Starting /dee2/code/volunteer_pipeline.sh SRR2745298 current disk space = 1552299470848 free memory = 1607250992 SRR2745298 SRAfilesize a50cb05df24554c59a70d9fae5057f74 SRR2745298.sra SRR2745298.sra file validated SRR2745298 is single end SRR2745298 is conventional basespace SRR2745298 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745298_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.94875 35.0 35.0 35.0 31.0 35.0 2 33.94075 35.0 35.0 35.0 31.0 35.0 3 33.94 35.0 35.0 35.0 31.0 35.0 4 33.87725 35.0 35.0 35.0 31.0 35.0 5 33.762 35.0 35.0 35.0 31.0 35.0 6 38.38575 40.0 39.0 40.0 35.0 40.0 7 38.55275 40.0 39.0 40.0 36.0 40.0 8 38.596 40.0 39.0 40.0 36.0 40.0 9 38.5595 40.0 39.0 40.0 36.0 40.0 10 38.5475 40.0 39.0 40.0 36.0 40.0 11 38.51375 40.0 39.0 40.0 36.0 40.0 12 38.58325 40.0 39.0 40.0 36.0 40.0 13 38.5325 40.0 39.0 40.0 36.0 40.0 14 38.48875 40.0 39.0 40.0 36.0 40.0 15 38.42725 40.0 39.0 40.0 35.0 40.0 16 38.473 40.0 39.0 40.0 36.0 40.0 17 38.4345 40.0 39.0 40.0 36.0 40.0 18 38.431 40.0 39.0 40.0 36.0 40.0 19 38.54925 40.0 39.0 40.0 36.0 40.0 20 38.46525 40.0 39.0 40.0 36.0 40.0 21 38.59875 40.0 39.0 40.0 36.0 40.0 22 38.5135 40.0 39.0 40.0 36.0 40.0 23 38.613 40.0 39.0 40.0 36.0 40.0 24 38.53975 40.0 39.0 40.0 36.0 40.0 25 38.49975 40.0 39.0 40.0 36.0 40.0 26 38.1825 40.0 39.0 40.0 35.0 40.0 27 38.5085 40.0 39.0 40.0 36.0 40.0 28 38.549 40.0 39.0 40.0 36.0 40.0 29 38.505 40.0 39.0 40.0 36.0 40.0 30 38.55975 40.0 39.0 40.0 36.0 40.0 31 38.52375 40.0 39.0 40.0 36.0 40.0 32 38.4965 40.0 39.0 40.0 36.0 40.0 33 38.4275 40.0 39.0 40.0 36.0 40.0 34 38.4005 40.0 39.0 40.0 35.0 40.0 35 38.33925 40.0 39.0 40.0 36.0 40.0 36 38.40175 40.0 39.0 40.0 35.0 40.0 37 38.4565 40.0 39.0 40.0 36.0 40.0 38 38.40875 40.0 39.0 40.0 36.0 40.0 39 38.3915 40.0 39.0 40.0 35.0 40.0 40 38.349 40.0 39.0 40.0 35.0 40.0 41 38.34875 40.0 39.0 40.0 35.0 40.0 42 38.31325 40.0 39.0 40.0 35.0 40.0 43 38.3905 40.0 39.0 40.0 35.0 40.0 44 38.2625 40.0 39.0 40.0 35.0 40.0 45 38.2215 40.0 39.0 40.0 34.0 40.0 46 38.22775 40.0 39.0 40.0 35.0 40.0 47 38.2125 40.0 39.0 40.0 35.0 40.0 48 38.232 40.0 39.0 40.0 35.0 40.0 49 38.13775 40.0 39.0 40.0 34.0 40.0 50 38.23325 40.0 39.0 40.0 35.0 40.0 51 37.5425 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 2.0 24 3.0 25 2.0 26 6.0 27 10.0 28 28.0 29 27.0 30 35.0 31 47.0 32 74.0 33 101.0 34 112.0 35 142.0 36 192.0 37 358.0 38 685.0 39 2173.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.75 11.875 8.5 40.875 2 26.150000000000002 17.4 32.375 24.075 3 23.0 23.674999999999997 23.1 30.225 4 27.85 29.349999999999998 19.05 23.75 5 26.718710652228655 30.2694535381516 21.50591790480987 21.50591790480987 6 22.725 32.824999999999996 21.15 23.3 7 20.1 20.599999999999998 37.675 21.625 8 21.65 19.7 27.200000000000003 31.45 9 21.45 20.150000000000002 29.849999999999998 28.549999999999997 10 23.9 32.800000000000004 20.9 22.400000000000002 11 27.800000000000004 21.425 19.85 30.925000000000004 12 25.7 20.225 23.525 30.55 13 25.074999999999996 22.875 24.55 27.500000000000004 14 25.0 24.15 25.275 25.575 15 24.275 23.025000000000002 26.375 