Starting /dee2/code/volunteer_pipeline.sh SRR2745301 current disk space = 1551796133888 free memory = 1597721516 SRR2745301 SRAfilesize 6b8a27c3774512ab861a957346335ff5 SRR2745301.sra SRR2745301.sra file validated SRR2745301 is single end SRR2745301 is conventional basespace SRR2745301 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745301_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.0475 35.0 35.0 35.0 32.0 35.0 2 33.89375 35.0 35.0 35.0 31.0 35.0 3 33.8485 35.0 35.0 35.0 31.0 35.0 4 33.87025 35.0 34.0 35.0 31.0 35.0 5 33.71125 35.0 35.0 35.0 31.0 35.0 6 38.36725 40.0 39.0 40.0 35.0 40.0 7 38.505 40.0 39.0 40.0 36.0 40.0 8 38.582 40.0 39.0 40.0 36.0 40.0 9 38.459 40.0 39.0 40.0 36.0 40.0 10 38.40025 40.0 39.0 40.0 36.0 40.0 11 38.5795 40.0 39.0 40.0 36.0 40.0 12 38.59675 40.0 39.0 40.0 36.0 40.0 13 38.5845 40.0 39.0 40.0 36.0 40.0 14 38.46075 40.0 39.0 40.0 36.0 40.0 15 38.35225 40.0 39.0 40.0 36.0 40.0 16 38.464 40.0 39.0 40.0 36.0 40.0 17 38.474 40.0 39.0 40.0 36.0 40.0 18 38.4525 40.0 39.0 40.0 36.0 40.0 19 38.51225 40.0 39.0 40.0 36.0 40.0 20 38.48375 40.0 39.0 40.0 36.0 40.0 21 38.55175 40.0 39.0 40.0 36.0 40.0 22 38.54375 40.0 39.0 40.0 36.0 40.0 23 38.546 40.0 39.0 40.0 36.0 40.0 24 38.4875 40.0 39.0 40.0 35.0 40.0 25 38.40525 40.0 39.0 40.0 36.0 40.0 26 38.137 40.0 39.0 40.0 34.0 40.0 27 38.39625 40.0 39.0 40.0 35.0 40.0 28 38.40375 40.0 39.0 40.0 35.0 40.0 29 38.49925 40.0 39.0 40.0 36.0 40.0 30 38.45825 40.0 39.0 40.0 36.0 40.0 31 38.47375 40.0 39.0 40.0 36.0 40.0 32 38.454 40.0 39.0 40.0 36.0 40.0 33 38.40025 40.0 39.0 40.0 36.0 40.0 34 38.39575 40.0 39.0 40.0 35.0 40.0 35 38.32725 40.0 39.0 40.0 36.0 40.0 36 38.423 40.0 39.0 40.0 36.0 40.0 37 38.40875 40.0 39.0 40.0 36.0 40.0 38 38.5035 40.0 39.0 40.0 36.0 40.0 39 38.4225 40.0 39.0 40.0 36.0 40.0 40 38.35275 40.0 39.0 40.0 35.0 40.0 41 38.303 40.0 39.0 40.0 35.0 40.0 42 38.3225 40.0 39.0 40.0 35.0 40.0 43 38.3015 40.0 39.0 40.0 35.0 40.0 44 38.2185 40.0 39.0 40.0 35.0 40.0 45 38.1525 40.0 39.0 40.0 35.0 40.0 46 38.14425 40.0 39.0 40.0 35.0 40.0 47 38.00375 40.0 39.0 40.0 34.0 40.0 48 38.14875 40.0 39.0 40.0 34.0 40.0 49 38.1435 40.0 39.0 40.0 35.0 40.0 50 38.20025 40.0 39.0 40.0 35.0 40.0 51 37.5085 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 6.0 26 6.0 27 9.0 28 25.0 29 28.0 30 37.0 31 57.0 32 89.0 33 78.0 34 122.0 35 151.0 36 204.0 37 322.0 38 708.0 39 2151.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.875 12.174999999999999 8.825 45.125 2 24.95 16.8 34.225 24.025 3 24.45 21.925 22.175 31.45 4 26.625 29.225 19.575 24.575 5 27.19276200050264 31.314400603166625 20.834380497612464 20.65845689871827 6 22.125 32.875 21.925 23.075000000000003 7 19.7 19.425 38.275 22.6 8 22.125 19.975 27.35 30.55 9 21.375 19.125 30.8 28.7 10 22.925 33.825 21.3 21.95 11 26.900000000000002 21.75 19.55 31.8 12 26.55 18.825 25.3 29.325000000000003 13 24.2 22.225 24.725 28.849999999999998 14 23.45 24.8 24.925 26.825 15 24.25 24.8 25.124999999999996 25.825 16 25.224999999999998 24.625 22.8 27.35 17 25.825 24.75 