Starting /dee2/code/volunteer_pipeline.sh SRR2745295 current disk space = 1552309420032 free memory = 1333823652 SRR2745295 SRAfilesize 4a95b0212c6be80f3096812a633a4334 SRR2745295.sra SRR2745295.sra file validated SRR2745295 is single end SRR2745295 is conventional basespace SRR2745295 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745295_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.9585 35.0 35.0 35.0 31.0 35.0 2 33.85125 35.0 35.0 35.0 31.0 35.0 3 33.86575 35.0 35.0 35.0 31.0 35.0 4 33.872 35.0 35.0 35.0 31.0 35.0 5 33.67425 35.0 35.0 35.0 31.0 35.0 6 38.3765 40.0 39.0 40.0 35.0 40.0 7 38.48375 40.0 39.0 40.0 36.0 40.0 8 38.58875 40.0 39.0 40.0 36.0 40.0 9 38.55475 40.0 39.0 40.0 36.0 40.0 10 38.5475 40.0 39.0 40.0 36.0 40.0 11 38.5095 40.0 39.0 40.0 36.0 40.0 12 38.567 40.0 39.0 40.0 36.0 40.0 13 38.54975 40.0 39.0 40.0 36.0 40.0 14 38.49275 40.0 39.0 40.0 36.0 40.0 15 38.378 40.0 39.0 40.0 35.0 40.0 16 38.5665 40.0 39.0 40.0 36.0 40.0 17 38.53 40.0 39.0 40.0 36.0 40.0 18 38.52825 40.0 39.0 40.0 36.0 40.0 19 38.6155 40.0 39.0 40.0 36.0 40.0 20 38.469 40.0 39.0 40.0 36.0 40.0 21 38.5765 40.0 39.0 40.0 36.0 40.0 22 38.46125 40.0 39.0 40.0 36.0 40.0 23 38.507 40.0 39.0 40.0 36.0 40.0 24 38.392 40.0 39.0 40.0 35.0 40.0 25 38.4165 40.0 39.0 40.0 35.0 40.0 26 38.25175 40.0 39.0 40.0 34.0 40.0 27 38.41925 40.0 39.0 40.0 36.0 40.0 28 38.395 40.0 39.0 40.0 35.0 40.0 29 38.3715 40.0 39.0 40.0 36.0 40.0 30 38.518 40.0 39.0 40.0 36.0 40.0 31 38.44475 40.0 39.0 40.0 36.0 40.0 32 38.41875 40.0 39.0 40.0 36.0 40.0 33 38.33825 40.0 39.0 40.0 35.0 40.0 34 38.2895 40.0 39.0 40.0 35.0 40.0 35 38.24525 40.0 39.0 40.0 35.0 40.0 36 38.2665 40.0 39.0 40.0 35.0 40.0 37 38.37325 40.0 39.0 40.0 35.0 40.0 38 38.403 40.0 39.0 40.0 36.0 40.0 39 38.26725 40.0 39.0 40.0 35.0 40.0 40 38.31875 40.0 39.0 40.0 35.0 40.0 41 38.30975 40.0 39.0 40.0 35.0 40.0 42 38.31725 40.0 39.0 40.0 35.0 40.0 43 38.3035 40.0 39.0 40.0 35.0 40.0 44 38.2305 40.0 39.0 40.0 35.0 40.0 45 38.246 40.0 39.0 40.0 35.0 40.0 46 38.21225 40.0 39.0 40.0 35.0 40.0 47 38.13075 40.0 39.0 40.0 35.0 40.0 48 38.20075 40.0 39.0 40.0 35.0 40.0 49 38.11775 40.0 39.0 40.0 35.0 40.0 50 38.096 40.0 39.0 40.0 35.0 40.0 51 37.52675 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 2.0 24 5.0 25 8.0 26 8.0 27 13.0 28 21.0 29 32.0 30 35.0 31 63.0 32 77.0 33 89.0 34 113.0 35 132.0 36 217.0 37 316.0 38 685.0 39 2182.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.449999999999996 11.899999999999999 9.15 43.5 2 24.175 18.475 34.975 22.375 3 24.099999999999998 22.625 21.625 31.65 4 28.499999999999996 29.425 19.025 23.05 5 27.245283018867923 31.22012578616352 20.9811320754717 20.553459119496857 6 20.9 32.7 22.325 24.075 7 19.15 19.275000000000002 39.025 22.55 8 23.075000000000003 20.275000000000002 26.150000000000002 30.5 9 22.725 21.05 28.575 27.650000000000002 10 23.225 32.9 21.825 22.05 11 27.975 21.55 19.275000000000002 31.2 12 27.250000000000004 19.3 22.75 30.7 13 23.599999999999998 24.4 24.2 27.800000000000004 14 23.925 24.099999999999998 25.3 26.674999999999997 15 24.4 24.3 23.525 27.775 16 24.625 24.4 23.45 27.525 17 26.200000000000003 24.575 22.775000000000002 