0.06% 75 12058 0.06% 76 13020 0.07% 77 13292 0.07% 78 14065 0.07% 79 15524 0.08% 80 16111 0.09% 81 17185 0.09% 82 18444 0.10% 83 19188 0.10% 84 20383 0.11% 85 22303 0.12% 86 23724 0.13% 87 27175 0.14% 88 26475 0.14% 89 27528 0.15% 90 29983 0.16% 91 31810 0.17% 92 33468 0.18% 93 35557 0.19% 94 37539 0.20% 95 39318 0.21% 96 41168 0.22% 97 43215 0.23% 98 45876 0.24% 99 47581 0.25% 100 50228 0.27% 101 52721 0.28% 102 54602 0.29% 103 58161 0.31% 104 60937 0.32% 105 63440 0.34% 106 65478 0.35% 107 68933 0.37% 108 71235 0.38% 109 75747 0.40% 110 77393 0.41% 111 79904 0.42% 112 84623 0.45% 113 85786 0.46% 114 91901 0.49% 115 95474 0.51% 116 97751 0.52% 117 99217 0.53% 118 101333 0.54% 119 103608 0.55% 120 109294 0.58% 121 109727 0.58% 122 113694 0.60% 123 119527 0.64% 124 120432 0.64% 125 122620 0.65% 126 123570 0.66% 127 124030 0.66% 128 126549 0.67% 129 128985 0.69% 130 129057 0.69% 131 131088 0.70% 132 133255 0.71% 133 134152 0.71% 134 132028 0.70% 135 133339 0.71% 136 136232 0.72% 137 136837 0.73% 138 133745 0.71% 139 136905 0.73% 140 136138 0.72% 141 133439 0.71% 142 135481 0.72% 143 134942 0.72% 144 136108 0.72% 145 135614 0.72% 146 134989 0.72% 147 136194 0.72% 148 137596 0.73% 149 136364 0.72% 150 12512291 66.50% 18815286 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.88 fanout-score-rank=35 prefix-density=0.50 prefix-fanout=1.9 sequence=CCGTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATAAGCAACATCCGCCGATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGACCGGAATCCTATGATGTTATCCCATGCTAATGTATCCAGAGCGATGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACGATGCCGGAGGCACGACCCGGCCAATTAAGGCTAGGAGCGCATCGCCGGCTGAAGGGTCGAGTAGGTCGGTGCTCGCCGTGAGGCGGACCGGCCGACCCGGCCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=32.47 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=1.1 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTCCGCTTATTTATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=6 prefix-density=0.50 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=11.33 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=1.4 sequence=CGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGG SRR26060477 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:48:14 Started mapping on | Dec 06 21:48:14 Finished on | Dec 06 21:50:46 Mapping speed, Million of reads per hour | 445.63 Number of input reads | 18815286 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 15022873 Uniquely mapped reads % | 79.84% Average mapped length | 280.56 Number of splices: Total | 13391180 Number of splices: Annotated (sjdb) | 12676324 Number of splices: GT/AG | 13206445 Number of splices: GC/AG | 152607 Number of splices: AT/AC | 6653 Number of splices: Non-canonical | 25475 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 987682 % of reads mapped to multiple loci | 5.25% Number of reads mapped to too many loci | 425275 % of reads mapped to too many loci | 2.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 10.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2804853 2804853 2804853 N_multimapping 987682 987682 987682 N_noFeature 624455 14642779 771632 N_ambiguous 299294 1772 69017 UnstrandedReadsAssigned:14099124 PositiveStrandReadsAssigned:378322 NegativeStrandReadsAssigned:14182224 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=131 echo kmer=127 SRR26060477 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR26060477-trimmed-pair1.fastq SRR26060477-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,815,286 reads, 14,803,575 reads pseudoaligned [quant] estimated average fragment length: 184.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52973 SRR26060477.ke.tsv 35125 SRR26060477.se.tsv 88098 total ==> SRR26060477.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.883 0 0 PNS24247 1044 860.603 19.3958 2.05091 PNS24249 1928 1744.6 151.599 7.90759 PNS24246 1044 860.603 19.3958 2.05091 PNS24248 1044 860.603 19.3958 2.05091 PNS24244 1471 1287.6 9.21327 0.651141 PNS24243 293 123.573 0 0 KQK14069 1603 1419.6 2904.44 186.182 KQK14071 474 292.137 157.85 49.1702 ==> SRR26060477.se.tsv <== BRADI_1g14170v3 3208 BRADI_1g53295v3 21 BRADI_1g59795v3 278 BRADI_1g07683v3 0 BRADI_1g00485v3 25 BRADI_1g20270v3 1857 BRADI_1g74790v3 73 BRADI_1g09890v3 3 BRADI_1g77505v3 259 BRADI_1g48960v3 0 SRR26060477 completed mapping pipeline successfully