Starting /dee2/code/volunteer_pipeline.sh SRR26060478 current disk space = 1516048695296 free memory = 1570820252 SRR26060478 SRAfilesize 2bf2c84af6c29eca47548dfce0f8cfe0 SRR26060478.sra SRR26060478.sra file validated SRR26060478 is paired end SRR26060478 is conventional basespace SRR26060478 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26060478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.15525 37.0 37.0 37.0 37.0 37.0 2 36.1305 37.0 37.0 37.0 37.0 37.0 3 36.309 37.0 37.0 37.0 37.0 37.0 4 36.375 37.0 37.0 37.0 37.0 37.0 5 36.301 37.0 37.0 37.0 37.0 37.0 6 36.382 37.0 37.0 37.0 37.0 37.0 7 36.3965 37.0 37.0 37.0 37.0 37.0 8 36.43 37.0 37.0 37.0 37.0 37.0 9 36.364 37.0 37.0 37.0 37.0 37.0 10-14 36.3525 37.0 37.0 37.0 37.0 37.0 15-19 36.34779999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2808 37.0 37.0 37.0 37.0 37.0 25-29 36.229 37.0 37.0 37.0 37.0 37.0 30-34 36.251400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.2278 37.0 37.0 37.0 37.0 37.0 40-44 36.209700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1284 37.0 37.0 37.0 37.0 37.0 50-54 36.088300000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.029999999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.98969999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.9812 37.0 37.0 37.0 37.0 37.0 70-74 35.98720000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.9545 37.0 37.0 37.0 37.0 37.0 80-84 35.9677 37.0 37.0 37.0 37.0 37.0 85-89 35.9442 37.0 37.0 37.0 37.0 37.0 90-94 35.858000000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.74849999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.6771 37.0 37.0 37.0 37.0 37.0 105-109 35.602500000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.584 37.0 37.0 37.0 37.0 37.0 115-119 35.529399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.5829 37.0 37.0 37.0 37.0 37.0 125-129 35.5054 37.0 37.0 37.0 37.0 37.0 130-134 35.23910000000001 37.0 37.0 37.0 32.2 37.0 135-139 35.1226 37.0 37.0 37.0 29.8 37.0 140-144 34.9283 37.0 37.0 37.0 27.4 37.0 145-149 34.7145 37.0 37.0 37.0 25.0 37.0 150 34.4495 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 4.0 24 2.0 25 10.0 26 12.0 27 21.0 28 27.0 29 31.0 30 46.0 31 61.0 32 103.0 33 150.0 34 184.0 35 357.0 36 2763.0 37 227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.04361995487591 10.37854098771622 9.175231887691151 46.40260716971672 2 20.175 11.825 34.75 33.25 3 20.025000000000002 12.35 22.2 45.425 4 27.474999999999998 18.45 18.475 35.6 5 27.700000000000003 22.825 22.45 27.025 6 29.049999999999997 27.450000000000003 23.025000000000002 20.474999999999998 7 21.25 23.549999999999997 35.4 19.8 8 22.975 21.9 30.375000000000004 24.75 9 23.825 21.5 30.725 23.95 10-14 24.837483748374837 25.192519251925194 25.377537753775375 24.59245924592459 15-19 24.69 24.01 24.9 26.400000000000002 20-24 24.765 24.825 24.54 25.869999999999997 25-29 24.98 23.724999999999998 24.654999999999998 26.640000000000004 30-34 23.97 24.044999999999998 24.68 27.305 35-39 25.019999999999996 23.665 24.215 27.1 40-44 25.255 23.71 24.169999999999998 26.865 45-49 24.915000000000003 23.095 24.545 27.445000000000004 