Starting /dee2/code/volunteer_pipeline.sh SRR2745297 current disk space = 1552306552832 free memory = 1332691176 SRR2745297 SRAfilesize d1a9df4f4daa3a472252a35900cfce26 SRR2745297.sra SRR2745297.sra file validated SRR2745297 is single end SRR2745297 is conventional basespace SRR2745297 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745297_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.88325 35.0 35.0 35.0 31.0 35.0 2 33.84275 35.0 35.0 35.0 31.0 35.0 3 33.84125 35.0 35.0 35.0 31.0 35.0 4 33.7835 35.0 34.0 35.0 31.0 35.0 5 33.67525 35.0 35.0 35.0 31.0 35.0 6 38.32175 40.0 39.0 40.0 35.0 40.0 7 38.4575 40.0 39.0 40.0 36.0 40.0 8 38.4865 40.0 39.0 40.0 36.0 40.0 9 38.44375 40.0 39.0 40.0 36.0 40.0 10 38.49575 40.0 39.0 40.0 36.0 40.0 11 38.4985 40.0 39.0 40.0 36.0 40.0 12 38.41775 40.0 39.0 40.0 36.0 40.0 13 38.42675 40.0 39.0 40.0 36.0 40.0 14 38.43925 40.0 39.0 40.0 36.0 40.0 15 38.41875 40.0 39.0 40.0 36.0 40.0 16 38.503 40.0 39.0 40.0 36.0 40.0 17 38.4175 40.0 39.0 40.0 35.0 40.0 18 38.36725 40.0 39.0 40.0 35.0 40.0 19 38.39625 40.0 39.0 40.0 36.0 40.0 20 38.20225 40.0 39.0 40.0 34.0 40.0 21 38.4875 40.0 39.0 40.0 36.0 40.0 22 38.44875 40.0 39.0 40.0 36.0 40.0 23 38.41575 40.0 39.0 40.0 36.0 40.0 24 38.30075 40.0 39.0 40.0 35.0 40.0 25 38.3055 40.0 39.0 40.0 35.0 40.0 26 38.0755 40.0 39.0 40.0 34.0 40.0 27 38.3035 40.0 39.0 40.0 35.0 40.0 28 38.42325 40.0 39.0 40.0 35.0 40.0 29 38.37475 40.0 39.0 40.0 35.0 40.0 30 38.3725 40.0 39.0 40.0 36.0 40.0 31 38.3995 40.0 39.0 40.0 35.0 40.0 32 38.26525 40.0 39.0 40.0 35.0 40.0 33 38.338 40.0 39.0 40.0 36.0 40.0 34 38.3085 40.0 39.0 40.0 35.0 40.0 35 38.19625 40.0 39.0 40.0 35.0 40.0 36 38.22425 40.0 39.0 40.0 35.0 40.0 37 38.199 40.0 39.0 40.0 35.0 40.0 38 38.34025 40.0 39.0 40.0 35.0 40.0 39 38.26375 40.0 39.0 40.0 35.0 40.0 40 38.279 40.0 39.0 40.0 35.0 40.0 41 38.276 40.0 39.0 40.0 35.0 40.0 42 38.2385 40.0 39.0 40.0 35.0 40.0 43 38.21975 40.0 39.0 40.0 35.0 40.0 44 38.09 40.0 39.0 40.0 35.0 40.0 45 38.1025 40.0 39.0 40.0 34.0 40.0 46 38.072 40.0 39.0 40.0 34.0 40.0 47 38.05325 40.0 39.0 40.0 35.0 40.0 48 38.05025 40.0 39.0 40.0 34.0 40.0 49 37.97375 40.0 39.0 40.0 34.0 40.0 50 37.9405 40.0 39.0 40.0 34.0 40.0 51 37.354 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 5.0 25 7.0 26 4.0 27 23.0 28 21.0 29 32.0 30 42.0 31 64.0 32 68.0 33 107.0 34 105.0 35 146.0 36 222.0 37 322.0 38 717.0 39 2108.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.5 11.25 9.85 41.4 2 26.0 18.0 31.574999999999996 24.425 3 24.025 23.625 21.65 30.7 4 28.675 29.299999999999997 18.15 23.875 5 27.156147850138296 31.70731707317073 20.895147095800855 20.241387980890117 6 22.25 33.15 21.475 23.125 7 19.725 19.7 37.875 22.7 8 22.25 20.7 26.700000000000003 30.349999999999998 9 22.925 20.75 28.725 27.6 10 23.95 33.35 19.7 23.0 11 26.474999999999998 23.674999999999997 19.45 30.4 12 27.55 18.975 23.400000000000002 30.075000000000003 13 23.474999999999998 23.150000000000002 24.9 28.475 14 23.35 25.424999999999997 24.725 26.5 15 23.075000000000003 25.25 25.0 26.674999999999997 16 24.85 24.425 22.900000000000002 27.825 17 26.174999999999997 24.95 23.7 25.174999999999997 