Starting /dee2/code/volunteer_pipeline.sh SRR2745296 current disk space = 1552306552832 free memory = 1332588852 SRR2745296 SRAfilesize fb173f7c4feb68603b34d30b530e5222 SRR2745296.sra SRR2745296.sra file validated SRR2745296 is single end SRR2745296 is conventional basespace SRR2745296 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745296_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.948 35.0 35.0 35.0 31.0 35.0 2 33.8455 35.0 35.0 35.0 31.0 35.0 3 33.88125 35.0 35.0 35.0 31.0 35.0 4 33.84725 35.0 35.0 35.0 31.0 35.0 5 33.71775 35.0 35.0 35.0 31.0 35.0 6 38.40825 40.0 39.0 40.0 36.0 40.0 7 38.544 40.0 39.0 40.0 36.0 40.0 8 38.549 40.0 39.0 40.0 36.0 40.0 9 38.5495 40.0 39.0 40.0 36.0 40.0 10 38.5505 40.0 39.0 40.0 36.0 40.0 11 38.58 40.0 39.0 40.0 36.0 40.0 12 38.4905 40.0 39.0 40.0 36.0 40.0 13 38.5005 40.0 39.0 40.0 36.0 40.0 14 38.47075 40.0 39.0 40.0 36.0 40.0 15 38.425 40.0 39.0 40.0 36.0 40.0 16 38.53875 40.0 39.0 40.0 36.0 40.0 17 38.5895 40.0 39.0 40.0 36.0 40.0 18 38.4835 40.0 39.0 40.0 36.0 40.0 19 38.54325 40.0 39.0 40.0 36.0 40.0 20 38.49125 40.0 39.0 40.0 36.0 40.0 21 38.452 40.0 39.0 40.0 36.0 40.0 22 38.5105 40.0 39.0 40.0 36.0 40.0 23 38.5535 40.0 39.0 40.0 36.0 40.0 24 38.51125 40.0 39.0 40.0 36.0 40.0 25 38.50725 40.0 39.0 40.0 36.0 40.0 26 38.23425 40.0 39.0 40.0 35.0 40.0 27 38.35875 40.0 39.0 40.0 36.0 40.0 28 38.4165 40.0 39.0 40.0 36.0 40.0 29 38.2805 40.0 39.0 40.0 35.0 40.0 30 38.38125 40.0 39.0 40.0 36.0 40.0 31 38.35675 40.0 39.0 40.0 35.0 40.0 32 38.35775 40.0 39.0 40.0 36.0 40.0 33 38.338 40.0 39.0 40.0 35.0 40.0 34 38.30025 40.0 39.0 40.0 35.0 40.0 35 38.26 40.0 39.0 40.0 35.0 40.0 36 38.28775 40.0 39.0 40.0 35.0 40.0 37 38.18375 40.0 39.0 40.0 35.0 40.0 38 38.3635 40.0 39.0 40.0 36.0 40.0 39 38.31875 40.0 39.0 40.0 35.0 40.0 40 38.4 40.0 39.0 40.0 36.0 40.0 41 38.3255 40.0 39.0 40.0 35.0 40.0 42 38.29125 40.0 39.0 40.0 35.0 40.0 43 38.2695 40.0 39.0 40.0 35.0 40.0 44 38.225 40.0 39.0 40.0 35.0 40.0 45 38.1825 40.0 39.0 40.0 35.0 40.0 46 38.21625 40.0 39.0 40.0 35.0 40.0 47 38.1725 40.0 39.0 40.0 35.0 40.0 48 38.21975 40.0 39.0 40.0 35.0 40.0 49 38.19475 40.0 39.0 40.0 35.0 40.0 50 38.0475 40.0 39.0 40.0 34.0 40.0 51 37.36725 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 5.0 25 3.0 26 13.0 27 14.0 28 18.0 29 29.0 30 45.0 31 56.0 32 78.0 33 85.0 34 121.0 35 144.0 36 217.0 37 324.0 38 674.0 39 2171.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.975 12.35 8.95 35.725 2 26.525 16.5 32.05 24.925 3 24.224999999999998 23.200000000000003 21.15 31.424999999999997 4 28.225 29.15 19.725 22.900000000000002 5 27.896456396079415 30.686102035687355 20.758984669514955 20.65845689871827 6 22.625 32.875 21.925 22.575 7 19.05 19.7 38.975 22.275 8 21.0 21.625 25.0 32.375 9 21.9 20.424999999999997 29.175 28.499999999999996 10 24.725 32.550000000000004 20.75 21.975 11 27.35 22.375 18.85 31.424999999999997 12 27.900000000000002 19.1 22.0 31.0 13 24.875 22.3 23.799999999999997 29.025000000000002 14 22.675 24.975 24.5 27.85 15 25.45 24.224999999999998 24.875 25.45 16 26.724999999999998 24.55 22.1 26.625 17 24.425 25.074999999999996 24.0 26.5 18 25.025 24.474999999999998 24.25 26.25 19 26.325 23.674999999999997 22.95 27.05 