Starting /dee2/code/volunteer_pipeline.sh SRR26060480 current disk space = 1548880838656 free memory = 1394995632 SRR26060480 SRAfilesize b948875dd6569026538a7b48fb57a1bb SRR26060480.sra SRR26060480.sra file validated SRR26060480 is paired end SRR26060480 is conventional basespace SRR26060480 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26060480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18075 37.0 37.0 37.0 37.0 37.0 2 36.2085 37.0 37.0 37.0 37.0 37.0 3 36.372 37.0 37.0 37.0 37.0 37.0 4 36.4465 37.0 37.0 37.0 37.0 37.0 5 36.426 37.0 37.0 37.0 37.0 37.0 6 36.357 37.0 37.0 37.0 37.0 37.0 7 36.314 37.0 37.0 37.0 37.0 37.0 8 36.3565 37.0 37.0 37.0 37.0 37.0 9 36.438 37.0 37.0 37.0 37.0 37.0 10-14 36.332800000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.3538 37.0 37.0 37.0 37.0 37.0 20-24 36.2608 37.0 37.0 37.0 37.0 37.0 25-29 36.2685 37.0 37.0 37.0 37.0 37.0 30-34 36.1802 37.0 37.0 37.0 37.0 37.0 35-39 36.1746 37.0 37.0 37.0 37.0 37.0 40-44 36.1738 37.0 37.0 37.0 37.0 37.0 45-49 36.1222 37.0 37.0 37.0 37.0 37.0 50-54 36.0654 37.0 37.0 37.0 37.0 37.0 55-59 36.015299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0218 37.0 37.0 37.0 37.0 37.0 65-69 35.99550000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.8968 37.0 37.0 37.0 37.0 37.0 75-79 35.930299999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.9008 37.0 37.0 37.0 37.0 37.0 85-89 35.9602 37.0 37.0 37.0 37.0 37.0 90-94 35.7415 37.0 37.0 37.0 37.0 37.0 95-99 35.744899999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.680099999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.560199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.477000000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.505100000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.55030000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.4039 37.0 37.0 37.0 34.6 37.0 130-134 35.1862 37.0 37.0 37.0 29.8 37.0 135-139 35.0955 37.0 37.0 37.0 27.4 37.0 140-144 35.0253 37.0 37.0 37.0 27.4 37.0 145-149 34.7576 37.0 37.0 37.0 25.0 37.0 150 34.66 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 9.0 25 4.0 26 12.0 27 24.0 28 32.0 29 31.0 30 54.0 31 60.0 32 87.0 33 144.0 34 199.0 35 369.0 36 2760.0 37 210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.34444722988218 9.100025068939583 9.175231887691151 47.38029581348709 2 20.4 10.2 35.949999999999996 33.45 3 19.675 11.65 21.75 46.925 4 28.4 16.525000000000002 18.925 36.15 5 29.025000000000002 21.775 23.325000000000003 25.874999999999996 6 28.625 25.874999999999996 24.15 21.349999999999998 7 22.875 21.425 35.575 20.125 8 22.525000000000002 22.650000000000002 30.925000000000004 23.9 9 21.4 21.175 33.925 23.5 10-14 24.265 24.555 25.115 26.064999999999998 15-19 24.845 22.945 24.555 27.655 20-24 24.565 23.285 25.055 27.095000000000002 25-29 25.46 22.935 24.08 27.525 30-34 25.009999999999998 22.830000000000002 24.0 28.16 35-39 25.264999999999997 22.63 24.275 27.83 40-44 25.195 23.150000000000002 24.04 27.615000000000002 45-49 24.98 23.215 23.91 27.894999999999996 50-54 