Starting /dee2/code/volunteer_pipeline.sh SRR26060479 current disk space = 1548884250624 free memory = 1601807076 SRR26060479 SRAfilesize ce44c2d741d477681ac80563f728f76c SRR26060479.sra SRR26060479.sra file validated SRR26060479 is paired end SRR26060479 is conventional basespace SRR26060479 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26060479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0775 37.0 37.0 37.0 37.0 37.0 2 36.3175 37.0 37.0 37.0 37.0 37.0 3 36.4335 37.0 37.0 37.0 37.0 37.0 4 36.309 37.0 37.0 37.0 37.0 37.0 5 36.3985 37.0 37.0 37.0 37.0 37.0 6 36.379 37.0 37.0 37.0 37.0 37.0 7 36.387 37.0 37.0 37.0 37.0 37.0 8 36.424 37.0 37.0 37.0 37.0 37.0 9 36.337 37.0 37.0 37.0 37.0 37.0 10-14 36.371700000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3427 37.0 37.0 37.0 37.0 37.0 20-24 36.318200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.23440000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.1952 37.0 37.0 37.0 37.0 37.0 35-39 36.1783 37.0 37.0 37.0 37.0 37.0 40-44 36.2054 37.0 37.0 37.0 37.0 37.0 45-49 36.1124 37.0 37.0 37.0 37.0 37.0 50-54 36.0637 37.0 37.0 37.0 37.0 37.0 55-59 36.0437 37.0 37.0 37.0 37.0 37.0 60-64 36.0024 37.0 37.0 37.0 37.0 37.0 65-69 36.0021 37.0 37.0 37.0 37.0 37.0 70-74 36.0142 37.0 37.0 37.0 37.0 37.0 75-79 35.96379999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.890600000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.8581 37.0 37.0 37.0 37.0 37.0 90-94 35.71810000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.759699999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.6644 37.0 37.0 37.0 37.0 37.0 105-109 35.5237 37.0 37.0 37.0 37.0 37.0 110-114 35.5013 37.0 37.0 37.0 37.0 37.0 115-119 35.6146 37.0 37.0 37.0 37.0 37.0 120-124 35.5073 37.0 37.0 37.0 37.0 37.0 125-129 35.4953 37.0 37.0 37.0 37.0 37.0 130-134 35.311 37.0 37.0 37.0 37.0 37.0 135-139 35.2525 37.0 37.0 37.0 34.6 37.0 140-144 35.1481 37.0 37.0 37.0 29.8 37.0 145-149 34.92100000000001 37.0 37.0 37.0 25.0 37.0 150 34.965 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 3.0 22 3.0 23 3.0 24 2.0 25 11.0 26 13.0 27 18.0 28 29.0 29 46.0 30 38.0 31 61.0 32 69.0 33 122.0 34 202.0 35 375.0 36 2801.0 37 203.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.43358395989975 9.072681704260651 9.974937343358397 47.51879699248121 2 19.775000000000002 11.4 34.575 34.25 3 19.225 12.2 21.95 46.625 4 27.6 16.425 21.3 34.675 5 27.950000000000003 21.875 23.200000000000003 26.974999999999998 6 27.400000000000002 26.974999999999998 24.325 21.3 7 21.425 23.275000000000002 35.725 19.575 8 23.150000000000002 21.349999999999998 31.2 24.3 9 21.675 22.1 31.95 24.275 10-14 24.327432743274326 25.11751175117512 25.402540254025403 25.152515251525152 15-19 24.575 24.165 24.685000000000002 26.575 20-24 24.005000000000003 23.830000000000002 25.195 26.97 25-29 24.535 23.665 24.224999999999998 27.575 30-34 24.9 22.735 25.15 27.215 35-39 25.205 23.005 23.965 27.825 40-44 25.685000000000002 23.419999999999998 24.02 26.875 45-49 24.46 23.18 24.36 28.000000000000004 50-54 24.815 23.49 24.335 27.36 55-59 24.834999999999997 24.169999999999998 23.9 27.095000000000002 60-64 25.355 22.95 24.33 27.365000000000002 65-69 24.695 23.825 23.98 27.500000000000004 