Starting /dee2/code/volunteer_pipeline.sh SRR2745300 current disk space = 1552299470848 free memory = 1607246224 SRR2745300 SRAfilesize 35b59a671c841a5b239d4a614db40533 SRR2745300.sra SRR2745300.sra file validated SRR2745300 is single end SRR2745300 is conventional basespace SRR2745300 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745300_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.93725 35.0 35.0 35.0 31.0 35.0 2 33.83675 35.0 35.0 35.0 31.0 35.0 3 33.84625 35.0 35.0 35.0 31.0 35.0 4 33.83 35.0 34.0 35.0 31.0 35.0 5 33.55875 35.0 35.0 35.0 31.0 35.0 6 38.33225 40.0 39.0 40.0 35.0 40.0 7 38.372 40.0 39.0 40.0 35.0 40.0 8 38.51825 40.0 39.0 40.0 36.0 40.0 9 38.42825 40.0 39.0 40.0 36.0 40.0 10 38.45075 40.0 39.0 40.0 36.0 40.0 11 38.53275 40.0 39.0 40.0 36.0 40.0 12 38.54425 40.0 39.0 40.0 36.0 40.0 13 38.5045 40.0 39.0 40.0 36.0 40.0 14 38.4865 40.0 39.0 40.0 36.0 40.0 15 38.39375 40.0 39.0 40.0 35.0 40.0 16 38.48975 40.0 39.0 40.0 36.0 40.0 17 38.479 40.0 39.0 40.0 36.0 40.0 18 38.41225 40.0 39.0 40.0 36.0 40.0 19 38.50825 40.0 39.0 40.0 36.0 40.0 20 38.4355 40.0 39.0 40.0 36.0 40.0 21 38.542 40.0 39.0 40.0 36.0 40.0 22 38.40175 40.0 39.0 40.0 36.0 40.0 23 38.45925 40.0 39.0 40.0 36.0 40.0 24 38.42 40.0 39.0 40.0 35.0 40.0 25 38.32 40.0 39.0 40.0 35.0 40.0 26 38.17975 40.0 39.0 40.0 34.0 40.0 27 38.40125 40.0 39.0 40.0 35.0 40.0 28 38.38825 40.0 39.0 40.0 36.0 40.0 29 38.3685 40.0 39.0 40.0 35.0 40.0 30 38.36525 40.0 39.0 40.0 35.0 40.0 31 38.314 40.0 39.0 40.0 35.0 40.0 32 38.351 40.0 39.0 40.0 35.0 40.0 33 38.29425 40.0 39.0 40.0 35.0 40.0 34 38.308 40.0 39.0 40.0 35.0 40.0 35 38.28 40.0 39.0 40.0 35.0 40.0 36 38.33575 40.0 39.0 40.0 35.0 40.0 37 38.28025 40.0 39.0 40.0 35.0 40.0 38 38.33075 40.0 39.0 40.0 35.0 40.0 39 38.22525 40.0 39.0 40.0 35.0 40.0 40 38.23275 40.0 39.0 40.0 35.0 40.0 41 38.30675 40.0 39.0 40.0 35.0 40.0 42 38.149 40.0 39.0 40.0 35.0 40.0 43 38.223 40.0 39.0 40.0 35.0 40.0 44 38.1 40.0 39.0 40.0 34.0 40.0 45 38.0185 40.0 39.0 40.0 34.0 40.0 46 38.1 40.0 39.0 40.0 35.0 40.0 47 38.19325 40.0 39.0 40.0 35.0 40.0 48 38.2085 40.0 39.0 40.0 35.0 40.0 49 38.12225 40.0 39.0 40.0 35.0 40.0 50 38.17125 40.0 39.0 40.0 35.0 40.0 51 37.3525 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 2.0 20 1.0 21 1.0 22 0.0 23 0.0 24 2.0 25 3.0 26 8.0 27 14.0 28 24.0 29 38.0 30 45.0 31 73.0 32 86.0 33 102.0 34 106.0 35 124.0 36 206.0 37 311.0 38 715.0 39 2138.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.425000000000004 11.325000000000001 9.125 44.125 2 26.424999999999997 16.225 33.5 23.849999999999998 3 23.674999999999997 22.6 21.475 32.25 4 28.925 26.575 19.125 25.374999999999996 5 27.726013598589777 31.075295895240494 21.455552757491816 19.743137748677913 6 22.900000000000002 31.674999999999997 21.8 23.625 7 20.925 18.475 37.824999999999996 22.775000000000002 8 23.025000000000002 20.674999999999997 27.175 29.125 9 21.65 19.950000000000003 30.025000000000002 28.375 10 23.925 32.074999999999996 21.375 22.625 11 26.924999999999997 22.1 19.075 31.900000000000002 12 25.0 18.975 23.775 32.25 13 24.075 23.65 24.7 27.575 14 25.8 22.975 24.55 