25.485000000000003 22.919999999999998 24.21 27.384999999999998 55-59 25.14 23.555 24.01 27.295 60-64 25.56 22.16 24.39 27.889999999999997 65-69 24.87 23.22 24.355 27.555000000000003 70-74 25.974999999999998 22.955000000000002 23.474999999999998 27.595 75-79 25.885 23.3 23.345 27.47 80-84 26.205000000000002 23.105 23.385 27.305 85-89 25.85 22.41 23.294999999999998 28.444999999999997 90-94 26.545 22.61 23.400000000000002 27.445000000000004 95-99 25.724999999999998 22.655 24.33 27.29 100-104 26.224999999999998 23.29 23.119999999999997 27.365000000000002 105-109 26.465 22.650000000000002 22.97 27.915 110-114 26.11 23.294999999999998 23.315 27.279999999999998 115-119 26.665 22.495 23.225 27.615000000000002 120-124 26.99 23.89 22.02 27.1 125-129 25.755 24.665 22.24 27.339999999999996 130-134 26.595000000000002 23.265 22.505 27.634999999999998 135-139 27.425 23.849999999999998 21.595 27.13 140-144 27.105 24.68 21.575 26.640000000000004 145-149 26.950000000000003 25.25 20.8 27.0 150 27.0 24.575 21.224999999999998 27.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 1.5 26 3.0 27 2.5 28 2.0 29 3.0 30 6.5 31 8.0 32 8.5 33 11.0 34 14.5 35 25.0 36 35.0 37 44.0 38 53.0 39 63.5 40 84.0 41 102.5 42 109.0 43 120.5 44 137.5 45 144.0 46 146.5 47 150.5 48 157.5 49 166.0 50 150.0 51 131.5 52 125.5 53 122.5 54 126.5 55 125.5 56 121.5 57 110.5 58 100.5 59 106.0 60 101.5 61 87.5 62 79.5 63 71.5 64 71.0 65 84.0 66 83.5 67 69.0 68 59.0 69 57.0 70 68.0 71 66.0 72 54.0 73 46.0 74 38.5 75 33.0 76 28.0 77 22.0 78 14.5 79 10.5 80 11.0 81 8.0 82 4.0 83 3.5 84 1.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.32704773129052 72.39999999999999 2 12.610489098408955 21.4 3 1.4142604596346495 3.5999999999999996 4 0.44195639363582795 1.5 5 0.0883912787271656 0.375 6 0.02946375957572186 0.15 7 0.02946375957572186 0.17500000000000002 8 0.05892751915144372 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATAGGACCGG 8 0.2 No Hit CCCATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCT 8 0.2 No Hit CTCGTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATT 7 0.17500000000000002 No Hit CCCGACTGTCCCTATTAATCATTACTCCGATCCCGAAGGCCAACACAATA 6 0.15 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 5 0.125 No Hit GCGGTGTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGC 5 0.125 No Hit GTTCGTTAACGGAATTAACCAGACAAATCGCTCCACCAACTAAGAACGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.325 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.475 0.0 0.0 0.0 0.0 60-61 0.5125 0.0 0.0 0.0 0.0 62-63 0.65 0.0 0.0 0.0 0.0 64-65 0.7 0.0 0.0 0.0 0.0 66-67 0.7375 0.0 0.0 0.0 0.0 68-69 0.7875000000000001 0.0 0.0 0.0 0.0 70-71 0.9125 0.0 0.0 0.0 0.0 72-73 0.975 0.0 0.0 0.0 0.0 74-75 1.025 0.0 0.0 0.0 0.0 76-77 1.0875 0.0 0.0 0.0 0.0 78-79 1.1625 0.0 0.0 0.0 0.0 80-81 1.2875 0.0 0.0 0.0 0.0 82-83 1.3 0.0 0.0 0.0 0.0 84-85 1.4375 0.0 0.0 0.0 0.0 86-87 1.6875 0.0 0.0 0.0 0.0 88-89 2.05 0.0 0.0 0.0 0.0 90-91 2.325 0.0 0.0 0.0 0.0 92-93 2.775 0.0 0.0 0.0 0.0 94-95 3.0625 0.0 0.0 0.0 0.0 96-97 3.325 0.0 0.0 0.0 0.0 98-99 3.65 