70-74 25.355 22.745 24.735 27.165 75-79 25.09 23.78 23.125 28.005000000000003 80-84 25.205 23.465 24.48 26.85 85-89 25.2 23.31 24.39 27.1 90-94 26.005 23.380000000000003 23.49 27.125 95-99 25.55 23.07 24.310000000000002 27.07 100-104 24.915000000000003 23.005 24.315 27.765 105-109 25.729999999999997 23.315 23.73 27.224999999999998 110-114 25.96 23.669999999999998 23.625 26.745 115-119 26.179999999999996 22.965 23.57 27.284999999999997 120-124 26.655 23.72 22.435 27.189999999999998 125-129 25.555 24.825 22.16 27.46 130-134 26.495 23.52 22.32 27.665 135-139 26.695 23.255 22.605 27.445000000000004 140-144 26.905 23.849999999999998 21.63 27.615000000000002 145-149 26.0 24.3 22.189999999999998 27.51 150 26.375 24.875 22.925 25.825 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 3.0 27 5.0 28 5.0 29 4.0 30 6.0 31 8.5 32 9.5 33 9.0 34 13.5 35 19.0 36 33.5 37 51.0 38 53.5 39 70.0 40 90.5 41 110.0 42 137.5 43 152.5 44 138.0 45 139.0 46 154.5 47 143.5 48 141.0 49 157.0 50 154.0 51 139.0 52 137.0 53 136.0 54 144.0 55 151.0 56 145.0 57 120.0 58 90.5 59 84.0 60 86.5 61 81.5 62 70.5 63 72.0 64 74.0 65 68.5 66 71.5 67 70.5 68 73.0 69 61.0 70 43.0 71 43.5 72 39.5 73 35.5 74 31.0 75 26.0 76 27.5 77 20.5 78 13.0 79 9.0 80 4.5 81 5.5 82 3.0 83 2.0 84 2.5 85 1.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.85 #Duplication Level Percentage of deduplicated Percentage of total 1 83.79601689800845 69.425 2 13.126131563065782 21.75 3 2.2631261315630655 5.625 4 0.6035003017501509 2.0 5 0.09052504526252263 0.375 6 0.030175015087507546 0.15 7 0.0 0.0 8 0.06035003017501509 0.4 9 0.0 0.0 >10 0.030175015087507546 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTAT 11 0.27499999999999997 No Hit GTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCT 8 0.2 No Hit GGCAGAAATTTGAATGATGCGTCGCCGGCACGAGGGCCGTGCGATCCGTC 8 0.2 No Hit CCTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAAT 6 0.15 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 5 0.125 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 5 0.125 No Hit CCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.05 14-15 0.0 0.0 0.0 0.0 0.05 16-17 0.0 0.0 0.0 0.0 0.05 18-19 0.0 0.0 0.0 0.0 0.05 20-21 0.0 0.0 0.0 0.0 0.05 22-23 0.0 0.0 0.0 0.0 0.05 24-25 0.0 0.0 0.0 0.0 0.05 26-27 0.0 0.0 0.0 0.0 0.05 28-29 0.0125 0.0 0.0 0.0 0.05 30-31 0.037500000000000006 0.0 0.0 0.0 0.05 32-33 0.05 0.0 0.0 0.0 0.05 34-35 0.1125 0.0 0.0 0.0 0.05 36-37 0.125 0.0 0.0 0.0 0.05 38-39 0.125 0.0 0.0 0.0 0.05 40-41 0.15 0.0 0.0 0.0 0.05 42-43 0.2 0.0 0.0 0.0 0.05 44-45 0.2 0.0 0.0 0.0 0.05 46-47 0.225 0.0 0.0 0.0 0.05 48-49 0.25 0.0 0.0 0.0 0.05 50-51 0.2625 0.0 0.0 0.0 0.05 52-53 0.3625 0.0 0.0 0.0 0.05 54-55 0.4125 0.0 0.0 0.0 0.05 56-57 0.475 0.0 0.0 0.0 0.05 58-59 0.5 0.0 0.0 0.0 0.05 60-61 0.525 0.0 0.0 0.0 0.05 62-63 0.55 0.0 0.0 0.0 0.05 64-65 0.625 0.0 0.0 0.0 0.05 66-67 0.6875 0.0 0.0 0.0 0.05 68-69 0.725 0.0 0.0 0.0 0.05 70-71 0.775 0.0 0.0 0.0 0.05 72-73 0.9 0.0 0.0 0.0 0.05 74-75 1.025 0.0 0.0 0.0 0.05 76-77 1.1875 0.0 0.0 0.0 0.05 78-79 1.2999999999999998 0.0 0.0 0.0 0.05 80-81 1.4375 0.0 0.0 0.0 0.05 82-83 1.5875 0.0 0.0 0.0 0.05 84-85 1.7 0.0 0.0 0.0 0.05 86-87 1.9375 0.0 0.0 0.0 0.05 88-89 2.2249999999999996 0.0 0.0 0.0 0.05 90-91 