Starting /dee2/code/volunteer_pipeline.sh SRR2745303 current disk space = 1551802195968 free memory = 1377978936 SRR2745303 SRAfilesize a1e7bf5d0aa62922a6e94111ef21dbbb SRR2745303.sra SRR2745303.sra file validated SRR2745303 is single end SRR2745303 is conventional basespace SRR2745303 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745303_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.92325 35.0 35.0 35.0 31.0 35.0 2 33.83725 35.0 35.0 35.0 31.0 35.0 3 33.9275 35.0 35.0 35.0 31.0 35.0 4 33.85625 35.0 34.0 35.0 31.0 35.0 5 33.68925 35.0 35.0 35.0 31.0 35.0 6 38.37725 40.0 39.0 40.0 35.0 40.0 7 38.573 40.0 39.0 40.0 36.0 40.0 8 38.64125 40.0 39.0 40.0 36.0 40.0 9 38.46375 40.0 39.0 40.0 36.0 40.0 10 38.4725 40.0 39.0 40.0 36.0 40.0 11 38.56125 40.0 39.0 40.0 36.0 40.0 12 38.64875 40.0 39.0 40.0 36.0 40.0 13 38.5495 40.0 39.0 40.0 36.0 40.0 14 38.4975 40.0 39.0 40.0 36.0 40.0 15 38.4115 40.0 39.0 40.0 36.0 40.0 16 38.462 40.0 39.0 40.0 35.0 40.0 17 38.532 40.0 39.0 40.0 36.0 40.0 18 38.48525 40.0 39.0 40.0 36.0 40.0 19 38.58575 40.0 39.0 40.0 36.0 40.0 20 38.4775 40.0 39.0 40.0 36.0 40.0 21 38.57725 40.0 39.0 40.0 36.0 40.0 22 38.48225 40.0 39.0 40.0 36.0 40.0 23 38.42425 40.0 39.0 40.0 36.0 40.0 24 38.468 40.0 39.0 40.0 36.0 40.0 25 38.336 40.0 39.0 40.0 36.0 40.0 26 38.138 40.0 39.0 40.0 34.0 40.0 27 38.27425 40.0 39.0 40.0 35.0 40.0 28 38.443 40.0 39.0 40.0 36.0 40.0 29 38.373 40.0 39.0 40.0 35.0 40.0 30 38.327 40.0 39.0 40.0 35.0 40.0 31 38.42275 40.0 39.0 40.0 36.0 40.0 32 38.4725 40.0 39.0 40.0 36.0 40.0 33 38.3725 40.0 39.0 40.0 35.0 40.0 34 38.33125 40.0 39.0 40.0 35.0 40.0 35 38.391 40.0 39.0 40.0 36.0 40.0 36 38.35175 40.0 39.0 40.0 35.0 40.0 37 38.365 40.0 39.0 40.0 36.0 40.0 38 38.418 40.0 39.0 40.0 35.0 40.0 39 38.2155 40.0 39.0 40.0 35.0 40.0 40 38.37775 40.0 39.0 40.0 36.0 40.0 41 38.34825 40.0 39.0 40.0 35.0 40.0 42 38.28025 40.0 39.0 40.0 35.0 40.0 43 38.29425 40.0 39.0 40.0 35.0 40.0 44 38.21675 40.0 39.0 40.0 35.0 40.0 45 38.12125 40.0 39.0 40.0 34.0 40.0 46 38.24675 40.0 39.0 40.0 35.0 40.0 47 38.24225 40.0 39.0 40.0 35.0 40.0 48 38.1065 40.0 39.0 40.0 35.0 40.0 49 38.09075 40.0 39.0 40.0 35.0 40.0 50 38.13375 40.0 39.0 40.0 35.0 40.0 51 37.4455 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 7.0 26 4.0 27 10.0 28 19.0 29 37.0 30 52.0 31 63.0 32 77.0 33 90.0 34 115.0 35 152.0 36 206.0 37 315.0 38 669.0 39 2180.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.55 12.625 9.425 43.4 2 24.9 16.85 33.775 24.474999999999998 3 23.25 22.725 22.25 31.775 4 28.975 28.125 19.55 23.35 5 26.742138364779873 31.069182389937104 21.735849056603772 20.452830188679243 6 21.3 32.775 21.3 24.625 7 19.3 20.549999999999997 38.224999999999994 21.925 8 21.875 20.95 28.000000000000004 29.175 9 21.349999999999998 20.474999999999998 29.575000000000003 28.599999999999998 10 23.849999999999998 33.575 21.175 21.4 11 27.250000000000004 22.650000000000002 19.650000000000002 30.45 12 25.35 19.6 24.6 30.45 13 25.174999999999997 22.6 24.95 27.275 14 23.45 25.1 25.874999999999996 25.575 15 23.75 24.5 23.674999999999997 28.075 16 25.7 24.725 23.325000000000003 26.25 17 25.0 