Starting /dee2/code/volunteer_pipeline.sh SRR2745299 current disk space = 1552299470848 free memory = 1607241924 SRR2745299 SRAfilesize 5cfa278498e1423abc6c45d4f448d647 SRR2745299.sra SRR2745299.sra file validated SRR2745299 is single end SRR2745299 is conventional basespace SRR2745299 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745299_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.905 35.0 35.0 35.0 31.0 35.0 2 33.828 35.0 35.0 35.0 31.0 35.0 3 33.87025 35.0 35.0 35.0 31.0 35.0 4 33.79875 35.0 35.0 35.0 31.0 35.0 5 33.6615 35.0 35.0 35.0 31.0 35.0 6 38.4165 40.0 39.0 40.0 35.0 40.0 7 38.4545 40.0 39.0 40.0 36.0 40.0 8 38.4865 40.0 39.0 40.0 36.0 40.0 9 38.45925 40.0 39.0 40.0 36.0 40.0 10 38.514 40.0 39.0 40.0 36.0 40.0 11 38.51225 40.0 39.0 40.0 36.0 40.0 12 38.53225 40.0 39.0 40.0 36.0 40.0 13 38.4325 40.0 39.0 40.0 35.0 40.0 14 38.44825 40.0 39.0 40.0 36.0 40.0 15 38.34725 40.0 39.0 40.0 36.0 40.0 16 38.4125 40.0 39.0 40.0 36.0 40.0 17 38.40075 40.0 39.0 40.0 36.0 40.0 18 38.40075 40.0 39.0 40.0 35.0 40.0 19 38.499 40.0 39.0 40.0 36.0 40.0 20 38.50675 40.0 39.0 40.0 36.0 40.0 21 38.58025 40.0 39.0 40.0 36.0 40.0 22 38.49425 40.0 39.0 40.0 36.0 40.0 23 38.47875 40.0 39.0 40.0 36.0 40.0 24 38.325 40.0 39.0 40.0 35.0 40.0 25 38.36925 40.0 39.0 40.0 35.0 40.0 26 38.116 40.0 39.0 40.0 34.0 40.0 27 38.35425 40.0 39.0 40.0 35.0 40.0 28 38.379 40.0 39.0 40.0 35.0 40.0 29 38.41925 40.0 39.0 40.0 35.0 40.0 30 38.407 40.0 39.0 40.0 35.0 40.0 31 38.35625 40.0 39.0 40.0 36.0 40.0 32 38.327 40.0 39.0 40.0 35.0 40.0 33 38.4095 40.0 39.0 40.0 36.0 40.0 34 38.31675 40.0 39.0 40.0 35.0 40.0 35 38.22775 40.0 39.0 40.0 35.0 40.0 36 38.32075 40.0 39.0 40.0 35.0 40.0 37 38.324 40.0 39.0 40.0 35.0 40.0 38 38.42 40.0 39.0 40.0 36.0 40.0 39 38.2985 40.0 39.0 40.0 36.0 40.0 40 38.319 40.0 39.0 40.0 36.0 40.0 41 38.2575 40.0 39.0 40.0 35.0 40.0 42 38.14475 40.0 39.0 40.0 35.0 40.0 43 38.276 40.0 39.0 40.0 35.0 40.0 44 38.21875 40.0 39.0 40.0 35.0 40.0 45 38.21575 40.0 39.0 40.0 35.0 40.0 46 37.98775 40.0 39.0 40.0 34.0 40.0 47 37.97975 40.0 39.0 40.0 34.0 40.0 48 38.21825 40.0 39.0 40.0 35.0 40.0 49 38.03675 40.0 39.0 40.0 34.0 40.0 50 38.0315 40.0 39.0 40.0 34.0 40.0 51 37.4035 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 2.0 22 1.0 23 0.0 24 2.0 25 6.0 26 11.0 27 13.0 28 16.0 29 36.0 30 47.0 31 58.0 32 67.0 33 98.0 34 112.0 35 162.0 36 212.0 37 327.0 38 743.0 39 2085.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.425000000000004 11.15 9.55 42.875 2 26.825 17.1 31.775 24.3 3 24.7 22.3 20.474999999999998 32.525 4 28.549999999999997 28.349999999999998 18.15 24.95 5 27.039919658548833 31.031885513432083 22.24453929199096 19.68365553602812 6 22.25 30.7 21.725 25.324999999999996 7 19.8 20.1 37.5 22.6 8 23.0 20.474999999999998 26.275 30.25 9 23.674999999999997 18.25 28.9 29.175 10 22.725 32.15 21.6 23.525 11 27.375 21.6 19.125 31.900000000000002 12 28.050000000000004 18.975 22.35 30.625000000000004 13 24.075 22.825 24.625 28.475 14 24.375 24.7 24.8 26.125 15 25.974999999999998 22.55 24.575 26.900000000000002 16 25.25 22.8 23.525 28.425 17 25.124999999999996 23.175 24.625 27.075 18 24.525 24.0 