2.4000000000000004 0.0 0.0 0.0 0.05 92-93 2.55 0.0 0.0 0.0 0.05 94-95 2.7375 0.0 0.0 0.0 0.05 96-97 2.95 0.0 0.0 0.0 0.05 98-99 3.3125 0.0 0.0 0.0 0.05 100-101 3.675 0.0 0.0 0.0 0.05 102-103 4.05 0.0 0.0 0.0 0.05 104-105 4.4625 0.0 0.0 0.0 0.05 106-107 5.1875 0.0 0.0 0.0 0.05 108-109 5.725 0.0 0.0 0.0 0.05 110-111 6.324999999999999 0.0 0.0 0.0 0.05 112-113 7.3875 0.0 0.0 0.0 0.05 114-115 8.3 0.0 0.0 0.0 0.05 116-117 9.275 0.0 0.0 0.0 0.05 118-119 10.3125 0.0 0.0 0.0 0.05 120-121 11.0625 0.0 0.0 0.0 0.05 122-123 11.8875 0.0 0.0 0.0 0.05 124-125 13.075 0.0 0.0 0.0 0.05 126-127 14.3875 0.0 0.0 0.0 0.05 128-129 15.725 0.0 0.0 0.0 0.05 130-131 16.925 0.0 0.0 0.0 0.05 132-133 18.3375 0.0 0.0 0.0 0.05 134-135 19.5 0.0 0.0 0.0 0.05 136-137 20.8125 0.0 0.0 0.0 0.05 138 21.775 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGCC 10 0.006973645 144.0 7 >>END_MODULE SRR26060479 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26060479_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7155 37.0 37.0 37.0 37.0 37.0 2 36.136 37.0 37.0 37.0 37.0 37.0 3 36.0515 37.0 37.0 37.0 37.0 37.0 4 36.084 37.0 37.0 37.0 37.0 37.0 5 36.0305 37.0 37.0 37.0 37.0 37.0 6 36.1065 37.0 37.0 37.0 37.0 37.0 7 36.0645 37.0 37.0 37.0 37.0 37.0 8 35.929 37.0 37.0 37.0 37.0 37.0 9 36.129 37.0 37.0 37.0 37.0 37.0 10-14 36.04345 37.0 37.0 37.0 37.0 37.0 15-19 35.99145 37.0 37.0 37.0 37.0 37.0 20-24 36.0039 37.0 37.0 37.0 37.0 37.0 25-29 35.910900000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.912549999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.88334999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.758399999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.86024999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.77954999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.79 37.0 37.0 37.0 37.0 37.0 60-64 35.65930000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.67479999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.712900000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.65575 37.0 37.0 37.0 37.0 37.0 80-84 35.514849999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.50005 37.0 37.0 37.0 37.0 37.0 90-94 35.470150000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.509 37.0 37.0 37.0 37.0 37.0 100-104 35.32525 37.0 37.0 37.0 37.0 37.0 105-109 35.33075 37.0 37.0 37.0 37.0 37.0 110-114 35.368399999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.337900000000005 37.0 37.0 37.0 34.6 37.0 120-124 35.2408 37.0 37.0 37.0 32.2 37.0 125-129 35.112049999999996 37.0 37.0 37.0 27.4 37.0 130-134 35.01855 37.0 37.0 37.0 25.0 37.0 135-139 34.838499999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.8095 37.0 37.0 37.0 25.0 37.0 145-149 34.8089 37.0 37.0 37.0 25.0 37.0 150 34.7735 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 3.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 2.0 15 3.0 16 1.0 17 2.0 18 1.0 19 4.0 20 4.0 21 3.0 22 6.0 23 11.0 24 15.0 25 8.0 26 15.0 27 13.0 28 20.0 29 26.0 30 41.0 31 52.0 32 82.0 33 111.0 34 223.0 35 751.0 36 2437.0 37 161.