Starting /dee2/code/volunteer_pipeline.sh SRR2745305 current disk space = 1551954968576 free memory = 1604054772 SRR2745305 SRAfilesize b353e52e6b42b2d5d5b497854c6b5484 SRR2745305.sra SRR2745305.sra file validated SRR2745305 is single end SRR2745305 is conventional basespace SRR2745305 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745305_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.94375 35.0 35.0 35.0 31.0 35.0 2 33.9875 35.0 35.0 35.0 31.0 35.0 3 33.88125 35.0 35.0 35.0 31.0 35.0 4 33.815 35.0 35.0 35.0 31.0 35.0 5 33.754 35.0 35.0 35.0 31.0 35.0 6 38.42825 40.0 39.0 40.0 35.0 40.0 7 38.4735 40.0 39.0 40.0 36.0 40.0 8 38.51675 40.0 39.0 40.0 36.0 40.0 9 38.4615 40.0 39.0 40.0 36.0 40.0 10 38.4945 40.0 39.0 40.0 36.0 40.0 11 38.50275 40.0 39.0 40.0 36.0 40.0 12 38.48825 40.0 39.0 40.0 36.0 40.0 13 38.4485 40.0 39.0 40.0 36.0 40.0 14 38.459 40.0 39.0 40.0 36.0 40.0 15 38.3695 40.0 39.0 40.0 35.0 40.0 16 38.50525 40.0 39.0 40.0 36.0 40.0 17 38.4695 40.0 39.0 40.0 36.0 40.0 18 38.40475 40.0 39.0 40.0 35.0 40.0 19 38.53775 40.0 39.0 40.0 36.0 40.0 20 38.3905 40.0 39.0 40.0 36.0 40.0 21 38.4835 40.0 39.0 40.0 36.0 40.0 22 38.45925 40.0 39.0 40.0 36.0 40.0 23 38.4885 40.0 39.0 40.0 36.0 40.0 24 38.49 40.0 39.0 40.0 36.0 40.0 25 38.375 40.0 39.0 40.0 35.0 40.0 26 38.086 40.0 39.0 40.0 35.0 40.0 27 38.304 40.0 39.0 40.0 35.0 40.0 28 38.2965 40.0 39.0 40.0 35.0 40.0 29 38.31225 40.0 39.0 40.0 35.0 40.0 30 38.382 40.0 39.0 40.0 36.0 40.0 31 38.4295 40.0 39.0 40.0 36.0 40.0 32 38.39675 40.0 39.0 40.0 36.0 40.0 33 38.3415 40.0 39.0 40.0 36.0 40.0 34 38.293 40.0 39.0 40.0 35.0 40.0 35 38.31 40.0 39.0 40.0 35.0 40.0 36 38.338 40.0 39.0 40.0 35.0 40.0 37 38.267 40.0 39.0 40.0 35.0 40.0 38 38.34375 40.0 39.0 40.0 35.0 40.0 39 38.30825 40.0 39.0 40.0 35.0 40.0 40 38.24775 40.0 39.0 40.0 35.0 40.0 41 38.25875 40.0 39.0 40.0 35.0 40.0 42 38.25375 40.0 39.0 40.0 35.0 40.0 43 38.25725 40.0 39.0 40.0 35.0 40.0 44 38.19275 40.0 39.0 40.0 35.0 40.0 45 38.13925 40.0 39.0 40.0 35.0 40.0 46 38.0665 40.0 39.0 40.0 34.0 40.0 47 38.1155 40.0 39.0 40.0 34.0 40.0 48 38.12475 40.0 39.0 40.0 35.0 40.0 49 38.1395 40.0 39.0 40.0 35.0 40.0 50 38.09075 40.0 39.0 40.0 35.0 40.0 51 37.35775 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 0.0 21 1.0 22 0.0 23 2.0 24 3.0 25 8.0 26 12.0 27 13.0 28 19.0 29 35.0 30 51.0 31 59.0 32 67.0 33 87.0 34 122.0 35 144.0 36 193.0 37 299.0 38 694.0 39 2186.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.324999999999996 12.075 9.525 40.075 2 26.0 17.825 31.55 24.625 3 24.099999999999998 23.175 21.6 31.125000000000004 4 28.175 29.375 19.075 23.375 5 27.660642570281123 31.275100401606426 21.536144578313255 19.5281124497992 6 21.125 32.475 22.25 24.15 7 19.125 19.2 37.775 23.9 8 20.674999999999997 20.375 27.400000000000002 31.55 9 20.95 19.2 29.349999999999998 30.5 10 23.599999999999998 31.55 21.15 23.7 11 28.349999999999998 21.925 18.05 31.674999999999997 12 26.25 20.525 23.525 29.7 13 24.525 22.925 23.849999999999998 28.7 14 24.725 23.625 24.95 26.700000000000003 15 23.05 24.5 24.925 27.525 16 24.6 24.95 23.525 26.924999999999997 17 25.324999999999996 24.675 24.05 25.95 18 24.725 24.05 24.175 27.05 19 27.425 23.375 22.675 26.525 20 24.975 24.325 