26.325 16 27.375 23.7 22.475 26.450000000000003 17 24.575 23.625 25.525 26.275 18 24.0 24.575 24.75 26.674999999999997 19 25.1 23.05 24.4 27.450000000000003 20 24.4 24.525 24.349999999999998 26.724999999999998 21 24.9 24.099999999999998 24.85 26.150000000000002 22 23.724999999999998 26.075 23.35 26.85 23 25.0 24.575 24.175 26.25 24 23.625 24.224999999999998 24.85 27.3 25 26.674999999999997 23.175 22.6 27.55 26 24.975 23.425 24.25 27.35 27 24.5 23.724999999999998 24.925 26.85 28 26.450000000000003 23.625 24.2 25.724999999999998 29 25.525 24.15 24.349999999999998 25.974999999999998 30 24.325 24.125 24.825 26.724999999999998 31 24.775 24.725 23.3 27.200000000000003 32 26.825 24.125 23.075000000000003 25.974999999999998 33 23.95 24.275 24.425 27.35 34 26.474999999999998 23.025000000000002 23.625 26.875 35 25.525 24.675 22.375 27.425 36 24.725 24.325 24.275 26.674999999999997 37 24.65 24.3 23.875 27.175 38 24.25 24.75 24.4 26.6 39 24.8 24.875 23.05 27.275 40 26.1 24.15 22.675 27.075 41 26.25 24.825 22.875 26.05 42 25.55 24.2 23.974999999999998 26.275 43 24.425 25.45 23.875 26.25 44 25.1 25.124999999999996 23.375 26.400000000000002 45 24.4 24.425 23.65 27.525 46 25.25 23.375 24.325 27.05 47 25.650000000000002 24.025 24.099999999999998 26.224999999999998 48 25.124999999999996 23.75 23.674999999999997 27.450000000000003 49 26.625 24.95 22.900000000000002 25.525 50 24.825 23.575 24.425 27.175 51 25.4 24.275 23.325000000000003 27.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 4.0 24 7.0 25 6.0 26 8.5 27 12.0 28 18.0 29 24.0 30 32.5 31 41.0 32 56.5 33 72.0 34 75.0 35 78.0 36 113.0 37 148.0 38 173.5 39 199.0 40 215.0 41 231.0 42 247.0 43 263.0 44 280.0 45 297.0 46 291.5 47 286.0 48 271.5 49 257.0 50 259.5 51 262.0 52 239.0 53 216.0 54 219.5 55 223.0 56 191.5 57 160.0 58 161.5 59 163.0 60 171.0 61 179.0 62 162.0 63 145.0 64 140.5 65 136.0 66 139.0 67 142.0 68 130.0 69 118.0 70 104.5 71 91.0 72 73.5 73 56.0 74 62.0 75 60.5 76 53.0 77 42.0 78 31.0 79 23.0 80 15.0 81 15.0 82 15.0 83 9.0 84 3.0 85 2.5 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.7250000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393184 spots for SRR2745298.sra Written 1393184 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra Read 1393179 spots for SRR2745298.sra Written 1393179 spots for SRR2745298.sra SRR ids: ['SRR2745298.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s993yq8p SRR2745298.sra spots: 27863585 blocks: [[1, 1393179], [1393180, 2786358], [2786359, 4179537], [4179538, 5572716], [5572717, 6965895], [6965896, 8359074], [8359075, 9752253], [9752254, 11145432], [11145433, 12538611], [12538612, 13931790], [13931791, 15324969], [15324970, 16718148], [16718149, 18111327], [18111328, 19504506], [19504507, 20897685], [20897686, 22290864], [22290865, 23684043], [23684044, 25077222], [25077223, 26470401], [26470402, 27863585]] SRR2745298 file size 4845948 SRR2745298 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745298 SRR2745298_1.fastq Input file: SRR2745298_1.fastq trimmed: SRR2745298-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 09:49:28 2024 >> started Fri Dec 6 09:49:46 2024 >> done (18.382s) 27863585 reads processed; of these: 1371 ( 0.00%) short reads filtered out after trimming by size control 8381 ( 0.03%) empty reads filtered out after trimming by size control 27853833 (99.97%) reads available; of these: 375845 ( 1.35%) trimmed reads available after processing 27477988 (98.