26.450000000000003 18 24.6 24.6 24.224999999999998 26.575 19 25.3 25.674999999999997 23.200000000000003 25.825 20 25.224999999999998 24.075 24.075 26.625 21 24.7 24.45 23.775 27.075 22 24.925 24.85 23.7 26.525 23 24.474999999999998 24.875 23.974999999999998 26.674999999999997 24 24.825 24.224999999999998 23.425 27.525 25 25.0 23.35 23.35 28.299999999999997 26 24.125 24.925 24.224999999999998 26.724999999999998 27 25.224999999999998 22.6 25.974999999999998 26.200000000000003 28 25.974999999999998 24.525 23.25 26.25 29 24.625 25.1 23.275000000000002 27.0 30 24.625 23.825 24.65 26.900000000000002 31 26.224999999999998 24.2 22.6 26.974999999999998 32 25.224999999999998 24.625 23.95 26.200000000000003 33 25.3 24.975 24.125 25.6 34 26.25 23.75 23.95 26.05 35 25.474999999999998 23.9 23.65 26.974999999999998 36 24.425 24.75 23.05 27.775 37 25.6 24.875 22.875 26.650000000000002 38 25.924999999999997 23.474999999999998 24.4 26.200000000000003 39 24.75 24.925 23.75 26.575 40 27.075 23.400000000000002 23.150000000000002 26.375 41 24.349999999999998 23.75 24.375 27.525 42 24.0 25.074999999999996 22.925 28.000000000000004 43 26.075 24.224999999999998 22.975 26.724999999999998 44 24.7 23.799999999999997 23.974999999999998 27.525 45 25.4 25.45 21.375 27.775 46 25.650000000000002 23.599999999999998 24.25 26.5 47 26.474999999999998 24.0 22.8 26.724999999999998 48 24.775 24.5 23.925 26.8 49 25.8 23.425 24.2 26.575 50 24.75 24.325 23.1 27.825 51 25.15 24.5 24.425 25.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 2.5 22 3.0 23 2.5 24 2.0 25 4.5 26 7.5 27 8.0 28 14.0 29 20.0 30 34.5 31 49.0 32 55.0 33 61.0 34 78.0 35 95.0 36 116.5 37 138.0 38 170.0 39 202.0 40 237.5 41 273.0 42 266.5 43 260.0 44 272.5 45 285.0 46 284.5 47 284.0 48 270.5 49 257.0 50 247.0 51 237.0 52 224.5 53 212.0 54 204.5 55 197.0 56 186.5 57 176.0 58 175.0 59 174.0 60 164.0 61 154.0 62 148.0 63 142.0 64 141.5 65 141.0 66 139.0 67 137.0 68 120.5 69 104.0 70 100.5 71 97.0 72 90.5 73 84.0 74 79.5 75 61.5 76 48.0 77 40.5 78 33.0 79 24.5 80 16.0 81 16.0 82 16.0 83 11.0 84 6.0 85 4.0 86 2.0 87 1.5 88 1.0 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.625 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132870 spots for SRR2745295.sra Written 1132870 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra Read 1132858 spots for SRR2745295.sra Written 1132858 spots for SRR2745295.sra SRR ids: ['SRR2745295.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n93lzhfw SRR2745295.sra spots: 22657172 blocks: [[1, 1132858], [1132859, 2265716], [2265717, 3398574], [3398575, 4531432], [4531433, 5664290], [5664291, 6797148], [6797149, 7930006], [7930007, 9062864], [9062865, 10195722], [10195723, 11328580], [11328581, 12461438], [12461439, 13594296], [13594297, 14727154], [14727155, 15860012], [15860013, 16992870], [16992871, 18125728], [18125729, 19258586], [19258587, 20391444], [20391445, 21524302], [21524303, 22657172]] SRR2745295 file size 3938440 SRR2745295 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745295 SRR2745295_1.fastq Input file: SRR2745295_1.fastq trimmed: SRR2745295-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 09:49:02 2024 >> started Fri Dec 6 09:49:18 2024 >> done (16.232s) 22657172 reads processed; of these: 1259 ( 0.01%) short reads filtered out after trimming by size control 6032 ( 0.03%) empty reads filtered out after trimming by size control 22649881 (99.97%) reads available; of these: 313310 ( 1.38%) trimmed reads available after processing 22336571 (98.