0.0 0.0 0.0 0.0 100-101 4.0875 0.0 0.0 0.0 0.0 102-103 4.5 0.0 0.0 0.0 0.0 104-105 4.875 0.0 0.0 0.0 0.0 106-107 5.5125 0.0 0.0 0.0 0.0 108-109 6.225 0.0 0.0 0.0 0.0 110-111 6.9 0.0 0.0 0.0 0.0 112-113 7.675000000000001 0.0 0.0 0.0 0.0 114-115 8.4375 0.0 0.0 0.0 0.0 116-117 9.05 0.0 0.0 0.0 0.0 118-119 9.65 0.0 0.0 0.0 0.0 120-121 10.412500000000001 0.0 0.0 0.0 0.0 122-123 11.275 0.0 0.0 0.0 0.0 124-125 12.225000000000001 0.0 0.0 0.0 0.0 126-127 13.6125 0.0 0.0 0.0 0.0 128-129 14.7875 0.0 0.0 0.0 0.0 130-131 15.9375 0.0 0.0 0.0 0.0 132-133 17.15 0.0 0.0 0.0 0.0 134-135 18.75 0.0 0.0 0.0 0.0 136-137 20.2875 0.0 0.0 0.0 0.0 138 21.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTGT 10 0.006973645 144.0 1 >>END_MODULE SRR26060480 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR26060480_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.182 37.0 37.0 37.0 25.0 37.0 2 35.7805 37.0 37.0 37.0 37.0 37.0 3 35.8985 37.0 37.0 37.0 37.0 37.0 4 35.8555 37.0 37.0 37.0 37.0 37.0 5 35.7685 37.0 37.0 37.0 37.0 37.0 6 36.032 37.0 37.0 37.0 37.0 37.0 7 35.913 37.0 37.0 37.0 37.0 37.0 8 35.753 37.0 37.0 37.0 37.0 37.0 9 35.978 37.0 37.0 37.0 37.0 37.0 10-14 35.839 37.0 37.0 37.0 37.0 37.0 15-19 35.8516 37.0 37.0 37.0 37.0 37.0 20-24 35.8186 37.0 37.0 37.0 37.0 37.0 25-29 35.818799999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.75855 37.0 37.0 37.0 37.0 37.0 35-39 35.6877 37.0 37.0 37.0 37.0 37.0 40-44 35.6287 37.0 37.0 37.0 37.0 37.0 45-49 35.6364 37.0 37.0 37.0 37.0 37.0 50-54 35.6632 37.0 37.0 37.0 37.0 37.0 55-59 35.662400000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.5147 37.0 37.0 37.0 37.0 37.0 65-69 35.4228 37.0 37.0 37.0 37.0 37.0 70-74 35.5383 37.0 37.0 37.0 37.0 37.0 75-79 35.3962 37.0 37.0 37.0 37.0 37.0 80-84 35.294200000000004 37.0 37.0 37.0 34.6 37.0 85-89 35.2756 37.0 37.0 37.0 34.6 37.0 90-94 35.296 37.0 37.0 37.0 32.2 37.0 95-99 35.3331 37.0 37.0 37.0 34.6 37.0 100-104 35.1086 37.0 37.0 37.0 25.0 37.0 105-109 35.102999999999994 37.0 37.0 37.0 25.0 37.0 110-114 35.11409999999999 37.0 37.0 37.0 29.8 37.0 115-119 35.138099999999994 37.0 37.0 37.0 27.4 37.0 120-124 34.98010000000001 37.0 37.0 37.0 27.4 37.0 125-129 34.9294 37.0 37.0 37.0 25.0 37.0 130-134 34.764300000000006 37.0 37.0 37.0 25.0 37.0 135-139 34.5829 37.0 37.0 37.0 25.0 37.0 140-144 34.5841 37.0 37.0 37.0 25.0 37.0 145-149 34.5471 37.0 37.0 37.0 25.0 37.0 150 34.4025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 3.0 16 6.0 17 1.0 18 3.0 19 1.0 20 1.0 21 5.0 22 11.0 23 10.0 24 6.0 25 14.0 26 20.0 27 25.0 28 33.0 29 28.0 30 39.0 31 64.0 32 93.0 33 139.0 34 313.0 35 875.0 36 2183.0 37 121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.025 14.649999999999999 11.65 41.675000000000004 2 27.075 25.974999999999998 25.650000000000002 21.3 3 23.599999999999998 26.6 21.475 28.325 4 28.15 28.15 17.224999999999998 26.474999999999998 5 29.325000000000003 28.225 20.974999999999998 21.475 6 25.575 32.75 19.225 22.45 7 24.675 19.425 30.7 25.2 8 26.25 22.3 23.150000000000002 28.299999999999997 9 26.3 21.825 