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.225 15.024999999999999 13.900000000000002 38.85 2 26.174999999999997 26.025 26.700000000000003 21.099999999999998 3 23.325000000000003 26.25 24.4 26.025 4 28.9 27.775 17.75 25.575 5 29.825000000000003 27.450000000000003 19.975 22.75 6 26.575 34.525 18.05 20.849999999999998 7 23.175 19.900000000000002 31.424999999999997 25.5 8 27.175 21.85 21.625 29.349999999999998 9 24.95 21.85 26.85 26.35 10-14 28.144221633244985 24.46867030054508 20.9181377206581 26.468970345551835 15-19 27.370527895921942 24.448336252189144 22.682011508631476 25.499124343257446 20-24 27.096677341873498 24.75480384307446 22.758206565252202 25.39031224979984 25-29 27.908954477238616 24.062031015507753 22.10105052526263 25.927963981991 30-34 27.68076057042782 24.68851638729047 22.02151613710283 25.609206905178883 35-39 27.15851644226438 24.90615145903198 22.15326092397017 25.782071174733467 40-44 27.985784362799077 24.036440084092504 22.459705676243868 25.51806987686455 45-49 27.288653085740027 24.67590970519045 21.867961359427397 26.167475849642123 50-54 27.17353220881926 24.896140947995395 22.36848691125682 25.561839931928525 55-59 27.94073480828912 24.627089798778655 22.684953448793674 24.747221944138552 60-64 28.149409172841978 24.879831764470257 22.3963548968556 24.574404165832163 65-69 28.077115673510267 24.521782674011018 22.468703054581873 24.932398597896846 70-74 28.174444221910676 24.654516322851993 22.12096935709994 25.050070098137393 75-79 27.40021034707267 23.73416136625432 22.27174838483498 26.59387990183803 80-84 28.471978764962184 24.2249712024841 22.336855812089947 24.966194220463766 85-89 27.65115463607674 23.573611180684264 22.807193307619094 25.968040875619895 90-94 28.77110365212164 24.788337257652422 21.71233906116928 24.72822002905666 95-99 28.271543086172347 24.819639278557116 22.369739478957914 24.539078156312623 100-104 28.714507486604234 23.776854123892033 22.865441434223047 24.643196955280686 105-109 28.78962391707146 24.828484150433173 22.569983474385296 23.81190845811007 110-114 29.138276553106213 25.005010020040082 21.54809619238477 24.308617234468937 115-119 29.383767535070138 24.478957915831664 21.52805611222445 24.609218436873746 120-124 29.939879759519037 23.997995991983966 21.67835671342685 24.38376753507014 125-129 29.7249912337825 25.16154886540099 20.84356058708611 24.2698993137304 130-134 30.50643690828032 24.650603616690876 21.539848720132245 23.303110754896558 135-139 30.89178356713427 25.325651302605213 21.16733466933868 22.615230460921843 140-144 31.563126252505008 25.490981963927855 21.047094188376754 21.89879759519038 145-149 32.199398797595194 25.23547094188377 20.99699398797595 21.56813627254509 150 33.792585170340686 25.35070140280561 18.812625250501004 22.044088176352705 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.5 12 1.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 1.0 22 1.0 23 0.0 24 0.5 25 2.5 26 3.0 27 4.0 28 5.5 29 4.5 30 4.5 31 5.5 32 9.5 33 12.0 34 14.0 35 21.0 36 32.0 37 41.0 38 48.5 39 67.0 40 92.5 41 108.0 42 117.5 43 125.5 44 118.0 45 111.5 46 127.0 47 145.5 48 150.5 49 156.0 50 163.5 51 147.0 52 125.0 53 129.5 54 149.5 55 146.0 56 119.0 57 101.5 58 102.5 59 99.5 60 91.5 61 94.5 62 100.0 63 90.0 64 78.5 65 79.0 66 82.5 67 83.5 68 79.0 69 69.5 70 63.0 71 54.5 72 37.0 73 28.0 74 29.0 75 26.0 76 26.0 77 23.0 78 12.0 79 8.0 80 4.5 81 4.0 82 3.5 83 3.0 84 3.0 85 1.