23.474999999999998 27.224999999999998 21 24.325 24.3 23.45 27.925 22 25.025 24.425 23.200000000000003 27.35 23 25.3 23.95 24.275 26.474999999999998 24 25.174999999999997 24.525 24.25 26.05 25 25.924999999999997 24.099999999999998 22.725 27.250000000000004 26 24.125 24.6 23.724999999999998 27.55 27 25.025 24.15 25.124999999999996 25.7 28 25.85 23.925 24.025 26.200000000000003 29 25.5 25.624999999999996 22.925 25.95 30 23.974999999999998 25.324999999999996 24.375 26.325 31 25.85 24.349999999999998 22.55 27.250000000000004 32 25.25 24.8 24.075 25.874999999999996 33 25.3 23.05 23.1 28.549999999999997 34 25.45 24.0 22.725 27.825 35 25.724999999999998 24.349999999999998 23.849999999999998 26.075 36 25.6 23.775 22.825 27.800000000000004 37 26.724999999999998 24.425 22.5 26.35 38 25.7 22.95 24.5 26.85 39 24.95 23.875 23.599999999999998 27.575 40 25.575 24.275 22.925 27.224999999999998 41 26.200000000000003 23.375 24.25 26.174999999999997 42 24.875 23.325000000000003 23.474999999999998 28.325 43 25.174999999999997 23.599999999999998 24.7 26.525 44 25.374999999999996 24.3 24.25 26.075 45 25.324999999999996 24.425 23.125 27.125 46 26.075 23.425 22.925 27.575 47 26.450000000000003 24.725 23.0 25.825 48 25.074999999999996 23.75 24.0 27.175 49 25.85 23.5 22.95 27.700000000000003 50 25.8 25.074999999999996 23.1 26.025 51 25.424999999999997 24.125 24.175 26.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 2.0 22 4.0 23 2.5 24 1.0 25 4.5 26 10.0 27 12.0 28 15.0 29 18.0 30 30.5 31 43.0 32 51.5 33 60.0 34 76.0 35 92.0 36 107.0 37 122.0 38 155.5 39 189.0 40 207.0 41 225.0 42 246.5 43 268.0 44 286.5 45 305.0 46 293.5 47 282.0 48 268.0 49 254.0 50 249.5 51 245.0 52 231.0 53 217.0 54 212.5 55 208.0 56 200.0 57 192.0 58 177.0 59 162.0 60 165.0 61 168.0 62 161.5 63 155.0 64 154.5 65 154.0 66 149.0 67 144.0 68 129.5 69 115.0 70 103.0 71 91.0 72 87.5 73 84.0 74 71.0 75 53.5 76 49.0 77 45.5 78 42.0 79 28.5 80 15.0 81 12.0 82 9.0 83 6.0 84 3.0 85 3.5 86 4.0 87 2.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.4 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.3264691109994977 0.65 3 0.025113008538422906 0.075 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089981 spots for SRR2745305.sra Written 1089981 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra Read 1089963 spots for SRR2745305.sra Written 1089963 spots for SRR2745305.sra SRR ids: ['SRR2745305.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kdt1ar14 SRR2745305.sra spots: 21799278 blocks: [[1, 1089963], [1089964, 2179926], [2179927, 3269889], [3269890, 4359852], [4359853, 5449815], [5449816, 6539778], [6539779, 7629741], [7629742, 8719704], [8719705, 9809667], [9809668, 10899630], [10899631, 11989593], [11989594, 13079556], [13079557, 14169519], [14169520, 15259482], [15259483, 16349445], [16349446, 17439408], [17439409, 18529371], [18529372, 19619334], [19619335, 20709297], [20709298, 21799278]] SRR2745305 file size 3788892 SRR2745305 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745305 SRR2745305_1.fastq Input file: SRR2745305_1.fastq trimmed: SRR2745305-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 10:04:21 2024 >> started Fri Dec 6 10:04:33 2024 >> done (11.798s) 21799278 reads processed; of these: 1751 ( 0.01%) short reads filtered out after trimming by size control 15423 ( 0.07%) empty reads filtered out after trimming by size control 21782104 (99.92%) reads available; of these: 300223 ( 1.38%) trimmed reads available after processing 21481881 (98.