50-54 25.14 22.965 24.945 26.950000000000003 55-59 24.605 23.73 23.845 27.82 60-64 25.430000000000003 23.435 24.245 26.889999999999997 65-69 24.875 23.35 24.645 27.13 70-74 24.945 23.990000000000002 23.665 27.400000000000002 75-79 25.814999999999998 23.415 23.380000000000003 27.389999999999997 80-84 26.150000000000002 23.605 22.98 27.265 85-89 26.040000000000003 23.369999999999997 24.3 26.290000000000003 90-94 26.009999999999998 23.69 23.880000000000003 26.419999999999998 95-99 26.305 23.815 23.25 26.63 100-104 26.5 24.05 22.405 27.045 105-109 27.200000000000003 23.87 23.27 25.66 110-114 26.245 24.169999999999998 23.200000000000003 26.384999999999998 115-119 26.87 23.585 23.555 25.990000000000002 120-124 26.93 24.645 22.055 26.369999999999997 125-129 27.87 24.654999999999998 21.495 25.979999999999997 130-134 27.639999999999997 24.665 21.565 26.13 135-139 28.355000000000004 24.195 21.865000000000002 25.585 140-144 27.98 23.91 22.005 26.105 145-149 28.599999999999998 24.834999999999997 21.12 25.445 150 29.099999999999998 24.2 21.375 25.324999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 1.0 11 1.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 1.5 27 2.0 28 2.5 29 4.0 30 6.5 31 7.0 32 9.5 33 13.5 34 19.5 35 28.0 36 40.5 37 49.0 38 60.5 39 81.0 40 86.5 41 113.5 42 137.0 43 141.0 44 155.0 45 151.5 46 148.0 47 144.5 48 136.0 49 144.0 50 150.0 51 141.5 52 131.0 53 123.5 54 119.5 55 124.0 56 120.5 57 111.0 58 104.5 59 101.5 60 101.0 61 89.5 62 82.0 63 81.5 64 73.5 65 69.5 66 73.0 67 70.0 68 66.5 69 64.0 70 55.0 71 42.5 72 39.0 73 37.5 74 28.0 75 25.5 76 26.0 77 17.5 78 10.5 79 8.5 80 5.0 81 4.5 82 6.0 83 3.0 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.875 #Duplication Level Percentage of deduplicated Percentage of total 1 86.63755458515284 74.4 2 10.975254730713246 18.85 3 1.9796215429403203 5.1 4 0.2911208151382824 1.0 5 0.0 0.0 6 0.058224163027656484 0.3 7 0.058224163027656484 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 7 0.17500000000000002 No Hit ATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATA 7 0.17500000000000002 No Hit CCCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTAT 6 0.15 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0125 0.0 0.0 0.0 20-21 0.025 0.025 0.0 0.0 0.0 22-23 0.025 0.025 0.0 0.0 0.0 24-25 0.05 0.025 0.0 0.0 0.0 26-27 0.05 0.025 0.0 0.0 0.0 28-29 0.0625 0.025 0.0 0.0 0.0 30-31 0.075 0.025 0.0 0.0 0.0 32-33 0.1 0.025 0.0 0.0 0.0 34-35 0.1 0.025 0.0 0.0 0.0 36-37 0.1 0.025 0.0 0.0 0.0 38-39 0.1125 0.025 0.0 0.0 0.0 40-41 0.1375 0.025 0.0 0.0 0.0 42-43 0.175 0.025 0.0 0.0 0.0 44-45 0.23750000000000002 0.025 0.0 0.0 0.0 46-47 0.325 0.025 0.0 0.0 0.0 48-49 0.4375 0.025 0.0 0.0 0.0 50-51 0.475 0.025 0.0 0.0 0.0 52-53 0.5 0.025 0.0 0.0 0.0 54-55 0.5 0.025 0.0 0.0 0.0 56-57 0.55 0.025 0.0 0.0 0.0 58-59 0.575 0.025 0.0 0.0 0.0 60-61 0.575 0.025 0.0 0.0 0.0 62-63 0.6 0.025 0.0 0.0 0.0 64-65 0.6375 0.025 0.0 0.0 0.0 66-67 0.675 0.025 0.0 0.0 0.0 68-69 0.7 0.025 0.0 0.0 0.0 70-71 0.8500000000000001 0.025 0.0 0.0 0.0 72-73 0.9624999999999999 0.025 0.0 0.0 0.0 74-75 1.0625 0.025 0.0 0.0 0.0 76-77 1.125 0.025 0.0 0.0 0.0 78-79 