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 1.5 92 1.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.075 20-24 0.08 25-29 0.05 30-34 0.075 35-39 0.105 40-44 0.11 45-49 0.105 50-54 0.105 55-59 0.11 60-64 0.13999999999999999 65-69 0.15 70-74 0.13999999999999999 75-79 0.165 80-84 0.165 85-89 0.185 90-94 0.19499999999999998 95-99 0.2 100-104 0.155 105-109 0.155 110-114 0.2 115-119 0.2 120-124 0.2 125-129 0.185 130-134 0.185 135-139 0.2 140-144 0.2 145-149 0.2 150 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.5 #Duplication Level Percentage of deduplicated Percentage of total 1 85.17751479289942 71.975 2 12.692307692307692 21.45 3 1.5088757396449703 3.8249999999999997 4 0.35502958579881655 1.2 5 0.17751479289940827 0.75 6 0.0 0.0 7 0.02958579881656805 0.17500000000000002 8 0.02958579881656805 0.2 9 0.0 0.0 >10 0.02958579881656805 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 17 0.42500000000000004 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 8 0.2 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 7 0.17500000000000002 No Hit GGCCCGGGTAATCTTGGGAAATTTCATCGTGATGGGGATAGATCATTGCA 5 0.125 No Hit AAACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTT 5 0.125 No Hit CACGGCCCTCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAACT 5 0.125 No Hit TCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGCGCATTT 5 0.125 No Hit GTTCTGGGCCGCACGCGCGCTACACTGATGTATTCAACGAGTATATAGCC 5 0.125 No Hit TTTTCATTAATCAAGAACGAAAGTTGGGGGCTCGAAGACGATCAGATACC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.037500000000000006 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.1125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.2375 0.0 0.0 0.0 0.0 52-53 0.3375 0.0 0.0 0.0 0.0 54-55 0.3875 0.0 0.0 0.0 0.0 56-57 0.44999999999999996 0.0 0.0 0.0 0.0 58-59 0.475 0.0 0.0 0.0 0.0 60-61 0.5 0.0 0.0 0.0 0.0 62-63 0.525 0.0 0.0 0.0 0.0 64-65 0.6 0.0 0.0 0.0 0.0 66-67 0.6625000000000001 0.0 0.0 0.0 0.0 68-69 0.7 0.0 0.0 0.0 0.0 70-71 0.75 0.0 0.0 0.0 0.0 72-73 0.875 0.0 0.0 0.0 0.0 74-75 0.9874999999999999 0.0 0.0 0.0 0.0 76-77 1.1375000000000002 0.0 0.0 0.0 0.0 78-79 1.25 0.0 0.0 0.0 0.0 80-81 1.4 0.0 0.0 0.0 0.0 82-83 1.5375 0.0 0.0 0.0 0.0 84-85 1.6625 0.0 0.0 0.0 0.0 86-87 1.9125 0.0 0.0 0.0 0.0 88-89 2.2 0.0 0.0 0.0 0.0 90-91 2.375 0.0 0.0 0.0 0.0 92-93 2.5250000000000004 0.0 0.0 0.0 0.0 94-95 2.7125 0.0 0.0 0.0 0.0 96-97 2.925 0.0 0.0 0.0 0.0 98-99 3.3125 0.0 0.0 0.0 0.0 100-101 3.675 0.0 0.0 0.0 0.0 102-103 4.0875 0.0 0.0 0.0 0.0 104-105 4.5125 0.0 0.0 0.0 0.0 106-107 5.25 0.0 0.0 0.0 0.0 108-109 5.8125 0.0 0.0 0.0 0.0 110-111 6.425000000000001 0.0 0.0 0.0 0.0 112-113 7.4875 0.0 0.0 0.0 0.0 114-115 8.4 0.0 0.0 0.0 0.0 116-117 9.375 0.0 0.0 0.0 0.0 118-119 10.45 0.0 0.0 0.0 0.0 120-121 11.2375 0.0 0.0 0.0 0.0 122-123 12.05 0.0 0.0 0.0 0.0 124-125 13.275 0.0 0.0 0.0 0.0 126-127 14.5875 0.0 0.0 0.0 0.0 128-129 15.925 0.0 0.0 0.0 0.0 130-131 17.1875 0.0 0.0 0.0 0.0 132-133 18.7125 0.0 0.0 0.0 0.0 134-135 19.862499999999997 0.0 0.0 0.0 0.0 136-137 21.15 0.0 0.0 0.0 0.0 138 22.