23.825 25.6 18 24.425 24.525 24.925 26.125 19 24.3 24.525 23.625 27.55 20 24.825 25.624999999999996 22.275 27.275 21 23.75 23.200000000000003 25.0 28.050000000000004 22 22.75 25.224999999999998 24.625 27.400000000000002 23 24.925 25.324999999999996 25.4 24.349999999999998 24 24.725 24.7 23.7 26.875 25 24.224999999999998 24.6 24.099999999999998 27.075 26 25.624999999999996 24.675 22.75 26.950000000000003 27 24.725 25.05 23.775 26.450000000000003 28 25.650000000000002 24.8 23.225 26.325 29 26.450000000000003 25.5 22.8 25.25 30 24.825 24.9 24.474999999999998 25.8 31 25.275 24.725 22.675 27.325 32 26.200000000000003 24.925 23.525 25.35 33 24.0 24.775 24.65 26.575 34 23.575 25.1 22.975 28.349999999999998 35 25.724999999999998 23.549999999999997 24.975 25.75 36 24.55 24.85 23.549999999999997 27.05 37 25.0 24.2 23.974999999999998 26.825 38 26.525 23.549999999999997 24.0 25.924999999999997 39 25.0 24.325 23.849999999999998 26.825 40 26.0 23.400000000000002 23.3 27.3 41 25.650000000000002 24.025 23.724999999999998 26.6 42 24.95 23.175 23.875 28.000000000000004 43 24.325 24.325 23.974999999999998 27.375 44 25.35 24.75 24.8 25.1 45 24.575 24.224999999999998 23.425 27.775 46 25.124999999999996 24.2 23.825 26.85 47 23.45 26.125 24.075 26.35 48 25.874999999999996 23.9 23.65 26.575 49 25.25 24.45 23.525 26.775 50 25.6 23.5 24.975 25.924999999999997 51 24.85 25.15 22.525000000000002 27.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 2.5 24 3.0 25 4.0 26 9.5 27 14.0 28 19.5 29 25.0 30 36.0 31 47.0 32 54.0 33 61.0 34 78.5 35 96.0 36 116.0 37 136.0 38 170.0 39 204.0 40 206.5 41 209.0 42 225.5 43 242.0 44 272.5 45 303.0 46 312.5 47 322.0 48 309.0 49 296.0 50 289.0 51 282.0 52 256.5 53 231.0 54 213.5 55 196.0 56 186.0 57 176.0 58 174.5 59 173.0 60 159.0 61 145.0 62 147.0 63 149.0 64 132.5 65 116.0 66 113.5 67 111.0 68 105.0 69 99.0 70 97.5 71 96.0 72 85.0 73 74.0 74 68.5 75 59.0 76 55.0 77 44.0 78 33.0 79 27.5 80 22.0 81 14.5 82 7.0 83 5.0 84 3.0 85 2.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396967 spots for SRR2745301.sra Written 1396967 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra Read 1396964 spots for SRR2745301.sra Written 1396964 spots for SRR2745301.sra SRR ids: ['SRR2745301.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gwi8l64m SRR2745301.sra spots: 27939283 blocks: [[1, 1396964], [1396965, 2793928], [2793929, 4190892], [4190893, 5587856], [5587857, 6984820], [6984821, 8381784], [8381785, 9778748], [9778749, 11175712], [11175713, 12572676], [12572677, 13969640], [13969641, 15366604], [15366605, 16763568], [16763569, 18160532], [18160533, 19557496], [19557497, 20954460], [20954461, 22351424], [22351425, 23748388], [23748389, 25145352], [25145353, 26542316], [26542317, 27939283]] SRR2745301 file size 4859144 SRR2745301 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745301 SRR2745301_1.fastq Input file: SRR2745301_1.fastq trimmed: SRR2745301-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 10:04:28 2024 >> started Fri Dec 6 10:04:47 2024 >> done (19.636s) 27939283 reads processed; of these: 1297 ( 0.00%) short reads filtered out after trimming by size control 4771 ( 0.02%) empty reads filtered out after trimming by size control 27933215 (99.98%) reads available; of these: 361500 ( 1.29%) trimmed reads available after processing 27571715 (98.