1.2375 0.025 0.0 0.0 0.0 80-81 1.4 0.025 0.0 0.0 0.0 82-83 1.6 0.025 0.0 0.0 0.0 84-85 1.7625000000000002 0.025 0.0 0.0 0.0 86-87 1.975 0.025 0.0 0.0 0.0 88-89 2.3 0.025 0.0 0.0 0.0 90-91 2.5875000000000004 0.025 0.0 0.0 0.0 92-93 2.95 0.025 0.0 0.0 0.0 94-95 3.225 0.025 0.0 0.0 0.0 96-97 3.425 0.025 0.0 0.0 0.0 98-99 3.675 0.025 0.0 0.0 0.0 100-101 4.1875 0.025 0.0 0.0 0.0 102-103 4.625 0.025 0.0 0.0 0.0 104-105 5.15 0.025 0.0 0.0 0.0 106-107 5.475 0.025 0.0 0.0 0.0 108-109 6.0375 0.025 0.0 0.0 0.0 110-111 6.800000000000001 0.025 0.0 0.0 0.0 112-113 7.35 0.025 0.0 0.0 0.0 114-115 8.125 0.025 0.0 0.0 0.0 116-117 9.125 0.025 0.0 0.0 0.0 118-119 10.25 0.025 0.0 0.0 0.0 120-121 11.175 0.025 0.0 0.0 0.0 122-123 12.162500000000001 0.025 0.0 0.0 0.0 124-125 13.25 0.025 0.0 0.0 0.0 126-127 14.350000000000001 0.025 0.0 0.0 0.0 128-129 15.6875 0.025 0.0 0.0 0.0 130-131 16.9125 0.025 0.0 0.0 0.0 132-133 18.15 0.025 0.0 0.0 0.0 134-135 19.525 0.025 0.0 0.0 0.0 136-137 20.924999999999997 0.025 0.0 0.0 0.0 138 21.95 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCGTTG 20 0.0061575063 28.7825 55-59 >>END_MODULE SRR26060478 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26060478_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.53025 37.0 37.0 37.0 37.0 37.0 2 35.9075 37.0 37.0 37.0 37.0 37.0 3 36.114 37.0 37.0 37.0 37.0 37.0 4 36.093 37.0 37.0 37.0 37.0 37.0 5 35.9735 37.0 37.0 37.0 37.0 37.0 6 36.0695 37.0 37.0 37.0 37.0 37.0 7 35.9615 37.0 37.0 37.0 37.0 37.0 8 35.959 37.0 37.0 37.0 37.0 37.0 9 36.156 37.0 37.0 37.0 37.0 37.0 10-14 36.0108 37.0 37.0 37.0 37.0 37.0 15-19 35.939099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.0009 37.0 37.0 37.0 37.0 37.0 25-29 35.9237 37.0 37.0 37.0 37.0 37.0 30-34 35.8769 37.0 37.0 37.0 37.0 37.0 35-39 35.8182 37.0 37.0 37.0 37.0 37.0 40-44 35.7855 37.0 37.0 37.0 37.0 37.0 45-49 35.7718 37.0 37.0 37.0 37.0 37.0 50-54 35.769600000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.7615 37.0 37.0 37.0 37.0 37.0 60-64 35.66415 37.0 37.0 37.0 37.0 37.0 65-69 35.6216 37.0 37.0 37.0 37.0 37.0 70-74 35.673950000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.59225 37.0 37.0 37.0 37.0 37.0 80-84 35.511399999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.39545 37.0 37.0 37.0 37.0 37.0 90-94 35.46085000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.42725 37.0 37.0 37.0 37.0 37.0 100-104 35.23425 37.0 37.0 37.0 32.2 37.0 105-109 35.3068 37.0 37.0 37.0 32.2 37.0 110-114 35.27505 37.0 37.0 37.0 32.2 37.0 115-119 35.35815 37.0 37.0 37.0 34.6 37.0 120-124 35.2346 37.0 37.0 37.0 32.2 37.0 125-129 35.10255 37.0 37.0 37.0 27.4 37.0 130-134 34.97255 37.0 37.0 37.0 27.4 37.0 135-139 34.90050000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.87305 37.0 37.0 37.0 25.0 37.0 145-149 34.735400000000006 37.0 37.0 37.0 25.0 37.0 150 34.64075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 1.0 18 1.0 19 2.0 20 1.0 21 5.0 22 9.0 23 8.0 24 12.0 25 10.0 26 8.0 27 31.0 28 35.0 29 30.0 30 37.0 31 49.0 32 82.0 33 130.0 34 273.0 35 775.0 36 2363.0 37 134.