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGAC 10 0.006973645 144.0 1 >>END_MODULE Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138715 spots for SRR26060479.sra Written 1138715 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra Read 1138705 spots for SRR26060479.sra Written 1138705 spots for SRR26060479.sra SRR ids: ['SRR26060479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hpm_oxi_ SRR26060479.sra spots: 22774110 blocks: [[1, 1138705], [1138706, 2277410], [2277411, 3416115], [3416116, 4554820], [4554821, 5693525], [5693526, 6832230], [6832231, 7970935], [7970936, 9109640], [9109641, 10248345], [10248346, 11387050], [11387051, 12525755], [12525756, 13664460], [13664461, 14803165], [14803166, 15941870], [15941871, 17080575], [17080576, 18219280], [18219281, 19357985], [19357986, 20496690], [20496691, 21635395], [21635396, 22774110]] SRR26060479 file size 8384112 SRR26060479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26060479 SRR26060479_1.fastq SRR26060479_2.fastq Input file: SRR26060479_1.fastq Paired file: SRR26060479_2.fastq trimmed: SRR26060479-trimmed-pair1.fastq, SRR26060479-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:51:44 2024 >> started Fri Dec 6 21:52:09 2024 >> done (25.076s) 22774110 read pairs processed; of these: 672 ( 0.00%) short read pairs filtered out after trimming by size control 11143 ( 0.05%) empty read pairs filtered out after trimming by size control 22762295 (99.95%) read pairs available; of these: 7213633 (31.69%) trimmed read pairs available after processing 15548662 (68.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 535 0.00% 19 133 0.00% 20 406 0.00% 21 228 0.00% 22 318 0.00% 23 344 0.00% 24 416 0.00% 25 582 0.00% 26 653 0.00% 27 756 0.00% 28 969 0.00% 29 1211 0.01% 30 1256 0.01% 31 1340 0.01% 32 1706 0.01% 33 1662 0.01% 34 3440 0.02% 35 1756 0.01% 36 1852 0.01% 37 2032 0.01% 38 2080 0.01% 39 2199 0.01% 40 2392 0.01% 41 2493 0.01% 42 2717 0.01% 43 2871 0.01% 44 2832 0.01% 45 3014 0.01% 46 3180 0.01% 47 3319 0.01% 48 4398 0.02% 49 3502 0.02% 50 3685 0.02% 51 3864 0.02% 52 4207 0.02% 53 4243 0.02% 54 4553 0.02% 55 4875 0.02% 56 4988 0.02% 57 5231 0.02% 58 5556 0.02% 59 5703 0.03% 60 5668 0.02% 61 6107 0.03% 62 6657 0.03% 63 7016 0.03% 64 7261 0.03% 65 7947 0.03% 66 8062 0.04% 67 8724 0.04% 68 8932 0.04% 69 8907 0.04% 70 9489 0.04% 71 10313 0.05% 72 11240 0.05% 73 11420 0.05% 74 11693 0.05% 75 12657 0.06% 76 13220 0.06% 77 14389 0.06% 78 14841 0.07% 79 16279 0.07% 80 16971 0.07% 81 18218 0.08% 82 19139 0.08% 83 19791 0.09% 84 21054 0.09% 85 22776 0.10% 86 24473 0.11% 87 28325 0.12% 88 27517 0.12% 89 29103 0.13% 90 30513 0.13% 91 32938 0.14% 92 34646 0.15% 93 37279 0.16% 94 38893 0.17% 95 40502 0.18% 96 42431 0.19% 97 45376 0.20% 98 48208 0.21% 99 49743 0.22% 100 52834 0.23% 101 56180 0.25% 102 57780 0.25% 103 62371 0.27% 104 64854 0.28% 105 68685 0.30% 106 70726 0.31% 107 74540 0.33% 108 76950 0.34% 109 82832 0.36% 110 84635 0.37% 111 87722 0.39% 112 92825 0.41% 113 95655 0.42% 114 102639 0.45% 115 106961 0.47% 116 108981 0.48% 117 110379 0.48% 118 113523 0.50% 119 117565 0.52% 120 124649 0.55% 121 124838 0.55% 122 130034 0.57% 123 137693 0.60% 124 137898 0.61% 125 141865 0.62% 126 142163 0.62% 127 144268 0.63% 128 146432 0.64% 129 150456 0.66% 130 151365 0.66% 131 155272 0.68% 132 157185 0.69% 133 156953 0.69% 134 155071 0.68% 135 156726 0.69% 136 