24.925 23.799999999999997 26.275 18 25.1 23.825 23.875 27.200000000000003 19 26.325 23.674999999999997 23.200000000000003 26.8 20 23.75 25.05 24.625 26.575 21 24.25 24.625 24.7 26.424999999999997 22 25.924999999999997 24.5 22.75 26.825 23 23.875 24.9 25.2 26.025 24 25.124999999999996 23.75 23.799999999999997 27.325 25 25.724999999999998 23.974999999999998 22.775000000000002 27.525 26 24.15 24.975 24.025 26.85 27 24.7 23.7 26.224999999999998 25.374999999999996 28 25.224999999999998 23.775 23.425 27.575 29 25.8 23.974999999999998 22.8 27.425 30 23.75 24.975 24.875 26.400000000000002 31 23.875 25.174999999999997 23.175 27.775 32 25.224999999999998 24.275 24.075 26.424999999999997 33 24.525 23.275000000000002 24.3 27.900000000000002 34 24.775 24.75 22.7 27.775 35 24.525 25.5 24.7 25.275 36 24.05 23.375 25.6 26.974999999999998 37 26.275 23.575 23.200000000000003 26.950000000000003 38 24.474999999999998 24.15 23.724999999999998 27.650000000000002 39 25.074999999999996 24.7 23.9 26.325 40 25.35 24.025 23.474999999999998 27.150000000000002 41 24.175 25.2 23.1 27.525 42 23.200000000000003 23.724999999999998 26.174999999999997 26.900000000000002 43 26.375 22.875 24.175 26.575 44 24.425 23.799999999999997 24.85 26.924999999999997 45 24.25 23.65 23.325000000000003 28.775000000000002 46 26.25 24.075 23.1 26.575 47 25.3 24.425 23.775 26.5 48 24.6 25.424999999999997 23.325000000000003 26.650000000000002 49 25.5 24.15 23.375 26.974999999999998 50 24.675 24.2 24.775 26.35 51 25.124999999999996 24.25 24.025 26.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 2.0 26 10.5 27 18.0 28 26.5 29 35.0 30 33.0 31 31.0 32 52.5 33 74.0 34 85.0 35 96.0 36 111.5 37 127.0 38 150.0 39 173.0 40 204.5 41 236.0 42 250.5 43 265.0 44 288.5 45 312.0 46 307.5 47 303.0 48 295.0 49 287.0 50 269.0 51 251.0 52 241.0 53 231.0 54 217.0 55 203.0 56 198.0 57 193.0 58 182.5 59 172.0 60 156.0 61 140.0 62 145.5 63 151.0 64 149.0 65 147.0 66 131.0 67 115.0 68 120.0 69 125.0 70 108.0 71 91.0 72 75.5 73 60.0 74 61.5 75 51.5 76 40.0 77 33.0 78 26.0 79 21.0 80 16.0 81 12.0 82 8.0 83 4.5 84 1.0 85 2.0 86 3.0 87 2.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.625 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552706 spots for SRR2745303.sra Written 1552706 spots for SRR2745303.sra Read 1552719 spots for SRR2745303.sra Written 1552719 spots for SRR2745303.sra SRR ids: ['SRR2745303.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3dy16pn3 SRR2745303.sra spots: 31054133 blocks: [[1, 1552706], [1552707, 3105412], [3105413, 4658118], [4658119, 6210824], [6210825, 7763530], [7763531, 9316236], [9316237, 10868942], [10868943, 12421648], [12421649, 13974354], [13974355, 15527060], [15527061, 17079766], [17079767, 18632472], [18632473, 20185178], [20185179, 21737884], [21737885, 23290590], [23290591, 24843296], [24843297, 26396002], [26396003, 27948708], [27948709, 29501414], [29501415, 31054133]] SRR2745303 file size 5402061 SRR2745303 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745303 SRR2745303_1.fastq Input file: SRR2745303_1.fastq trimmed: SRR2745303-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 10:03:31 