26.674999999999997 15 25.474999999999998 23.075000000000003 25.6 25.85 16 25.7 22.6 23.9 27.800000000000004 17 25.374999999999996 24.15 23.575 26.900000000000002 18 24.95 23.925 24.125 27.0 19 25.25 25.525 22.95 26.275 20 25.575 23.95 24.7 25.775 21 25.05 24.3 23.35 27.3 22 24.975 25.0 23.474999999999998 26.55 23 25.05 23.849999999999998 23.974999999999998 27.125 24 24.9 23.3 24.425 27.375 25 25.424999999999997 24.224999999999998 23.3 27.05 26 24.975 24.65 24.0 26.375 27 23.45 23.200000000000003 25.2 28.15 28 25.025 23.75 23.974999999999998 27.250000000000004 29 25.05 23.275000000000002 24.099999999999998 27.575 30 24.375 23.925 23.775 27.925 31 24.525 24.375 24.474999999999998 26.625 32 25.75 24.025 23.150000000000002 27.075 33 24.325 24.6 22.625 28.449999999999996 34 24.925 24.85 23.724999999999998 26.5 35 25.35 23.599999999999998 25.05 26.0 36 24.55 24.0 24.525 26.924999999999997 37 26.275 23.775 23.625 26.325 38 25.8 24.425 22.675 27.1 39 24.474999999999998 25.75 22.775000000000002 27.0 40 26.200000000000003 24.175 22.925 26.700000000000003 41 26.25 23.35 24.075 26.325 42 23.974999999999998 23.925 23.65 28.449999999999996 43 25.474999999999998 23.5 23.799999999999997 27.224999999999998 44 25.0 25.5 23.325000000000003 26.174999999999997 45 24.45 24.275 24.025 27.250000000000004 46 26.200000000000003 23.05 23.225 27.525 47 25.0 25.6 23.925 25.474999999999998 48 25.124999999999996 24.625 23.0 27.250000000000004 49 25.2 24.224999999999998 23.875 26.700000000000003 50 25.924999999999997 24.15 23.724999999999998 26.200000000000003 51 25.1 23.150000000000002 24.375 27.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 3.5 24 6.0 25 5.5 26 9.5 27 14.0 28 16.5 29 19.0 30 35.5 31 52.0 32 59.5 33 67.0 34 87.0 35 107.0 36 118.5 37 130.0 38 156.0 39 182.0 40 206.5 41 231.0 42 238.0 43 245.0 44 258.0 45 271.0 46 278.5 47 286.0 48 273.5 49 261.0 50 259.0 51 257.0 52 240.5 53 224.0 54 221.0 55 218.0 56 200.5 57 183.0 58 166.0 59 149.0 60 159.5 61 170.0 62 165.0 63 160.0 64 146.0 65 132.0 66 130.0 67 128.0 68 121.0 69 114.0 70 113.5 71 113.0 72 95.5 73 78.0 74 70.5 75 56.0 76 49.0 77 43.0 78 37.0 79 28.5 80 20.0 81 17.5 82 15.0 83 12.5 84 10.0 85 6.5 86 3.0 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.7250000000000001 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra Read 1293416 spots for SRR2745300.sra Written 1293416 spots for SRR2745300.sra SRR ids: ['SRR2745300.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_feh69tzy SRR2745300.sra spots: 25868320 blocks: [[1, 1293416], [1293417, 2586832], [2586833, 3880248], [3880249, 5173664], [5173665, 6467080], [6467081, 7760496], [7760497, 9053912], [9053913, 10347328], [10347329, 11640744], [11640745, 12934160], [12934161, 14227576], [14227577, 15520992], [15520993, 16814408], [16814409, 18107824], [18107825, 19401240], [19401241, 20694656], [20694657, 21988072], [21988073, 23281488], [23281489, 24574904], [24574905, 25868320]] SRR2745300 file size 4498154 SRR2745300 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745300 SRR2745300_1.fastq Input file: SRR2745300_1.fastq trimmed: SRR2745300-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 