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.3330832708177 15.828957239309826 11.252813203300825 40.58514628657164 2 25.374999999999996 26.75 27.250000000000004 20.625 3 24.85 25.6 22.650000000000002 26.900000000000002 4 30.349999999999998 26.25 18.25 25.15 5 29.275000000000002 28.075 19.825 22.825 6 24.9 32.725 19.475 22.900000000000002 7 23.400000000000002 18.275 32.375 25.95 8 26.200000000000003 22.1 23.1 28.599999999999998 9 25.55 21.375 25.474999999999998 27.6 10-14 28.192819281928195 24.76247624762476 20.787078707870787 26.257625762576257 15-19 26.20048019207683 24.23469387755102 23.03421368547419 26.53061224489796 20-24 27.240896358543417 24.314725890356144 22.498999599839937 25.945378151260506 25-29 27.013103931179355 24.807442232669803 22.08662598779634 26.092827848354506 30-34 27.09083633453381 24.494797919167667 22.574029611844736 25.840336134453786 35-39 27.253626813406704 24.497248624312157 22.74137068534267 25.507753876938473 40-44 27.893946973486745 24.482241120560282 21.56578289144572 26.058029014507255 45-49 27.648824412206103 24.312156078039017 22.096048024012006 25.942971485742873 50-54 27.073536768384194 24.402201100550275 22.916458229114557 25.607803901950977 55-59 27.538769384692348 23.686843421710854 22.87143571785893 25.90295147573787 60-64 28.115463504927714 23.367852318775327 23.102706488568714 25.413977687728252 65-69 27.506503902341407 24.284570742445467 22.488493095857514 25.720432259355615 70-74 27.28500675371454 23.648006403521936 22.81254690079544 26.254439941968084 75-79 27.192675238905288 23.765447540901587 22.7998198829239 26.242057337269227 80-84 27.324126888822175 24.817372160512356 22.926048233763634 24.93245271690183 85-89 27.11533650237678 23.502626970227674 23.057292969727293 26.32474355766825 90-94 27.74080560420315 24.44333249937453 22.59194395796848 25.223917938453837 95-99 28.08606454841131 24.11808856642482 22.41180885664248 25.38403802852139 100-104 27.462850853054487 24.8411467453845 22.504628008205334 25.19137439335568 105-109 27.826696017610566 24.104462677606563 22.873724234540724 25.195117070242144 110-114 29.001751313485112 24.658493870402804 22.101576182136604 24.238178633975483 115-119 28.946710032524393 24.933700275206405 21.7813360020015 24.3382536902677 120-124 29.308446757405925 24.82485988791033 21.492193755004003 24.374499599679744 125-129 30.407805854390794 25.088816612459347 21.04578433825369 23.457593194896173 130-134 30.23267450587941 24.978734050537906 21.155866900175134 23.632724543407555 135-139 30.684547638110487 25.31024819855885 21.497197758206564 22.5080064051241 140-144 31.231546814792573 25.386578591803033 20.772656758244505 22.609217835159885 145-149 32.140712570056046 25.410328262610086 20.806645316253004 21.642313851080868 150 32.99974981235927 25.068801601200903 20.79059294470853 21.1408556417313 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.5 25 1.0 26 1.0 27 2.0 28 1.5 29 1.5 30 5.5 31 9.0 32 9.5 33 11.0 34 18.5 35 33.5 36 37.0 37 38.0 38 55.5 39 77.5 40 86.5 41 98.0 42 121.5 43 128.0 44 138.0 45 148.0 46 140.0 47 126.5 48 135.5 49 150.5 50 145.0 51 136.5 52 133.5 53 134.5 54 120.5 55 104.5 56 104.0 57 101.5 58 99.0 59 104.5 60 106.0 61 100.5 62 91.0 63 86.5 64 85.5 65 82.5 66 83.0 67 84.0 68 73.0 69 68.5 70 75.0 71 59.0 72 40.5 73 39.0 74 37.0 75 30.5 76 20.0 77 13.0 78 11.0 79 11.0 80 9.0 81 5.0 82 3.5 83 3.5 84 3.5 85 2.