2024 >> started Fri Dec 6 10:03:55 2024 >> done (23.747s) 31054133 reads processed; of these: 1399 ( 0.00%) short reads filtered out after trimming by size control 6297 ( 0.02%) empty reads filtered out after trimming by size control 31046437 (99.98%) reads available; of these: 408342 ( 1.32%) trimmed reads available after processing 30638095 (98.68%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 125 0.00% 19 183 0.00% 20 194 0.00% 21 223 0.00% 22 302 0.00% 23 416 0.00% 24 517 0.00% 25 693 0.00% 26 690 0.00% 27 658 0.00% 28 767 0.00% 29 923 0.00% 30 841 0.00% 31 1109 0.00% 32 1191 0.00% 33 1304 0.00% 34 1487 0.00% 35 1753 0.01% 36 2080 0.01% 37 2603 0.01% 38 3343 0.01% 39 4801 0.02% 40 4623 0.01% 41 7940 0.03% 42 7002 0.02% 43 13137 0.04% 44 13281 0.04% 45 16312 0.05% 46 24565 0.08% 47 32217 0.10% 48 45124 0.15% 49 80266 0.26% 50 137672 0.44% 51 30638095 98.68% 31046437 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=7.27 fanout-score-rank=11 prefix-density=0.12 prefix-fanout=4.5 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=5 fanout-score=176.21 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=21.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCAC Started job on | Dec 06 10:04:12 Started mapping on | Dec 06 10:04:12 Finished on | Dec 06 10:04:39 Mapping speed, Million of reads per hour | 4139.52 Number of input reads | 31046437 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 30136140 Uniquely mapped reads % | 97.07% Average mapped length | 50.81 Number of splices: Total | 4226186 Number of splices: Annotated (sjdb) | 4050318 Number of splices: GT/AG | 4163083 Number of splices: GC/AG | 59269 Number of splices: AT/AC | 2153 Number of splices: Non-canonical | 1681 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 715802 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 145432 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.14% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 194495 194495 194495 N_multimapping 715802 715802 715802 N_noFeature 1319807 29396433 1568399 N_ambiguous 539232 1814 48607 UnstrandedReadsAssigned:28277101 PositiveStrandReadsAssigned:737893 NegativeStrandReadsAssigned:28519134 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745303 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745303-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,046,437 reads, 28,209,704 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,271 rounds 52973 SRR2745303.ke.tsv 35125 SRR2745303.se.tsv 88098 total ==> SRR2745303.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 169.242 11.3182 PNS24247 1044 945 92.9991 5.50857 PNS24249 1928 1829 343.397 10.5093 PNS24246 1044 945 92.9991 5.50857 PNS24248 1044 945 92.9991 5.50857 PNS24244 1471 1372 107.364 4.38022 PNS24243 293 194 0 0 KQK14069 1603 1504 52053.9 1937.3 KQK14071 474 375 16773.8 2503.75 ==> SRR2745303.se.tsv <== BRADI_1g14170v3 76305 BRADI_1g53295v3 111 BRADI_1g59795v3 1061 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 1313 BRADI_1g74790v3 464 BRADI_1g09890v3 0 BRADI_1g77505v3 742 BRADI_1g48960v3 1 SRR2745303 completed mapping pipeline successfully