18 24.45 25.874999999999996 23.35 26.325 19 25.3 25.650000000000002 22.400000000000002 26.650000000000002 20 24.349999999999998 25.324999999999996 24.25 26.075 21 23.974999999999998 24.325 24.725 26.974999999999998 22 25.424999999999997 25.174999999999997 22.400000000000002 27.0 23 24.55 25.25 23.849999999999998 26.35 24 24.775 24.525 23.799999999999997 26.900000000000002 25 24.975 24.175 24.275 26.575 26 25.3 23.724999999999998 25.674999999999997 25.3 27 25.15 24.9 24.0 25.95 28 26.174999999999997 24.2 23.05 26.575 29 25.174999999999997 25.0 23.625 26.200000000000003 30 24.25 25.25 23.724999999999998 26.775 31 26.25 24.675 22.35 26.724999999999998 32 26.474999999999998 23.875 24.0 25.650000000000002 33 23.925 24.224999999999998 24.55 27.3 34 25.025 24.775 23.0 27.200000000000003 35 26.575 23.7 23.425 26.3 36 24.75 24.85 23.0 27.400000000000002 37 25.85 24.4 23.25 26.5 38 25.424999999999997 24.725 23.45 26.400000000000002 39 24.2 25.174999999999997 24.375 26.25 40 24.9 23.599999999999998 24.325 27.175 41 25.8 22.6 25.05 26.55 42 25.4 23.5 24.775 26.325 43 25.25 24.0 22.975 27.775 44 24.775 24.925 23.5 26.8 45 23.275000000000002 24.825 24.3 27.6 46 26.0 23.825 23.7 26.474999999999998 47 25.624999999999996 23.549999999999997 23.974999999999998 26.85 48 24.5 24.474999999999998 23.549999999999997 27.474999999999998 49 25.775 24.3 22.575 27.35 50 26.125 24.075 23.0 26.8 51 25.424999999999997 23.7 24.525 26.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 3.0 24 5.0 25 7.5 26 9.5 27 9.0 28 16.0 29 23.0 30 27.5 31 32.0 32 46.5 33 61.0 34 77.5 35 94.0 36 123.5 37 153.0 38 166.0 39 179.0 40 220.5 41 262.0 42 264.5 43 267.0 44 266.5 45 266.0 46 278.0 47 290.0 48 277.0 49 264.0 50 265.5 51 267.0 52 249.0 53 231.0 54 220.0 55 209.0 56 201.0 57 193.0 58 179.5 59 166.0 60 166.0 61 166.0 62 155.5 63 145.0 64 135.5 65 126.0 66 129.0 67 132.0 68 126.5 69 121.0 70 109.0 71 97.0 72 81.5 73 66.0 74 61.0 75 48.0 76 40.0 77 36.0 78 32.0 79 25.0 80 18.0 81 12.5 82 7.0 83 7.0 84 7.0 85 5.5 86 4.0 87 2.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.575 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205332 spots for SRR2745297.sra Written 1205332 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra Read 1205328 spots for SRR2745297.sra Written 1205328 spots for SRR2745297.sra SRR ids: ['SRR2745297.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4oieltdv SRR2745297.sra spots: 24106564 blocks: [[1, 1205328], [1205329, 2410656], [2410657, 3615984], [3615985, 4821312], [4821313, 6026640], [6026641, 7231968], [7231969, 8437296], [8437297, 9642624], [9642625, 10847952], [10847953, 12053280], [12053281, 13258608], [13258609, 14463936], [14463937, 15669264], [15669265, 16874592], [16874593, 18079920], [18079921, 19285248], [19285249, 20490576], [20490577, 21695904], [21695905, 22901232], [22901233, 24106564]] SRR2745297 file size 4191064 SRR2745297 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745297 SRR2745297_1.fastq Input file: SRR2745297_1.fastq trimmed: SRR2745297-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 09:49:00 2024 >> started Fri Dec 6 09:49:18 2024 >> done (17.276s) 24106564 reads processed; of these: 1152 ( 0.00%) short reads filtered out after trimming by size control 5345 ( 0.02%) empty reads filtered out after trimming by size control 24100067 (99.97%) reads available; of these: 321032 ( 1.33%) trimmed reads available after processing 23779035 (98.