23.3 28.175 19 25.45 23.925 23.599999999999998 27.025 20 24.7 24.65 24.7 25.95 21 25.8 23.5 24.3 26.400000000000002 22 24.95 24.625 23.1 27.325 23 26.1 24.275 24.05 25.575 24 25.424999999999997 23.325000000000003 23.200000000000003 28.050000000000004 25 26.625 24.175 23.35 25.85 26 26.200000000000003 24.15 22.975 26.674999999999997 27 25.025 23.674999999999997 23.875 27.425 28 24.45 24.675 23.3 27.575 29 26.25 22.75 25.324999999999996 25.674999999999997 30 25.174999999999997 23.150000000000002 24.175 27.500000000000004 31 25.15 24.75 23.175 26.924999999999997 32 25.724999999999998 25.0 23.1 26.174999999999997 33 25.874999999999996 23.225 24.25 26.650000000000002 34 25.5 24.075 22.725 27.700000000000003 35 25.1 25.074999999999996 23.724999999999998 26.1 36 25.3 23.525 24.474999999999998 26.700000000000003 37 26.0 21.975 23.65 28.375 38 26.150000000000002 24.65 23.45 25.75 39 25.05 23.125 24.099999999999998 27.725 40 25.4 23.200000000000003 22.975 28.425 41 25.8 22.900000000000002 23.674999999999997 27.625 42 25.825 22.85 23.799999999999997 27.525 43 26.424999999999997 23.95 22.400000000000002 27.224999999999998 44 26.3 24.099999999999998 23.150000000000002 26.450000000000003 45 24.65 23.25 24.125 27.975 46 27.275 21.975 24.175 26.575 47 25.724999999999998 24.0 24.099999999999998 26.174999999999997 48 26.275 22.900000000000002 24.8 26.025 49 26.474999999999998 23.375 22.175 27.975 50 25.474999999999998 24.525 23.375 26.625 51 26.625 24.025 23.125 26.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 2.0 24 1.0 25 3.0 26 8.5 27 12.0 28 20.5 29 29.0 30 30.0 31 31.0 32 51.0 33 71.0 34 79.5 35 88.0 36 102.0 37 116.0 38 146.0 39 176.0 40 193.5 41 211.0 42 246.5 43 282.0 44 275.5 45 269.0 46 263.0 47 257.0 48 262.5 49 268.0 50 254.0 51 240.0 52 241.0 53 242.0 54 220.0 55 198.0 56 181.0 57 164.0 58 178.0 59 192.0 60 186.5 61 181.0 62 162.5 63 144.0 64 145.5 65 147.0 66 136.0 67 125.0 68 126.0 69 127.0 70 124.5 71 122.0 72 107.0 73 92.0 74 83.5 75 63.0 76 51.0 77 41.0 78 31.0 79 28.5 80 26.0 81 19.0 82 12.0 83 9.0 84 6.0 85 4.5 86 3.0 87 2.5 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.42500000000000004 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231911 spots for SRR2745299.sra Written 1231911 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra Read 1231903 spots for SRR2745299.sra Written 1231903 spots for SRR2745299.sra SRR ids: ['SRR2745299.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_szvjbrbh SRR2745299.sra spots: 24638068 blocks: [[1, 1231903], [1231904, 2463806], [2463807, 3695709], [3695710, 4927612], [4927613, 6159515], [6159516, 7391418], [7391419, 8623321], [8623322, 9855224], [9855225, 11087127], [11087128, 12319030], [12319031, 13550933], [13550934, 14782836], [14782837, 16014739], [16014740, 17246642], [17246643, 18478545], [18478546, 19710448], [19710449, 20942351], [20942352, 22174254], [22174255, 23406157], [23406158, 24638068]] SRR2745299 file size 4283728 SRR2745299 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745299 SRR2745299_1.fastq Input file: SRR2745299_1.fastq trimmed: SRR2745299-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 09:51:08 