Starting /dee2/code/volunteer_pipeline.sh SRR2745302 current disk space = 1551813357568 free memory = 1386177668 SRR2745302 SRAfilesize 5947aa8e1789d19a9906e0d70f203142 SRR2745302.sra SRR2745302.sra file validated SRR2745302 is single end SRR2745302 is conventional basespace SRR2745302 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745302_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.96325 35.0 35.0 35.0 31.0 35.0 2 33.94675 35.0 35.0 35.0 31.0 35.0 3 33.93675 35.0 35.0 35.0 31.0 35.0 4 33.91525 35.0 35.0 35.0 31.0 35.0 5 33.792 35.0 35.0 35.0 31.0 35.0 6 38.41925 40.0 39.0 40.0 35.0 40.0 7 38.558 40.0 39.0 40.0 36.0 40.0 8 38.54175 40.0 39.0 40.0 36.0 40.0 9 38.50025 40.0 39.0 40.0 36.0 40.0 10 38.57 40.0 39.0 40.0 36.0 40.0 11 38.55275 40.0 39.0 40.0 36.0 40.0 12 38.59175 40.0 39.0 40.0 36.0 40.0 13 38.64475 40.0 39.0 40.0 36.0 40.0 14 38.56975 40.0 39.0 40.0 36.0 40.0 15 38.39325 40.0 39.0 40.0 36.0 40.0 16 38.52825 40.0 39.0 40.0 36.0 40.0 17 38.585 40.0 39.0 40.0 36.0 40.0 18 38.557 40.0 39.0 40.0 36.0 40.0 19 38.655 40.0 39.0 40.0 36.0 40.0 20 38.4945 40.0 39.0 40.0 36.0 40.0 21 38.59275 40.0 39.0 40.0 36.0 40.0 22 38.467 40.0 39.0 40.0 36.0 40.0 23 38.5305 40.0 39.0 40.0 36.0 40.0 24 38.43225 40.0 39.0 40.0 36.0 40.0 25 38.3935 40.0 39.0 40.0 36.0 40.0 26 38.12825 40.0 39.0 40.0 34.0 40.0 27 38.413 40.0 39.0 40.0 35.0 40.0 28 38.4635 40.0 39.0 40.0 36.0 40.0 29 38.52425 40.0 39.0 40.0 36.0 40.0 30 38.49725 40.0 39.0 40.0 36.0 40.0 31 38.51775 40.0 39.0 40.0 36.0 40.0 32 38.5205 40.0 39.0 40.0 36.0 40.0 33 38.46475 40.0 39.0 40.0 36.0 40.0 34 38.413 40.0 39.0 40.0 36.0 40.0 35 38.3265 40.0 39.0 40.0 35.0 40.0 36 38.42825 40.0 39.0 40.0 36.0 40.0 37 38.46475 40.0 39.0 40.0 36.0 40.0 38 38.50475 40.0 39.0 40.0 36.0 40.0 39 38.39425 40.0 39.0 40.0 36.0 40.0 40 38.4395 40.0 39.0 40.0 36.0 40.0 41 38.4065 40.0 39.0 40.0 36.0 40.0 42 38.287 40.0 39.0 40.0 35.0 40.0 43 38.404 40.0 39.0 40.0 36.0 40.0 44 38.4165 40.0 39.0 40.0 36.0 40.0 45 38.2675 40.0 39.0 40.0 35.0 40.0 46 38.2095 40.0 39.0 40.0 35.0 40.0 47 38.346 40.0 39.0 40.0 35.0 40.0 48 38.38375 40.0 39.0 40.0 36.0 40.0 49 38.18725 40.0 39.0 40.0 35.0 40.0 50 38.19775 40.0 39.0 40.0 35.0 40.0 51 37.528 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 1.0 24 2.0 25 0.0 26 11.0 27 16.0 28 20.0 29 39.0 30 42.0 31 43.0 32 74.0 33 86.0 34 105.0 35 144.0 36 198.0 37 312.0 38 722.0 39 2183.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 53.625 13.850000000000001 6.075 26.450000000000003 2 27.224999999999998 16.025 30.675 26.075 3 21.95 25.5 24.8 27.750000000000004 4 26.8 30.625000000000004 21.3 21.275 5 26.91631063081176 33.14903242020608 19.979894445840664 19.95476250314149 6 22.900000000000002 32.125 20.200000000000003 24.775 7 19.225 20.5 37.4 22.875 8 20.225 20.9 26.325 32.550000000000004 9 20.775 19.650000000000002 29.725 29.849999999999998 10 23.825 32.6 21.75 21.825 11 27.925 20.825 19.125 32.125 12 25.05 19.75 23.3 31.900000000000002 13 24.349999999999998 23.75 25.525 26.375 14 24.425 24.775 25.0 25.8 15 23.825 24.85 24.65 26.674999999999997 16 