24.925 26.950000000000003 10-14 27.555000000000003 24.365000000000002 21.065 27.015 15-19 27.243172951885562 24.56737021106332 22.54176252875863 25.64769430829249 20-24 27.536014405762305 25.135054021608642 21.48859543817527 25.840336134453786 25-29 28.235647129425885 24.3498699739948 21.614322864572916 25.800160032006403 30-34 27.094483069074176 23.73330665733007 22.732956534787174 26.43925373880858 35-39 27.256353812287372 24.8449069441665 21.968180908545126 25.930558335001002 40-44 27.92675605363218 24.23954372623574 21.60296177706624 26.23073844306584 45-49 26.848424212106053 24.647323661830917 21.785892946473236 26.718359179589797 50-54 28.492095257154293 23.659195517310387 21.943165899539725 25.905543325995595 55-59 28.051831098659196 23.579147488493096 22.338403041825096 26.030618371022612 60-64 27.810029026123512 23.130817735962367 22.865579021119007 26.193574216795117 65-69 28.54283426741393 24.044235388310646 21.732385908726982 25.68054443554844 70-74 28.615754178760884 24.326894204784306 21.54939445500951 25.5079571614453 75-79 28.210389350415372 23.320988890001 22.109898909018117 26.358722850565506 80-84 28.050245220698628 23.821439295365828 22.260034030627565 25.86828145330798 85-89 28.66866866866867 23.753753753753752 22.007007007007008 25.570570570570574 90-94 28.52852852852853 24.03903903903904 22.017017017017018 25.415415415415417 95-99 29.354354354354356 23.973973973973976 21.386386386386384 25.285285285285287 100-104 28.880992893604247 23.38604744269843 21.944750275247724 25.788209388449605 105-109 28.580722650385347 24.31188069262336 22.079871884696225 25.027524772295067 110-114 29.27927927927928 24.664664664664667 21.55155155155155 24.504504504504503 115-119 29.469469469469466 24.82982982982983 21.066066066066067 24.634634634634633 120-124 29.51951951951952 24.734734734734733 21.02102102102102 24.724724724724727 125-129 31.046046046046044 25.075075075075077 20.0 23.87887887887888 130-134 31.301301301301297 25.01001001001001 20.135135135135133 23.553553553553552 135-139 31.46146146146146 25.305305305305303 20.455455455455454 22.77777777777778 140-144 32.13213213213213 25.105105105105107 20.605605605605607 22.157157157157155 145-149 32.32232232232232 25.04004004004004 20.445445445445447 22.19219219219219 150 31.431431431431434 25.95095095095095 20.67067067067067 21.946946946946948 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 1.5 25 2.0 26 3.5 27 3.0 28 1.5 29 2.0 30 5.5 31 9.5 32 12.0 33 11.0 34 15.0 35 23.0 36 35.0 37 49.0 38 56.0 39 68.5 40 81.5 41 89.0 42 103.0 43 110.0 44 119.5 45 124.5 46 129.0 47 128.5 48 124.0 49 145.5 50 145.0 51 131.0 52 123.0 53 123.0 54 124.0 55 129.0 56 135.0 57 114.0 58 101.0 59 102.5 60 105.5 61 111.5 62 102.5 63 89.5 64 90.0 65 80.5 66 73.0 67 88.5 68 84.5 69 76.0 70 76.0 71 63.5 72 53.5 73 44.0 74 35.5 75 28.5 76 23.0 77 19.5 78 16.0 79 10.5 80 8.0 81 7.0 82 4.5 83 2.0 84 1.0 85 1.0 86 1.5 87 1.5 88 1.5 89 1.