20 25.124999999999996 24.75 22.85 27.275 21 22.775000000000002 25.525 24.224999999999998 27.474999999999998 22 25.5 23.9 24.5 26.1 23 25.3 24.099999999999998 23.35 27.250000000000004 24 24.349999999999998 23.825 25.2 26.625 25 25.074999999999996 24.95 23.625 26.35 26 26.25 23.974999999999998 23.474999999999998 26.3 27 23.75 24.125 24.275 27.85 28 26.150000000000002 23.724999999999998 23.175 26.950000000000003 29 26.8 24.8 22.975 25.424999999999997 30 25.275 24.3 23.974999999999998 26.450000000000003 31 25.1 25.55 22.8 26.55 32 26.200000000000003 24.725 23.1 25.974999999999998 33 24.725 23.7 24.325 27.250000000000004 34 25.174999999999997 23.974999999999998 22.75 28.1 35 25.525 24.525 24.05 25.900000000000002 36 25.474999999999998 23.400000000000002 24.75 26.375 37 26.85 24.625 22.1 26.424999999999997 38 27.525 24.65 22.775000000000002 25.05 39 24.825 23.7 24.5 26.974999999999998 40 25.775 24.0 23.125 27.1 41 25.825 23.9 24.3 25.974999999999998 42 24.375 24.075 23.849999999999998 27.700000000000003 43 25.0 24.825 22.325 27.85 44 24.95 24.775 22.775000000000002 27.500000000000004 45 25.1 24.375 23.65 26.875 46 25.3 24.474999999999998 23.075000000000003 27.150000000000002 47 26.224999999999998 24.5 22.925 26.35 48 25.724999999999998 24.0 23.45 26.825 49 26.6 24.675 22.175 26.55 50 26.025 22.975 24.075 26.924999999999997 51 24.325 23.75 23.674999999999997 28.249999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 2.5 24 4.0 25 3.5 26 6.0 27 9.0 28 17.5 29 26.0 30 32.0 31 38.0 32 45.5 33 53.0 34 75.0 35 97.0 36 112.5 37 128.0 38 153.0 39 178.0 40 201.0 41 224.0 42 245.0 43 266.0 44 279.5 45 293.0 46 300.0 47 307.0 48 294.0 49 281.0 50 257.0 51 233.0 52 241.5 53 250.0 54 230.5 55 211.0 56 195.0 57 179.0 58 179.5 59 180.0 60 158.0 61 136.0 62 137.5 63 139.0 64 135.0 65 131.0 66 128.0 67 125.0 68 117.0 69 109.0 70 105.5 71 102.0 72 99.5 73 97.0 74 88.5 75 64.0 76 48.0 77 41.5 78 35.0 79 27.0 80 19.0 81 14.0 82 9.0 83 7.5 84 6.0 85 4.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.0 12 0.05 0.0 0.0 0.0 0.0 13 0.05 0.0 0.0 0.0 0.0 14 0.05 0.0 0.0 0.0 0.0 15 0.05 0.0 0.0 0.0 0.0 16 0.05 0.0 0.0 0.0 0.0 17 0.05 0.0 0.0 0.0 0.0 18 0.05 0.0 0.0 0.0 0.0 19 0.05 0.0 0.0 0.0 0.0 20 0.05 0.0 0.0 0.0 0.0 21 0.05 0.0 0.0 0.0 0.0 22 0.05 0.0 0.0 0.0 0.0 23 0.05 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra Read 1034717 spots for SRR2745296.sra Written 1034717 spots for SRR2745296.sra Read 1034710 spots for SRR2745296.sra Written 1034710 spots for SRR2745296.sra SRR ids: ['SRR2745296.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bvtmg0bj SRR2745296.sra spots: 20694207 blocks: [[1, 1034710], [1034711, 2069420], [2069421, 3104130], [3104131, 4138840], [4138841, 5173550], [5173551, 6208260], [6208261, 7242970], [7242971, 8277680], [8277681, 9312390], [9312391, 10347100], [10347101, 11381810], [11381811, 12416520], [12416521, 13451230], [13451231, 14485940], [14485941, 15520650], [15520651, 16555360], [16555361, 17590070], [17590071, 18624780], [18624781, 19659490], [19659491, 20694207]] SRR2745296 file size 3596262 SRR2745296 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745296 SRR2745296_1.fastq Input file: SRR2745296_1.fastq trimmed: SRR2745296-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 09:49:00 2024 >> started Fri Dec 6 09:49:15 2024 >> done (14.597s) 20694207 reads processed; of these: 1036 ( 0.01%) short reads filtered out after trimming by size control 8994 ( 0.04%) empty reads filtered out after trimming by size control 20684177 (99.95%) reads available; of these: 286246 ( 1.38%) trimmed reads available after processing 20397931 (98.