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 1.0 96 1.0 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.04 20-24 0.04 25-29 0.03 30-34 0.04 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.055 65-69 0.06 70-74 0.055 75-79 0.065 80-84 0.06999999999999999 85-89 0.075 90-94 0.075 95-99 0.075 100-104 0.065 105-109 0.06 110-114 0.075 115-119 0.075 120-124 0.08 125-129 0.075 130-134 0.075 135-139 0.08 140-144 0.08499999999999999 145-149 0.08 150 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.7 #Duplication Level Percentage of deduplicated Percentage of total 1 87.48558246828144 75.85 2 10.668973471741639 18.5 3 1.384083044982699 3.5999999999999996 4 0.25951557093425603 0.8999999999999999 5 0.11534025374855825 0.5 6 0.0 0.0 7 0.0 0.0 8 0.02883506343713956 0.2 9 0.05767012687427912 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 9 0.22499999999999998 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 9 0.22499999999999998 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 8 0.2 No Hit CTTTGGGCCGGGTCGGCCGGTCCGCCTCACGGCGAGCACCGACCTACTCG 5 0.125 No Hit CTTGGATTTATGAAAGACGAACAACTGCGAAAGCATTTGCCAAGGATGTT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit AACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.037500000000000006 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.0875 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.1375 0.0 0.0 0.0 0.0 40-41 0.16249999999999998 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2625 0.0 0.0 0.0 0.0 46-47 0.35 0.0 0.0 0.0 0.0 48-49 0.4625 0.0 0.0 0.0 0.0 50-51 0.5 0.0 0.0 0.0 0.0 52-53 0.525 0.0 0.0 0.0 0.0 54-55 0.525 0.0 0.0 0.0 0.0 56-57 0.575 0.0 0.0 0.0 0.0 58-59 0.6 0.0 0.0 0.0 0.0 60-61 0.6 0.0 0.0 0.0 0.0 62-63 0.65 0.0 0.0 0.0 0.0 64-65 0.6875 0.0 0.0 0.0 0.0 66-67 0.7375 0.0 0.0 0.0 0.0 68-69 0.8 0.0 0.0 0.0 0.0 70-71 0.95 0.0 0.0 0.0 0.0 72-73 1.0625 0.0 0.0 0.0 0.0 74-75 1.1625 0.0 0.0 0.0 0.0 76-77 1.225 0.0 0.0 0.0 0.0 78-79 1.3375 0.0 0.0 0.0 0.0 80-81 1.5 0.0 0.0 0.0 0.0 82-83 1.7000000000000002 0.0 0.0 0.0 0.0 84-85 1.8624999999999998 0.0 0.0 0.0 0.0 86-87 2.075 0.0 0.0 0.0 0.0 88-89 2.425 0.0 0.0 0.0 0.0 90-91 2.7125000000000004 0.0 0.0 0.0 0.0 92-93 3.0875 0.0 0.0 0.0 0.0 94-95 3.4 0.0 0.0 0.0 0.0 96-97 3.6125 0.0 0.0 0.0 0.0 98-99 3.875 0.0 0.0 0.0 0.0 100-101 4.387499999999999 0.0 0.0 0.0 0.0 102-103 4.875 0.0 0.0 0.0 0.0 104-105 5.4 0.0 0.0 0.0 0.0 106-107 5.725 0.0 0.0 0.0 0.0 108-109 6.2875 0.0 0.0 0.0 0.0 110-111 7.075 0.0 0.0 0.0 0.0 112-113 7.6625 0.0 0.0 0.0 0.0 114-115 8.4375 0.0 0.0 0.0 0.0 116-117 9.45 0.0 0.0 0.0 0.0 118-119 10.625 0.0 0.0 0.0 0.0 120-121 11.600000000000001 0.0 0.0 0.0 0.0 122-123 12.6 0.0 0.0 0.0 0.0 124-125 13.712499999999999 0.0 0.0 0.0 0.0 126-127 14.8125 0.0 0.0 0.0 0.0 128-129 16.1125 0.0 0.0 0.0 0.0 130-131 17.35 0.0 0.0 0.0 0.0 132-133 18.525 0.0 0.0 0.0 0.0 134-135 19.8625 0.0 0.0 0.0 0.0 136-137 21.2875 0.0 0.0 0.0 0.0 138 22.