Starting /dee2/code/volunteer_pipeline.sh SRR2745304 current disk space = 1551802195968 free memory = 1377983780 SRR2745304 SRAfilesize 5eebb7672eb4b1b90a184d58f396ff61 SRR2745304.sra SRR2745304.sra file validated SRR2745304 is single end SRR2745304 is conventional basespace SRR2745304 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745304_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.037 35.0 35.0 35.0 31.0 35.0 2 33.925 35.0 35.0 35.0 31.0 35.0 3 33.9065 35.0 35.0 35.0 31.0 35.0 4 33.8815 35.0 35.0 35.0 31.0 35.0 5 33.7545 35.0 35.0 35.0 31.0 35.0 6 38.438 40.0 39.0 40.0 35.0 40.0 7 38.58775 40.0 39.0 40.0 36.0 40.0 8 38.53925 40.0 39.0 40.0 36.0 40.0 9 38.579 40.0 39.0 40.0 36.0 40.0 10 38.5395 40.0 39.0 40.0 36.0 40.0 11 38.5465 40.0 39.0 40.0 36.0 40.0 12 38.58925 40.0 39.0 40.0 36.0 40.0 13 38.496 40.0 39.0 40.0 36.0 40.0 14 38.4995 40.0 39.0 40.0 36.0 40.0 15 38.45875 40.0 39.0 40.0 36.0 40.0 16 38.565 40.0 39.0 40.0 36.0 40.0 17 38.53675 40.0 39.0 40.0 36.0 40.0 18 38.55575 40.0 39.0 40.0 36.0 40.0 19 38.5725 40.0 39.0 40.0 36.0 40.0 20 38.551 40.0 39.0 40.0 36.0 40.0 21 38.583 40.0 39.0 40.0 36.0 40.0 22 38.5115 40.0 39.0 40.0 36.0 40.0 23 38.5045 40.0 39.0 40.0 36.0 40.0 24 38.48325 40.0 39.0 40.0 36.0 40.0 25 38.455 40.0 39.0 40.0 36.0 40.0 26 38.20225 40.0 39.0 40.0 35.0 40.0 27 38.3595 40.0 39.0 40.0 35.0 40.0 28 38.394 40.0 39.0 40.0 35.0 40.0 29 38.36375 40.0 39.0 40.0 36.0 40.0 30 38.531 40.0 39.0 40.0 36.0 40.0 31 38.50425 40.0 39.0 40.0 36.0 40.0 32 38.43625 40.0 39.0 40.0 36.0 40.0 33 38.43025 40.0 39.0 40.0 36.0 40.0 34 38.43975 40.0 39.0 40.0 35.0 40.0 35 38.32375 40.0 39.0 40.0 35.0 40.0 36 38.35875 40.0 39.0 40.0 35.0 40.0 37 38.4195 40.0 39.0 40.0 36.0 40.0 38 38.45975 40.0 39.0 40.0 36.0 40.0 39 38.42 40.0 39.0 40.0 36.0 40.0 40 38.46 40.0 39.0 40.0 36.0 40.0 41 38.377 40.0 39.0 40.0 36.0 40.0 42 38.32725 40.0 39.0 40.0 35.0 40.0 43 38.34625 40.0 39.0 40.0 35.0 40.0 44 38.2895 40.0 39.0 40.0 35.0 40.0 45 38.22175 40.0 39.0 40.0 35.0 40.0 46 38.21975 40.0 39.0 40.0 35.0 40.0 47 38.333 40.0 39.0 40.0 36.0 40.0 48 38.3435 40.0 39.0 40.0 35.0 40.0 49 38.2345 40.0 39.0 40.0 35.0 40.0 50 38.23875 40.0 39.0 40.0 35.0 40.0 51 37.53675 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 0.0 23 1.0 24 1.0 25 8.0 26 8.0 27 14.0 28 27.0 29 27.0 30 44.0 31 53.0 32 79.0 33 73.0 34 106.0 35 145.0 36 194.0 37 312.0 38 670.0 39 2236.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.6 12.0 10.100000000000001 40.300000000000004 2 27.05 17.45 31.574999999999996 23.925 3 24.8 23.425 22.3 29.475 4 28.875 28.625 19.35 23.150000000000002 5 27.56892230576441 30.451127819548873 21.604010025062657 20.37593984962406 6 22.275 32.025 21.525 24.175 7 20.175 19.8 37.2 22.825 8 23.775 20.45 24.825 30.95 9 21.725 19.8 28.675 29.799999999999997 10 24.175 32.525 21.45 21.85 11 27.800000000000004 22.95 18.35 30.9 12 26.474999999999998 20.125 22.375 31.025000000000002 13 25.374999999999996 22.15 24.3 28.175 14 25.275 24.8 23.1 26.825 15 24.05 24.25 22.975 28.725 16 25.724999999999998 24.425 22.875 26.974999999999998 17 25.924999999999997 24.099999999999998 23.674999999999997 26.3 18 24.525 