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.03 20-24 0.04 25-29 0.02 30-34 0.034999999999999996 35-39 0.06 40-44 0.06 45-49 0.05 50-54 0.06 55-59 0.06 60-64 0.09 65-69 0.08 70-74 0.09 75-79 0.09 80-84 0.09 85-89 0.1 90-94 0.1 95-99 0.1 100-104 0.09 105-109 0.09 110-114 0.1 115-119 0.1 120-124 0.1 125-129 0.1 130-134 0.1 135-139 0.1 140-144 0.1 145-149 0.1 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.2 #Duplication Level Percentage of deduplicated Percentage of total 1 86.62993039443155 74.675 2 11.36890951276102 19.6 3 1.6531322505800465 4.275 4 0.23201856148491878 0.8 5 0.058004640371229696 0.25 6 0.0 0.0 7 0.029002320185614848 0.17500000000000002 8 0.0 0.0 9 0.029002320185614848 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 7 0.17500000000000002 No Hit AACTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTC 5 0.125 No Hit CTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.0625 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.25 0.0 0.0 0.0 0.0 48-49 0.25 0.0 0.0 0.0 0.0 50-51 0.25 0.0 0.0 0.0 0.0 52-53 0.25 0.0 0.0 0.0 0.0 54-55 0.325 0.0 0.0 0.0 0.0 56-57 0.375 0.0 0.0 0.0 0.0 58-59 0.5 0.0 0.0 0.0 0.0 60-61 0.5375000000000001 0.0 0.0 0.0 0.0 62-63 0.675 0.0 0.0 0.0 0.0 64-65 0.725 0.0 0.0 0.0 0.0 66-67 0.7625 0.0 0.0 0.0 0.0 68-69 0.8125 0.0 0.0 0.0 0.0 70-71 0.9375 0.0 0.0 0.0 0.0 72-73 1.025 0.0 0.0 0.0 0.0 74-75 1.075 0.0 0.0 0.0 0.0 76-77 1.1875 0.0 0.0 0.0 0.0 78-79 1.2625000000000002 0.0 0.0 0.0 0.0 80-81 1.3875 0.0 0.0 0.0 0.0 82-83 1.4 0.0 0.0 0.0 0.0 84-85 1.5375 0.0 0.0 0.0 0.0 86-87 1.7875 0.0 0.0 0.0 0.0 88-89 2.15 0.0 0.0 0.0 0.0 90-91 2.425 0.0 0.0 0.0 0.0 92-93 2.8625 0.0 0.0 0.0 0.0 94-95 3.1375 0.0 0.0 0.0 0.0 96-97 3.4000000000000004 0.0 0.0 0.0 0.0 98-99 3.725 0.0 0.0 0.0 0.0 100-101 4.1625 0.0 0.0 0.0 0.0 102-103 4.5625 0.0 0.0 0.0 0.0 104-105 4.925000000000001 0.0 0.0 0.0 0.0 106-107 5.5875 0.0 0.0 0.0 0.0 108-109 6.2875 0.0 0.0 0.0 0.0 110-111 6.975 0.0 0.0 0.0 0.0 112-113 7.75 0.0 0.0 0.0 0.0 114-115 8.55 0.0 0.0 0.0 0.0 116-117 9.149999999999999 0.0 0.0 0.0 0.0 118-119 9.75 0.0 0.0 0.0 0.0 120-121 10.537500000000001 0.0 0.0 0.0 0.0 122-123 11.412500000000001 0.0 0.0 0.0 0.0 124-125 12.375 0.0 0.0 0.0 0.0 126-127 13.7375 0.0 0.0 0.0 0.0 128-129 14.9375 0.0 0.0 0.0 0.0 130-131 16.025 0.0 0.0 0.0 0.0 132-133 17.3125 0.0 0.0 0.0 0.0 134-135 18.8125 0.0 0.0 0.0 0.0 136-137 20.3875 0.0 0.0 0.0 0.0 138 21.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTACC 15 1.1730364E-4 144.0 2 CTTACCA 15 1.1730364E-4 144.0 3 AGGTCCA 15 1.1730364E-4 144.0 9 CAGGTCC 15 1.1730364E-4 144.0 8 TACCAGG 15 1.1730364E-4 144.0 5 CCAGGTC 15 1.1730364E-4 144.0 7 ACCAGGT 15 1.1730364E-4 144.0 6 TTACCAG 20 3.687869E-4 108.0 4 AACTTAC 25 8.956223E-4 86.399994 1 AAGAGCG 60 0.0047032754 14.4 140-144 >>END_MODULE Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110573 spots for SRR26060480.sra Written 1110573 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra Read 1110566 spots for SRR26060480.sra Written 1110566 spots for SRR26060480.sra SRR ids: ['SRR26060480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ytp1r8rp SRR26060480.sra spots: 22211327 blocks: [[1, 