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 112 0.00% 19 130 0.00% 20 155 0.00% 21 189 0.00% 22 226 0.00% 23 286 0.00% 24 407 0.00% 25 571 0.00% 26 476 0.00% 27 571 0.00% 28 568 0.00% 29 678 0.00% 30 702 0.00% 31 828 0.00% 32 851 0.00% 33 1009 0.00% 34 1192 0.00% 35 1382 0.01% 36 1544 0.01% 37 1885 0.01% 38 2494 0.01% 39 3518 0.01% 40 3491 0.01% 41 5688 0.02% 42 5535 0.02% 43 9380 0.04% 44 9829 0.04% 45 12473 0.05% 46 18148 0.08% 47 24642 0.10% 48 36049 0.15% 49 63692 0.26% 50 112331 0.47% 51 23779035 98.67% 24100067 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=14.77 fanout-score-rank=10 prefix-density=0.19 prefix-fanout=5.9 sequence=GCCGCCGCGGCCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=11 fanout-score=236.48 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=19.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGC Started job on | Dec 06 09:50:31 Started mapping on | Dec 06 09:50:31 Finished on | Dec 06 09:50:56 Mapping speed, Million of reads per hour | 3470.41 Number of input reads | 24100067 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 23381264 Uniquely mapped reads % | 97.02% Average mapped length | 50.79 Number of splices: Total | 3380669 Number of splices: Annotated (sjdb) | 3244568 Number of splices: GT/AG | 3321916 Number of splices: GC/AG | 53792 Number of splices: AT/AC | 1574 Number of splices: Non-canonical | 3387 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.45 Insertion rate per base | 0.00% Insertion average length | 1.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510270 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 110645 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 208533 208533 208533 N_multimapping 510270 510270 510270 N_noFeature 992636 22741305 1234451 N_ambiguous 436564 1346 39433 UnstrandedReadsAssigned:21952064 PositiveStrandReadsAssigned:638613 NegativeStrandReadsAssigned:22107380 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745297 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745297-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,100,067 reads, 21,592,283 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,236 rounds 52973 SRR2745297.ke.tsv 35125 SRR2745297.se.tsv 88098 total ==> SRR2745297.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 239.66 21.2812 PNS24247 1044 945 56.9535 4.47933 PNS24249 1928 1829 361.281 14.681 PNS24246 1044 945 56.9535 4.47933 PNS24248 1044 945 56.9535 4.47933 PNS24244 1471 1372 55.1985 2.99019 PNS24243 293 194 0 0 KQK14069 1603 1504 37813.7 1868.64 KQK14071 474 375 11553.7 2289.89 ==> SRR2745297.se.tsv <== BRADI_1g14170v3 53420 BRADI_1g53295v3 93 BRADI_1g59795v3 642 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 424 BRADI_1g74790v3 993 BRADI_1g09890v3 0 BRADI_1g77505v3 398 BRADI_1g48960v3 0 SRR2745297 completed mapping pipeline successfully