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064976 spots for SRR26060478.sra Written 1064976 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra Read 1064966 spots for SRR26060478.sra Written 1064966 spots for SRR26060478.sra SRR ids: ['SRR26060478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__puweysq SRR26060478.sra spots: 21299330 blocks: [[1, 1064966], [1064967, 2129932], [2129933, 3194898], [3194899, 4259864], [4259865, 5324830], [5324831, 6389796], [6389797, 7454762], [7454763, 8519728], [8519729, 9584694], [9584695, 10649660], [10649661, 11714626], [11714627, 12779592], [12779593, 13844558], [13844559, 14909524], [14909525, 15974490], [15974491, 17039456], [17039457, 18104422], [18104423, 19169388], [19169389, 20234354], [20234355, 21299330]] SRR26060478 file size 7840480 SRR26060478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26060478 SRR26060478_1.fastq SRR26060478_2.fastq Input file: SRR26060478_1.fastq Paired file: SRR26060478_2.fastq trimmed: SRR26060478-trimmed-pair1.fastq, SRR26060478-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:12:46 2024 >> started Thu Dec 12 02:13:11 2024 >> done (24.654s) 21299330 read pairs processed; of these: 664 ( 0.00%) short read pairs filtered out after trimming by size control 16776 ( 0.08%) empty read pairs filtered out after trimming by size control 21281890 (99.92%) read pairs available; of these: 6488087 (30.49%) trimmed read pairs available after processing 14793803 (69.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 525 0.00% 19 137 0.00% 20 433 0.00% 21 235 0.00% 22 244 0.00% 23 285 0.00% 24 397 0.00% 25 471 0.00% 26 599 0.00% 27 759 0.00% 28 890 0.00% 29 1113 0.01% 30 1044 0.00% 31 1271 0.01% 32 1575 0.01% 33 1492 0.01% 34 3132 0.01% 35 1550 0.01% 36 1639 0.01% 37 1766 0.01% 38 1958 0.01% 39 2046 0.01% 40 2036 0.01% 41 2290 0.01% 42 2437 0.01% 43 2534 0.01% 44 2637 0.01% 45 2700 0.01% 46 3015 0.01% 47 3157 0.01% 48 4270 0.02% 49 3231 0.02% 50 3303 0.02% 51 3506 0.02% 52 3889 0.02% 53 3970 0.02% 54 4156 0.02% 55 4576 0.02% 56 4356 0.02% 57 4685 0.02% 58 5002 0.02% 59 5036 0.02% 60 5357 0.03% 61 5481 0.03% 62 5781 0.03% 63 6244 0.03% 64 6418 0.03% 65 7128 0.03% 66 7273 0.03% 67 7659 0.04% 68 8090 0.04% 69 8079 0.04% 70 8725 0.04% 71 9343 0.04% 72 9807 0.05% 73 10376 0.05% 74 10412 0.05% 75 11096 0.05% 76 12127 0.06% 77 12779 0.06% 78 13291 0.06% 79 14376 0.07% 80 14984 0.07% 81 16094 0.08% 82 16909 0.08% 83 17454 0.08% 84 18998 0.09% 85 20505 0.10% 86 21576 0.10% 87 25449 0.12% 88 24846 0.12% 89 25798 0.12% 90 27472 0.13% 91 29210 0.14% 92 30994 0.15% 93 33496 0.16% 94 35053 0.16% 95 36445 0.17% 96 38332 0.18% 97 40790 0.19% 98 43307 0.20% 99 45223 0.21% 100 47669 0.22% 101 50276 0.24% 102 52321 0.25% 103 56513 0.27% 104 58898 0.28% 105 61270 0.29% 106 63928 0.30% 107 67365 0.32% 108 69616 0.33% 109 74750 0.35% 110 76817 0.36% 111 79502 0.37% 112 84711 0.40% 113 86858 0.41% 114 91359 0.43% 115 96335 0.45% 116 98076 0.46% 117 100244 0.47% 118 103413 0.49% 119 106576 0.50% 120 112653 0.53% 121 111950 0.53% 122 116635 0.55% 123 122808 0.58% 124 123843 0.58% 125 127080 0.60% 126 128081 0.60% 127 129337 0.61% 128 132500 0.62% 129 134907 0.63% 130 136089 0.64% 131 