1110566], [1110567, 2221132], [2221133, 3331698], [3331699, 4442264], [4442265, 5552830], [5552831, 6663396], [6663397, 7773962], [7773963, 8884528], [8884529, 9995094], [9995095, 11105660], [11105661, 12216226], [12216227, 13326792], [13326793, 14437358], [14437359, 15547924], [15547925, 16658490], [16658491, 17769056], [17769057, 18879622], [18879623, 19990188], [19990189, 21100754], [21100755, 22211327]] SRR26060480 file size 8176660 SRR26060480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR26060480 SRR26060480_1.fastq SRR26060480_2.fastq Input file: SRR26060480_1.fastq Paired file: SRR26060480_2.fastq trimmed: SRR26060480-trimmed-pair1.fastq, SRR26060480-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:51:58 2024 >> started Fri Dec 6 21:52:25 2024 >> done (27.234s) 22211327 read pairs processed; of these: 528 ( 0.00%) short read pairs filtered out after trimming by size control 8353 ( 0.04%) empty read pairs filtered out after trimming by size control 22202446 (99.96%) read pairs available; of these: 7008408 (31.57%) trimmed read pairs available after processing 15194038 (68.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 440 0.00% 19 142 0.00% 20 421 0.00% 21 282 0.00% 22 365 0.00% 23 481 0.00% 24 575 0.00% 25 686 0.00% 26 971 0.00% 27 1158 0.01% 28 1339 0.01% 29 1707 0.01% 30 1715 0.01% 31 1901 0.01% 32 2311 0.01% 33 2185 0.01% 34 3497 0.02% 35 2311 0.01% 36 2510 0.01% 37 2695 0.01% 38 2792 0.01% 39 3115 0.01% 40 3113 0.01% 41 3234 0.01% 42 3454 0.02% 43 3541 0.02% 44 3782 0.02% 45 3823 0.02% 46 4093 0.02% 47 4301 0.02% 48 5150 0.02% 49 4545 0.02% 50 4426 0.02% 51 4699 0.02% 52 5228 0.02% 53 5235 0.02% 54 5344 0.02% 55 5718 0.03% 56 5628 0.03% 57 5908 0.03% 58 6534 0.03% 59 6213 0.03% 60 6492 0.03% 61 6757 0.03% 62 7216 0.03% 63 7859 0.04% 64 8084 0.04% 65 8663 0.04% 66 8676 0.04% 67 9178 0.04% 68 9764 0.04% 69 9704 0.04% 70 10379 0.05% 71 10881 0.05% 72 11486 0.05% 73 12334 0.06% 74 12206 0.05% 75 13227 0.06% 76 13884 0.06% 77 14428 0.06% 78 14912 0.07% 79 16579 0.07% 80 17075 0.08% 81 17953 0.08% 82 19136 0.09% 83 19710 0.09% 84 20614 0.09% 85 22726 0.10% 86 23919 0.11% 87 27617 0.12% 88 27130 0.12% 89 27957 0.13% 90 29743 0.13% 91 31409 0.14% 92 33276 0.15% 93 35797 0.16% 94 37352 0.17% 95 39534 0.18% 96 40888 0.18% 97 43787 0.20% 98 46360 0.21% 99 47624 0.21% 100 50531 0.23% 101 53328 0.24% 102 55366 0.25% 103 60095 0.27% 104 61967 0.28% 105 64854 0.29% 106 67514 0.30% 107 70863 0.32% 108 73134 0.33% 109 78777 0.35% 110 80489 0.36% 111 83068 0.37% 112 88439 0.40% 113 90802 0.41% 114 96808 0.44% 115 102240 0.46% 116 103456 0.47% 117 106003 0.48% 118 108757 0.49% 119 112238 0.51% 120 118396 0.53% 121 118957 0.54% 122 123335 0.56% 123 131566 0.59% 124 132262 0.60% 125 135450 0.61% 126 136595 0.62% 127 138418 0.62% 128 140875 0.63% 129 143267 0.65% 130 145734 0.66% 131 148747 0.67% 132 151236 0.68% 133 151888 0.68% 134 150811 0.68% 135 152878 0.69% 136 156585 0.71% 137 156706 0.71% 138 154572 0.70% 139 159976 0.72% 140 158279 0.71% 141 156461 0.70% 142 158215 0.71% 143 159906 