09:49:37 2024 >> started Fri Dec 6 09:49:56 2024 >> done (19.111s) 25868320 reads processed; of these: 1216 ( 0.00%) short reads filtered out after trimming by size control 7449 ( 0.03%) empty reads filtered out after trimming by size control 25859655 (99.97%) reads available; of these: 343756 ( 1.33%) trimmed reads available after processing 25515899 (98.67%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 123 0.00% 19 136 0.00% 20 172 0.00% 21 231 0.00% 22 254 0.00% 23 329 0.00% 24 437 0.00% 25 594 0.00% 26 531 0.00% 27 524 0.00% 28 605 0.00% 29 709 0.00% 30 782 0.00% 31 861 0.00% 32 990 0.00% 33 1108 0.00% 34 1209 0.00% 35 1473 0.01% 36 1749 0.01% 37 2113 0.01% 38 2684 0.01% 39 3788 0.01% 40 3700 0.01% 41 6016 0.02% 42 5840 0.02% 43 9894 0.04% 44 10448 0.04% 45 13074 0.05% 46 19755 0.08% 47 26151 0.10% 48 38866 0.15% 49 69168 0.27% 50 119442 0.46% 51 25515899 98.67% 25859655 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=41.98 fanout-score-rank=9 prefix-density=0.35 prefix-fanout=8.3 sequence=TGCTGCTGCTGCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=20 fanout-score=193.95 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=17.6 sequence=GCCGCCGCCACCA Started job on | Dec 06 09:51:07 Started mapping on | Dec 06 09:51:08 Finished on | Dec 06 09:51:31 Mapping speed, Million of reads per hour | 4047.60 Number of input reads | 25859655 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 24648825 Uniquely mapped reads % | 95.32% Average mapped length | 50.81 Number of splices: Total | 3571416 Number of splices: Annotated (sjdb) | 3436708 Number of splices: GT/AG | 3507241 Number of splices: GC/AG | 61179 Number of splices: AT/AC | 1544 Number of splices: Non-canonical | 1452 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 508115 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 412640 % of reads mapped to too many loci | 1.60% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 702715 702715 702715 N_multimapping 508115 508115 508115 N_noFeature 1045036 24046218 1280927 N_ambiguous 404522 1307 37867 UnstrandedReadsAssigned:23199267 PositiveStrandReadsAssigned:601300 NegativeStrandReadsAssigned:23330031 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745300 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745300-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,859,655 reads, 22,997,649 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,283 rounds 52973 SRR2745300.ke.tsv 35125 SRR2745300.se.tsv 88098 total ==> SRR2745300.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 189.382 16.4107 PNS24247 1044 945 72.3982 5.55659 PNS24249 1928 1829 547.958 21.7293 PNS24246 1044 945 72.3982 5.55659 PNS24248 1044 945 72.3982 5.55659 PNS24244 1471 1372 20.4648 1.08185 PNS24243 293 194 0 0 KQK14069 1603 1504 32463 1565.5 KQK14071 474 375 12468.9 2411.62 ==> SRR2745300.se.tsv <== BRADI_1g14170v3 50326 BRADI_1g53295v3 78 BRADI_1g59795v3 511 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 310 BRADI_1g74790v3 661 BRADI_1g09890v3 0 BRADI_1g77505v3 408 BRADI_1g48960v3 0 SRR2745300 completed mapping pipeline successfully