26.575 23.799999999999997 23.35 26.275 17 25.4 24.875 22.95 26.775 18 25.15 25.275 24.075 25.5 19 26.325 23.799999999999997 23.974999999999998 25.900000000000002 20 25.05 24.875 23.825 26.25 21 24.725 24.775 23.45 27.05 22 24.4 23.5 24.525 27.575 23 25.5 24.075 24.175 26.25 24 24.9 23.75 24.099999999999998 27.250000000000004 25 26.025 24.95 22.625 26.400000000000002 26 24.7 25.15 24.15 26.0 27 23.825 24.55 24.25 27.375 28 26.075 24.525 22.875 26.525 29 25.525 24.474999999999998 24.3 25.7 30 24.625 23.849999999999998 23.625 27.900000000000002 31 25.6 23.525 24.8 26.075 32 25.6 24.95 24.525 24.925 33 24.375 25.174999999999997 23.0 27.450000000000003 34 25.324999999999996 24.425 24.575 25.674999999999997 35 25.624999999999996 24.224999999999998 24.15 26.0 36 24.775 25.25 23.825 26.150000000000002 37 25.0 24.3 23.25 27.450000000000003 38 24.125 24.224999999999998 25.3 26.35 39 26.424999999999997 23.75 23.974999999999998 25.85 40 25.6 24.325 24.025 26.05 41 24.5 25.224999999999998 23.599999999999998 26.674999999999997 42 25.1 23.925 24.45 26.525 43 26.8 23.525 24.3 25.374999999999996 44 24.8 24.0 24.875 26.325 45 26.150000000000002 24.9 23.9 25.05 46 26.450000000000003 23.1 24.175 26.275 47 27.1 23.525 23.875 25.5 48 25.7 25.124999999999996 22.55 26.625 49 25.724999999999998 24.175 23.9 26.200000000000003 50 24.725 24.55 24.0 26.724999999999998 51 25.45 24.2 23.400000000000002 26.950000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 3.0 21 3.0 22 3.0 23 5.0 24 7.0 25 8.5 26 14.5 27 19.0 28 21.0 29 23.0 30 33.5 31 44.0 32 58.5 33 73.0 34 75.5 35 78.0 36 111.5 37 145.0 38 173.0 39 201.0 40 207.5 41 214.0 42 238.0 43 262.0 44 282.0 45 302.0 46 291.0 47 280.0 48 282.5 49 285.0 50 263.5 51 242.0 52 227.0 53 212.0 54 219.5 55 227.0 56 207.0 57 187.0 58 182.5 59 178.0 60 174.0 61 170.0 62 163.5 63 157.0 64 133.0 65 109.0 66 117.0 67 125.0 68 115.0 69 105.0 70 98.0 71 91.0 72 82.0 73 73.0 74 66.0 75 51.5 76 44.0 77 37.0 78 30.0 79 26.0 80 22.0 81 15.5 82 9.0 83 6.5 84 4.0 85 4.5 86 5.0 87 3.5 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202238 spots for SRR2745302.sra Written 1202238 spots for SRR2745302.sra Read 1202239 spots for SRR2745302.sra Written 1202239 spots for SRR2745302.sra SRR ids: ['SRR2745302.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bj6e38p8 SRR2745302.sra spots: 24044761 blocks: [[1, 1202238], [1202239, 2404476], [2404477, 3606714], [3606715, 4808952], [4808953, 6011190], [6011191, 7213428], [7213429, 8415666], [8415667, 9617904], [9617905, 10820142], [10820143, 12022380], [12022381, 13224618], [13224619, 14426856], [14426857, 15629094], [15629095, 16831332], [16831333, 18033570], [18033571, 19235808], [19235809, 20438046], [20438047, 21640284], [21640285, 22842522], [22842523, 24044761]] SRR2745302 file size 4180284 SRR2745302 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745302 SRR2745302_1.fastq Input file: SRR2745302_1.fastq trimmed: SRR2745302-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 10:04:39 2024 >> started Fri Dec 6 10:04:59 2024 >> done (20.389s) 24044761 reads processed; of these: 1215 ( 0.01%) short reads filtered out after trimming by size control 5909 ( 0.02%) empty reads filtered out after trimming by size control 24037637 (99.97%) reads available; of these: 313472 ( 1.30%) trimmed reads available after processing 23724165 (98.