2024 >> started Fri Dec 6 09:51:22 2024 >> done (14.099s) 24638068 reads processed; of these: 1261 ( 0.01%) short reads filtered out after trimming by size control 9112 ( 0.04%) empty reads filtered out after trimming by size control 24627695 (99.96%) reads available; of these: 349161 ( 1.42%) trimmed reads available after processing 24278534 (98.58%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 124 0.00% 19 155 0.00% 20 157 0.00% 21 233 0.00% 22 245 0.00% 23 349 0.00% 24 486 0.00% 25 605 0.00% 26 566 0.00% 27 573 0.00% 28 674 0.00% 29 813 0.00% 30 760 0.00% 31 853 0.00% 32 1062 0.00% 33 1187 0.00% 34 1358 0.01% 35 1493 0.01% 36 1834 0.01% 37 2173 0.01% 38 2937 0.01% 39 4167 0.02% 40 3823 0.02% 41 6762 0.03% 42 6115 0.02% 43 11214 0.05% 44 11393 0.05% 45 13685 0.06% 46 20748 0.08% 47 27375 0.11% 48 38965 0.16% 49 68760 0.28% 50 117517 0.48% 51 24278534 98.58% 24627695 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=45.08 fanout-score-rank=10 prefix-density=0.38 prefix-fanout=8.8 sequence=TGCTGCTGCTGCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=6 fanout-score=165.18 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=20.2 sequence=CGGCGGCGGCGG Started job on | Dec 06 09:51:39 Started mapping on | Dec 06 09:51:39 Finished on | Dec 06 09:51:58 Mapping speed, Million of reads per hour | 4666.30 Number of input reads | 24627695 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 23585700 Uniquely mapped reads % | 95.77% Average mapped length | 50.81 Number of splices: Total | 3409702 Number of splices: Annotated (sjdb) | 3273343 Number of splices: GT/AG | 3348779 Number of splices: GC/AG | 58059 Number of splices: AT/AC | 1481 Number of splices: Non-canonical | 1383 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 484699 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 378670 % of reads mapped to too many loci | 1.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.67% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 557296 557296 557296 N_multimapping 484699 484699 484699 N_noFeature 1035706 22997198 1271550 N_ambiguous 388819 1246 36265 UnstrandedReadsAssigned:22161175 PositiveStrandReadsAssigned:587256 NegativeStrandReadsAssigned:22277885 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745299 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745299-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,627,695 reads, 21,938,487 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,283 rounds 52973 SRR2745299.ke.tsv 35125 SRR2745299.se.tsv 88098 total ==> SRR2745299.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 89.7974 8.14031 PNS24247 1044 945 86.8844 6.9761 PNS24249 1928 1829 454.153 18.8405 PNS24246 1044 945 86.8844 6.9761 PNS24248 1044 945 86.8844 6.9761 PNS24244 1471 1372 66.3965 3.67192 PNS24243 293 194 0 0 KQK14069 1603 1504 31013.4 1564.6 KQK14071 474 375 11115.1 2248.98 ==> SRR2745299.se.tsv <== BRADI_1g14170v3 46707 BRADI_1g53295v3 110 BRADI_1g59795v3 515 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 295 BRADI_1g74790v3 645 BRADI_1g09890v3 0 BRADI_1g77505v3 366 BRADI_1g48960v3 0 SRR2745299 completed mapping pipeline successfully