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 96 0.00% 19 140 0.00% 20 144 0.00% 21 169 0.00% 22 237 0.00% 23 267 0.00% 24 369 0.00% 25 519 0.00% 26 441 0.00% 27 486 0.00% 28 575 0.00% 29 686 0.00% 30 609 0.00% 31 767 0.00% 32 821 0.00% 33 1025 0.00% 34 1047 0.01% 35 1229 0.01% 36 1403 0.01% 37 1874 0.01% 38 2424 0.01% 39 3521 0.02% 40 3268 0.02% 41 5685 0.03% 42 5018 0.02% 43 9316 0.05% 44 9255 0.04% 45 11193 0.05% 46 17260 0.08% 47 22442 0.11% 48 31930 0.15% 49 53940 0.26% 50 98090 0.47% 51 20397931 98.62% 20684177 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=118.06 fanout-score-rank=6 prefix-density=0.52 prefix-fanout=18.3 sequence=CGCCGCCGCCGCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=14 fanout-score=278.05 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=18.3 sequence=CGCCGCCGCCGG Started job on | Dec 06 09:50:27 Started mapping on | Dec 06 09:50:27 Finished on | Dec 06 09:50:49 Mapping speed, Million of reads per hour | 3384.68 Number of input reads | 20684177 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 20014008 Uniquely mapped reads % | 96.76% Average mapped length | 50.77 Number of splices: Total | 2901087 Number of splices: Annotated (sjdb) | 2780203 Number of splices: GT/AG | 2851837 Number of splices: GC/AG | 44103 Number of splices: AT/AC | 1352 Number of splices: Non-canonical | 3795 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.01% Deletion average length | 1.46 Insertion rate per base | 0.01% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460481 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 95284 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 209688 209688 209688 N_multimapping 460481 460481 460481 N_noFeature 912828 19457887 1133401 N_ambiguous 370263 1096 35564 UnstrandedReadsAssigned:18730917 PositiveStrandReadsAssigned:555025 NegativeStrandReadsAssigned:18845043 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745296 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745296-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,684,177 reads, 18,325,406 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52973 SRR2745296.ke.tsv 35125 SRR2745296.se.tsv 88098 total ==> SRR2745296.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 44.8127 4.7402 PNS24247 1044 945 78.408 7.34598 PNS24249 1928 1829 359.731 17.4135 PNS24246 1044 945 78.408 7.34598 PNS24248 1044 945 78.408 7.34598 PNS24244 1471 1372 28.232 1.82184 PNS24243 293 194 0 0 KQK14069 1603 1504 27283.3 1606.09 KQK14071 474 375 9643 2276.68 ==> SRR2745296.se.tsv <== BRADI_1g14170v3 40404 BRADI_1g53295v3 98 BRADI_1g59795v3 523 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 376 BRADI_1g74790v3 888 BRADI_1g09890v3 0 BRADI_1g77505v3 391 BRADI_1g48960v3 0 SRR2745296 completed mapping pipeline successfully