161461 0.71% 137 161354 0.71% 138 157711 0.69% 139 163711 0.72% 140 162528 0.71% 141 159014 0.70% 142 162159 0.71% 143 162026 0.71% 144 164182 0.72% 145 163209 0.72% 146 162900 0.72% 147 165785 0.73% 148 167243 0.73% 149 166630 0.73% 150 15548662 68.31% 22762295 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.54 prefix-fanout=2.0 sequence=CCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTATGAGAGGGTCTCGAACTTCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=34 fanout-score=30.18 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=1.1 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTCCGCTTATTTATATGCTTAAACTCAGCGGGTAGTCCCGCCTGACCTG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=10 prefix-density=0.52 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=79.55 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=2.1 sequence=CCGCTCCAACACTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGCGGCGACCATGGCGCTCTCCTCCCCCGCGATGGCCGGCACCCCGGTGAAGGTCTCCAGGGCCACCCCCTTCGGCGAGGGCCGCATCACCATGCGCAAGAC SRR26060479 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:53:05 Started mapping on | Dec 06 21:53:05 Finished on | Dec 06 21:55:25 Mapping speed, Million of reads per hour | 585.32 Number of input reads | 22762295 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 17665598 Uniquely mapped reads % | 77.61% Average mapped length | 282.17 Number of splices: Total | 15485819 Number of splices: Annotated (sjdb) | 14669572 Number of splices: GT/AG | 15273541 Number of splices: GC/AG | 174512 Number of splices: AT/AC | 7313 Number of splices: Non-canonical | 30453 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1481474 % of reads mapped to multiple loci | 6.51% Number of reads mapped to too many loci | 541030 % of reads mapped to too many loci | 2.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 11.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3615381 3615381 3615381 N_multimapping 1481474 1481474 1481474 N_noFeature 844481 17225769 1007679 N_ambiguous 365950 2049 94529 UnstrandedReadsAssigned:16455167 PositiveStrandReadsAssigned:437780 NegativeStrandReadsAssigned:16563390 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=133 echo kmer=129 SRR26060479 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR26060479-trimmed-pair1.fastq SRR26060479-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,762,295 reads, 17,408,605 reads pseudoaligned [quant] estimated average fragment length: 186.516 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52973 SRR26060479.ke.tsv 35125 SRR26060479.se.tsv 88098 total ==> SRR26060479.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 750.652 0 0 PNS24247 1044 858.484 22.5764 1.99766 PNS24249 1928 1742.48 217.245 9.47061 PNS24246 1044 858.484 22.5764 1.99766 PNS24248 1044 858.484 22.5764 1.99766 PNS24244 1471 1285.48 24.0261 1.41976 PNS24243 293 121.088 0 0 KQK14069 1603 1417.48 3869.72 207.376 KQK14071 474 289.945 208.147 54.5321 ==> SRR26060479.se.tsv <== BRADI_1g14170v3 4214 BRADI_1g53295v3 17 BRADI_1g59795v3 340 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 1917 BRADI_1g74790v3 96 BRADI_1g09890v3 5 BRADI_1g77505v3 299 BRADI_1g48960v3 0 SRR26060479 completed mapping pipeline successfully