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 114 0.00% 19 145 0.00% 20 126 0.00% 21 204 0.00% 22 220 0.00% 23 286 0.00% 24 398 0.00% 25 548 0.00% 26 501 0.00% 27 526 0.00% 28 598 0.00% 29 716 0.00% 30 676 0.00% 31 805 0.00% 32 894 0.00% 33 1052 0.00% 34 1171 0.00% 35 1251 0.01% 36 1608 0.01% 37 1873 0.01% 38 2596 0.01% 39 3705 0.02% 40 3365 0.01% 41 5886 0.02% 42 5453 0.02% 43 9752 0.04% 44 9959 0.04% 45 12278 0.05% 46 18615 0.08% 47 24447 0.10% 48 35021 0.15% 49 61703 0.26% 50 106980 0.45% 51 23724165 98.70% 24037637 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=98.20 fanout-score-rank=4 prefix-density=0.41 prefix-fanout=15.7 sequence=GGCGGCGGCGGCCTCGAAGCCTGACTTGGTCGCCGGCGGCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=14 fanout-score=222.51 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=21.0 sequence=CGCCGCCGCGGCCG Started job on | Dec 06 10:05:17 Started mapping on | Dec 06 10:05:18 Finished on | Dec 06 10:05:39 Mapping speed, Million of reads per hour | 4120.74 Number of input reads | 24037637 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 23371802 Uniquely mapped reads % | 97.23% Average mapped length | 50.79 Number of splices: Total | 3282095 Number of splices: Annotated (sjdb) | 3153426 Number of splices: GT/AG | 3230128 Number of splices: GC/AG | 48803 Number of splices: AT/AC | 1553 Number of splices: Non-canonical | 1611 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 520254 % of reads mapped to multiple loci | 2.16% Number of reads mapped to too many loci | 107053 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.14% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 145581 145581 145581 N_multimapping 520254 520254 520254 N_noFeature 975282 22781380 1174196 N_ambiguous 429604 1501 38718 UnstrandedReadsAssigned:21966916 PositiveStrandReadsAssigned:588921 NegativeStrandReadsAssigned:22158888 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745302 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745302-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,037,637 reads, 21,897,160 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,255 rounds 52973 SRR2745302.ke.tsv 35125 SRR2745302.se.tsv 88098 total ==> SRR2745302.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 180.945 15.0582 PNS24247 1044 945 26.6238 1.96241 PNS24249 1928 1829 360.197 13.7176 PNS24246 1044 945 26.6238 1.96241 PNS24248 1044 945 26.6238 1.96241 PNS24244 1471 1372 67.9865 3.4516 PNS24243 293 194 0 0 KQK14069 1603 1504 43594 2018.97 KQK14071 474 375 14735.6 2737.08 ==> SRR2745302.se.tsv <== BRADI_1g14170v3 64356 BRADI_1g53295v3 55 BRADI_1g59795v3 718 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 656 BRADI_1g74790v3 559 BRADI_1g09890v3 1 BRADI_1g77505v3 517 BRADI_1g48960v3 0 SRR2745302 completed mapping pipeline successfully