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 150 0.00% 19 192 0.00% 20 184 0.00% 21 224 0.00% 22 273 0.00% 23 355 0.00% 24 475 0.00% 25 636 0.00% 26 675 0.00% 27 638 0.00% 28 660 0.00% 29 869 0.00% 30 829 0.00% 31 967 0.00% 32 1083 0.00% 33 1277 0.00% 34 1401 0.01% 35 1649 0.01% 36 1960 0.01% 37 2289 0.01% 38 3119 0.01% 39 4558 0.02% 40 4167 0.01% 41 7355 0.03% 42 6514 0.02% 43 12292 0.04% 44 12190 0.04% 45 14937 0.05% 46 22800 0.08% 47 29308 0.11% 48 42069 0.15% 49 73375 0.26% 50 126375 0.45% 51 27477988 98.65% 27853833 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=140.67 fanout-score-rank=3 prefix-density=0.50 prefix-fanout=20.2 sequence=CGCCGCCGCGGCCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=16 fanout-score=156.00 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=16.0 sequence=GGCGGCGGCGGA Started job on | Dec 06 09:50:24 Started mapping on | Dec 06 09:50:24 Finished on | Dec 06 09:50:45 Mapping speed, Million of reads per hour | 4774.94 Number of input reads | 27853833 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 26558819 Uniquely mapped reads % | 95.35% Average mapped length | 50.81 Number of splices: Total | 3821119 Number of splices: Annotated (sjdb) | 3677584 Number of splices: GT/AG | 3751005 Number of splices: GC/AG | 66850 Number of splices: AT/AC | 1647 Number of splices: Non-canonical | 1617 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521132 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 462112 % of reads mapped to too many loci | 1.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 773882 773882 773882 N_multimapping 521132 521132 521132 N_noFeature 1068330 25888910 1310731 N_ambiguous 466057 1406 38614 UnstrandedReadsAssigned:25024432 PositiveStrandReadsAssigned:668503 NegativeStrandReadsAssigned:25209474 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745298 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745298-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,853,833 reads, 24,809,434 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,302 rounds 52973 SRR2745298.ke.tsv 35125 SRR2745298.se.tsv 88098 total ==> SRR2745298.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 128.726 9.83098 PNS24247 1044 945 59.1264 3.99951 PNS24249 1928 1829 467.965 16.3552 PNS24246 1044 945 59.1264 3.99951 PNS24248 1044 945 59.1264 3.99951 PNS24244 1471 1372 104.93 4.88879 PNS24243 293 194 0 0 KQK14069 1603 1504 41787.7 1776.06 KQK14071 474 375 13754.6 2344.62 ==> SRR2745298.se.tsv <== BRADI_1g14170v3 61624 BRADI_1g53295v3 82 BRADI_1g59795v3 516 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 413 BRADI_1g74790v3 773 BRADI_1g09890v3 0 BRADI_1g77505v3 462 BRADI_1g48960v3 1 SRR2745298 completed mapping pipeline successfully