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 181 0.00% 19 212 0.00% 20 202 0.00% 21 251 0.00% 22 329 0.00% 23 364 0.00% 24 478 0.00% 25 598 0.00% 26 557 0.00% 27 546 0.00% 28 640 0.00% 29 762 0.00% 30 719 0.00% 31 911 0.00% 32 1019 0.00% 33 1155 0.01% 34 1233 0.01% 35 1322 0.01% 36 1694 0.01% 37 1917 0.01% 38 2649 0.01% 39 3772 0.02% 40 3340 0.02% 41 6012 0.03% 42 5202 0.02% 43 9739 0.04% 44 9783 0.04% 45 11894 0.05% 46 18190 0.08% 47 23612 0.11% 48 33597 0.15% 49 56396 0.26% 50 100947 0.46% 51 21481881 98.62% 21782104 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=119.85 fanout-score-rank=5 prefix-density=0.52 prefix-fanout=18.5 sequence=CGCCGCCGCCGCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=203.17 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=14.9 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGAT Started job on | Dec 06 10:04:44 Started mapping on | Dec 06 10:04:45 Finished on | Dec 06 10:05:04 Mapping speed, Million of reads per hour | 4127.14 Number of input reads | 21782104 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 20777061 Uniquely mapped reads % | 95.39% Average mapped length | 50.78 Number of splices: Total | 2894304 Number of splices: Annotated (sjdb) | 2775300 Number of splices: GT/AG | 2838859 Number of splices: GC/AG | 51188 Number of splices: AT/AC | 1302 Number of splices: Non-canonical | 2955 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 1.51 Insertion rate per base | 0.00% Insertion average length | 1.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454072 % of reads mapped to multiple loci | 2.08% Number of reads mapped to too many loci | 269702 % of reads mapped to too many loci | 1.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.25% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 550971 550971 550971 N_multimapping 454072 454072 454072 N_noFeature 928884 20222618 1136909 N_ambiguous 379123 1147 32961 UnstrandedReadsAssigned:19469054 PositiveStrandReadsAssigned:553296 NegativeStrandReadsAssigned:19607191 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745305 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745305-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,782,104 reads, 19,124,758 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,264 rounds 52973 SRR2745305.ke.tsv 35125 SRR2745305.se.tsv 88098 total ==> SRR2745305.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 154.378 15.6711 PNS24247 1044 945 98.7553 8.87908 PNS24249 1928 1829 393.29 18.27 PNS24246 1044 945 98.7553 8.87908 PNS24248 1044 945 98.7553 8.87908 PNS24244 1471 1372 79.0665 4.89641 PNS24243 293 194 0 0 KQK14069 1603 1504 31369 1772.12 KQK14071 474 375 10103.8 2289.25 ==> SRR2745305.se.tsv <== BRADI_1g14170v3 46094 BRADI_1g53295v3 151 BRADI_1g59795v3 607 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 294 BRADI_1g74790v3 586 BRADI_1g09890v3 0 BRADI_1g77505v3 381 BRADI_1g48960v3 0 SRR2745305 completed mapping pipeline successfully