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 95 0.00% 19 126 0.00% 20 135 0.00% 21 179 0.00% 22 222 0.00% 23 294 0.00% 24 384 0.00% 25 543 0.00% 26 467 0.00% 27 527 0.00% 28 558 0.00% 29 693 0.00% 30 647 0.00% 31 804 0.00% 32 886 0.00% 33 1049 0.00% 34 1173 0.01% 35 1300 0.01% 36 1614 0.01% 37 1926 0.01% 38 2546 0.01% 39 3663 0.02% 40 3345 0.01% 41 6126 0.03% 42 5355 0.02% 43 9909 0.04% 44 10064 0.04% 45 12029 0.05% 46 18433 0.08% 47 24533 0.11% 48 34844 0.15% 49 61423 0.27% 50 107418 0.47% 51 22336571 98.62% 22649881 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=134.67 fanout-score-rank=7 prefix-density=0.56 prefix-fanout=19.9 sequence=CGCCGCCGCCGCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=313.05 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=19.9 sequence=CGCCGCCGCCGA Started job on | Dec 06 09:50:32 Started mapping on | Dec 06 09:50:33 Finished on | Dec 06 09:50:54 Mapping speed, Million of reads per hour | 3882.84 Number of input reads | 22649881 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 21913645 Uniquely mapped reads % | 96.75% Average mapped length | 50.78 Number of splices: Total | 3200114 Number of splices: Annotated (sjdb) | 3061747 Number of splices: GT/AG | 3147124 Number of splices: GC/AG | 47984 Number of splices: AT/AC | 1585 Number of splices: Non-canonical | 3421 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 1.44 Insertion rate per base | 0.00% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 509222 % of reads mapped to multiple loci | 2.25% Number of reads mapped to too many loci | 119257 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.45% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 227014 227014 227014 N_multimapping 509222 509222 509222 N_noFeature 981343 21326074 1206862 N_ambiguous 399446 1263 38263 UnstrandedReadsAssigned:20532856 PositiveStrandReadsAssigned:586308 NegativeStrandReadsAssigned:20668520 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745295 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745295-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,649,881 reads, 20,145,816 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52973 SRR2745295.ke.tsv 35125 SRR2745295.se.tsv 88098 total ==> SRR2745295.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 154.881 14.8206 PNS24247 1044 945 50.056 4.24248 PNS24249 1928 1829 456.951 20.0102 PNS24246 1044 945 50.056 4.24248 PNS24248 1044 945 50.056 4.24248 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 32956.1 1755.02 KQK14071 474 375 10806 2307.97 ==> SRR2745295.se.tsv <== BRADI_1g14170v3 47950 BRADI_1g53295v3 101 BRADI_1g59795v3 705 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 421 BRADI_1g74790v3 770 BRADI_1g09890v3 0 BRADI_1g77505v3 459 BRADI_1g48960v3 0 SRR2745295 completed mapping pipeline successfully