25.55 22.675 27.250000000000004 19 25.650000000000002 23.1 24.375 26.875 20 25.55 24.125 24.099999999999998 26.224999999999998 21 24.575 23.775 25.35 26.3 22 26.25 23.75 23.325000000000003 26.674999999999997 23 26.575 24.125 23.9 25.4 24 24.6 24.325 23.599999999999998 27.474999999999998 25 26.474999999999998 24.2 22.975 26.35 26 25.4 23.724999999999998 24.55 26.325 27 23.799999999999997 24.25 24.099999999999998 27.85 28 24.325 24.175 22.975 28.525 29 25.324999999999996 24.425 23.65 26.6 30 24.525 23.875 23.375 28.225 31 24.775 23.599999999999998 23.724999999999998 27.900000000000002 32 26.35 23.5 24.625 25.525 33 24.575 23.325000000000003 24.15 27.950000000000003 34 25.4 23.325000000000003 24.3 26.974999999999998 35 25.3 24.25 24.349999999999998 26.1 36 24.725 24.125 24.5 26.650000000000002 37 24.825 23.9 23.549999999999997 27.725 38 26.05 24.45 24.325 25.174999999999997 39 25.4 23.325000000000003 23.425 27.85 40 25.974999999999998 23.025000000000002 22.8 28.199999999999996 41 25.05 23.525 24.05 27.375 42 23.849999999999998 23.474999999999998 24.275 28.4 43 25.474999999999998 23.7 22.925 27.900000000000002 44 25.0 24.275 24.075 26.650000000000002 45 25.074999999999996 24.725 22.900000000000002 27.3 46 24.825 24.725 23.0 27.450000000000003 47 25.55 23.25 23.625 27.575 48 23.974999999999998 24.05 24.25 27.725 49 26.6 23.0 23.200000000000003 27.200000000000003 50 25.724999999999998 23.849999999999998 24.975 25.45 51 24.525 23.549999999999997 23.95 27.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 2.0 20 3.0 21 1.5 22 0.0 23 2.5 24 5.0 25 4.5 26 4.5 27 5.0 28 16.0 29 27.0 30 38.0 31 49.0 32 57.5 33 66.0 34 79.5 35 93.0 36 117.5 37 142.0 38 152.5 39 163.0 40 196.5 41 230.0 42 247.0 43 264.0 44 266.0 45 268.0 46 278.0 47 288.0 48 281.0 49 274.0 50 256.5 51 239.0 52 226.0 53 213.0 54 213.5 55 214.0 56 200.0 57 186.0 58 173.5 59 161.0 60 164.0 61 167.0 62 154.0 63 141.0 64 135.0 65 129.0 66 135.5 67 142.0 68 140.0 69 138.0 70 118.5 71 99.0 72 91.0 73 83.0 74 81.0 75 62.0 76 45.0 77 41.5 78 38.0 79 27.5 80 17.0 81 16.0 82 15.0 83 10.0 84 5.0 85 4.5 86 4.0 87 3.0 88 2.0 89 1.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751294 spots for SRR2745304.sra Written 751294 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra Read 751280 spots for SRR2745304.sra Written 751280 spots for SRR2745304.sra SRR ids: ['SRR2745304.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d4mi3fy4 SRR2745304.sra spots: 15025614 blocks: [[1, 751280], [751281, 1502560], [1502561, 2253840], [2253841, 3005120], [3005121, 3756400], [3756401, 4507680], [4507681, 5258960], [5258961, 6010240], [6010241, 6761520], [6761521, 7512800], [7512801, 8264080], [8264081, 9015360], [9015361, 9766640], [9766641, 10517920], [10517921, 11269200], [11269201, 12020480], [12020481, 12771760], [12771761, 13523040], [13523041, 14274320], [14274321, 15025614]] SRR2745304 file size 2608201 SRR2745304 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745304 SRR2745304_1.fastq Input file: SRR2745304_1.fastq trimmed: SRR2745304-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 10:03:00 2024 >> started Fri Dec 6 10:03:11 2024 >> done (11.531s) 15025614 reads processed; of these: 988 ( 0.01%) short reads filtered out after trimming by size control 11409 ( 0.08%) empty reads filtered out after trimming by size control 15013217 (99.92%) reads available; of these: 203269 ( 1.35%) trimmed reads available after processing 14809948 (98.