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 118 0.00% 19 159 0.00% 20 155 0.00% 21 187 0.00% 22 296 0.00% 23 331 0.00% 24 465 0.00% 25 646 0.00% 26 589 0.00% 27 571 0.00% 28 647 0.00% 29 800 0.00% 30 755 0.00% 31 905 0.00% 32 1039 0.00% 33 1145 0.00% 34 1338 0.00% 35 1522 0.01% 36 1767 0.01% 37 2154 0.01% 38 2819 0.01% 39 3929 0.01% 40 3894 0.01% 41 6474 0.02% 42 6098 0.02% 43 10354 0.04% 44 11349 0.04% 45 13757 0.05% 46 20610 0.07% 47 27750 0.10% 48 41182 0.15% 49 69945 0.25% 50 127750 0.46% 51 27571715 98.71% 27933215 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=7.27 fanout-score-rank=10 prefix-density=0.12 prefix-fanout=4.4 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=21 fanout-score=302.58 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=22.4 sequence=CGCCGCCGCCGG Started job on | Dec 06 10:05:03 Started mapping on | Dec 06 10:05:03 Finished on | Dec 06 10:05:23 Mapping speed, Million of reads per hour | 5027.98 Number of input reads | 27933215 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 27127461 Uniquely mapped reads % | 97.12% Average mapped length | 50.81 Number of splices: Total | 3889432 Number of splices: Annotated (sjdb) | 3720858 Number of splices: GT/AG | 3831206 Number of splices: GC/AG | 54528 Number of splices: AT/AC | 2057 Number of splices: Non-canonical | 1641 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 638589 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 124430 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.13% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 167165 167165 167165 N_multimapping 638589 638589 638589 N_noFeature 1237792 26456795 1473577 N_ambiguous 478804 1666 44409 UnstrandedReadsAssigned:25410865 PositiveStrandReadsAssigned:669000 NegativeStrandReadsAssigned:25609475 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745301 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745301-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,933,215 reads, 25,348,847 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,248 rounds 52973 SRR2745301.ke.tsv 35125 SRR2745301.se.tsv 88098 total ==> SRR2745301.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 96.0802 7.22535 PNS24247 1044 945 70.8636 4.71999 PNS24249 1928 1829 449.329 15.4633 PNS24246 1044 945 70.8636 4.71999 PNS24248 1044 945 70.8636 4.71999 PNS24244 1471 1372 0 0 PNS24243 293 194 0 0 KQK14069 1603 1504 45572.9 1907.26 KQK14071 474 375 13651.6 2291.41 ==> SRR2745301.se.tsv <== BRADI_1g14170v3 65332 BRADI_1g53295v3 91 BRADI_1g59795v3 1038 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 1308 BRADI_1g74790v3 480 BRADI_1g09890v3 4 BRADI_1g77505v3 575 BRADI_1g48960v3 0 SRR2745301 completed mapping pipeline successfully