138698 0.65% 132 139064 0.65% 133 141729 0.67% 134 139978 0.66% 135 140345 0.66% 136 144503 0.68% 137 144692 0.68% 138 141789 0.67% 139 146888 0.69% 140 146466 0.69% 141 142787 0.67% 142 146237 0.69% 143 145834 0.69% 144 147047 0.69% 145 147109 0.69% 146 147214 0.69% 147 148567 0.70% 148 150061 0.71% 149 149575 0.70% 150 14793803 69.51% 21281890 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=35 prefix-density=0.55 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTT criterion=fanout-score sequence-density=0.23 sequence-density-rank=14 fanout-score=43.26 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=12.9 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCG criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=8 prefix-density=0.54 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=10.99 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=2.7 sequence=GCCGACCCTGAAGCCTTCGCCCGGAACAGGGCGCTGGAGGTGATCCAC SRR26060478 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:14:50 Started mapping on | Dec 12 02:14:50 Finished on | Dec 12 02:17:13 Mapping speed, Million of reads per hour | 535.77 Number of input reads | 21281890 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 17470428 Uniquely mapped reads % | 82.09% Average mapped length | 282.53 Number of splices: Total | 15648063 Number of splices: Annotated (sjdb) | 14824088 Number of splices: GT/AG | 15432079 Number of splices: GC/AG | 177925 Number of splices: AT/AC | 7813 Number of splices: Non-canonical | 30246 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1076774 % of reads mapped to multiple loci | 5.06% Number of reads mapped to too many loci | 376940 % of reads mapped to too many loci | 1.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 8.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2734837 2734837 2734837 N_multimapping 1076774 1076774 1076774 N_noFeature 650720 17032600 815878 N_ambiguous 355201 2039 86498 UnstrandedReadsAssigned:16464507 PositiveStrandReadsAssigned:435789 NegativeStrandReadsAssigned:16568052 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=134 echo kmer=129 SRR26060478 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR26060478-trimmed-pair1.fastq SRR26060478-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,281,890 reads, 17,355,526 reads pseudoaligned [quant] estimated average fragment length: 189.462 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52973 SRR26060478.ke.tsv 35125 SRR26060478.se.tsv 88098 total ==> SRR26060478.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 747.736 0 0 PNS24247 1044 855.538 16.6243 1.51341 PNS24249 1928 1739.54 187.235 8.38314 PNS24246 1044 855.538 16.6243 1.51341 PNS24248 1044 855.538 16.6243 1.51341 PNS24244 1471 1282.54 13.8922 0.843634 PNS24243 293 120.346 0 0 KQK14069 1603 1414.54 3402.77 187.358 KQK14071 474 287.249 201.525 54.6417 ==> SRR26060478.se.tsv <== BRADI_1g14170v3 3746 BRADI_1g53295v3 10 BRADI_1g59795v3 305 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 2074 BRADI_1g74790v3 97 BRADI_1g09890v3 7 BRADI_1g77505v3 284 BRADI_1g48960v3 0 SRR26060478 completed mapping pipeline successfully