0.72% 144 160774 0.72% 145 160030 0.72% 146 159490 0.72% 147 161654 0.73% 148 163748 0.74% 149 162984 0.73% 150 15194038 68.43% 22202446 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=34 prefix-density=0.54 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=31.75 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=1.1 sequence=GCATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCTCC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=6 prefix-density=0.56 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=72.24 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=2.0 sequence=CCGCTCCAACACTTCAGTTCTCACTCCACAGCTCAGAGTCAGAGCTACTAGCAATGGCAGCGGCGACCATGGCGCTCTCCTCCCCCGCGATGGCCGGCACCCCGGTGAAGGTCTCCAGGGCCACCCCCTTCGGCGAGGGCCGCATCACCATGCGCAAGAC SRR26060480 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:53:16 Started mapping on | Dec 06 21:53:17 Finished on | Dec 06 21:55:38 Mapping speed, Million of reads per hour | 566.87 Number of input reads | 22202446 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 18031170 Uniquely mapped reads % | 81.21% Average mapped length | 281.84 Number of splices: Total | 16073818 Number of splices: Annotated (sjdb) | 15222800 Number of splices: GT/AG | 15853746 Number of splices: GC/AG | 181187 Number of splices: AT/AC | 7442 Number of splices: Non-canonical | 31443 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.46 Insertion rate per base | 0.01% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1184266 % of reads mapped to multiple loci | 5.33% Number of reads mapped to too many loci | 432899 % of reads mapped to too many loci | 1.95% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 9.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2987150 2987150 2987150 N_multimapping 1184266 1184266 1184266 N_noFeature 765020 17578888 934416 N_ambiguous 366756 2075 87546 UnstrandedReadsAssigned:16899394 PositiveStrandReadsAssigned:450207 NegativeStrandReadsAssigned:17009208 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=133 echo kmer=129 SRR26060480 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR26060480-trimmed-pair1.fastq SRR26060480-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,202,446 reads, 17,683,351 reads pseudoaligned [quant] estimated average fragment length: 185.979 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR26060480.ke.tsv 35125 SRR26060480.se.tsv 88098 total ==> SRR26060480.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.169 0 0 PNS24247 1044 859.021 24.7633 2.15244 PNS24249 1928 1743.02 208.848 8.94654 PNS24246 1044 859.021 24.7633 2.15244 PNS24248 1044 859.021 24.7633 2.15244 PNS24244 1471 1286.02 21.8616 1.26929 PNS24243 293 120.979 0 0 KQK14069 1603 1418.02 3949.48 207.962 KQK14071 474 290.467 304.617 78.304 ==> SRR26060480.se.tsv <== BRADI_1g14170v3 4432 BRADI_1g53295v3 13 BRADI_1g59795v3 305 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 2029 BRADI_1g74790v3 104 BRADI_1g09890v3 3 BRADI_1g77505v3 285 BRADI_1g48960v3 0 SRR26060480 completed mapping pipeline successfully