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 108 0.00% 19 93 0.00% 20 107 0.00% 21 124 0.00% 22 160 0.00% 23 202 0.00% 24 267 0.00% 25 350 0.00% 26 309 0.00% 27 351 0.00% 28 401 0.00% 29 449 0.00% 30 461 0.00% 31 507 0.00% 32 545 0.00% 33 641 0.00% 34 744 0.00% 35 796 0.01% 36 1036 0.01% 37 1166 0.01% 38 1599 0.01% 39 2094 0.01% 40 2149 0.01% 41 3566 0.02% 42 3406 0.02% 43 5799 0.04% 44 6399 0.04% 45 7834 0.05% 46 11543 0.08% 47 15610 0.10% 48 23063 0.15% 49 40639 0.27% 50 70751 0.47% 51 14809948 98.65% 15013217 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=104.81 fanout-score-rank=10 prefix-density=0.58 prefix-fanout=17.6 sequence=CGCCGCCGCCGCG criterion=fanout-score sequence-density=0.04 sequence-density-rank=19 fanout-score=218.91 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=19.2 sequence=CGGCGGCGGCGC Started job on | Dec 06 10:03:28 Started mapping on | Dec 06 10:03:28 Finished on | Dec 06 10:03:44 Mapping speed, Million of reads per hour | 3377.97 Number of input reads | 15013217 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 14340231 Uniquely mapped reads % | 95.52% Average mapped length | 50.78 Number of splices: Total | 2071896 Number of splices: Annotated (sjdb) | 1984725 Number of splices: GT/AG | 2033371 Number of splices: GC/AG | 35270 Number of splices: AT/AC | 944 Number of splices: Non-canonical | 2311 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.01% Deletion average length | 1.52 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318483 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 139898 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.40% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 354503 354503 354503 N_multimapping 318483 318483 318483 N_noFeature 664652 13972961 808577 N_ambiguous 245909 755 22695 UnstrandedReadsAssigned:13429670 PositiveStrandReadsAssigned:366515 NegativeStrandReadsAssigned:13508959 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745304 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745304-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,013,217 reads, 13,124,724 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,222 rounds 52973 SRR2745304.ke.tsv 35125 SRR2745304.se.tsv 88098 total ==> SRR2745304.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 167.171 25.1991 PNS24247 1044 945 42.2671 5.64314 PNS24249 1928 1829 342.78 23.6457 PNS24246 1044 945 42.2671 5.64314 PNS24248 1044 945 42.2671 5.64314 PNS24244 1471 1372 50.2479 4.62077 PNS24243 293 194 0 0 KQK14069 1603 1504 19671.8 1650.24 KQK14071 474 375 6952.12 2339.03 ==> SRR2745304.se.tsv <== BRADI_1g14170v3 29543 BRADI_1g53295v3 108 BRADI_1g59795v3 424 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 223 BRADI_1g74790v3 419 BRADI_1g09890v3 0 BRADI_1g77505v3 260 BRADI_1g48960v3 0 SRR2745304 completed mapping pipeline successfully