Starting /dee2/code/volunteer_pipeline.sh SRR2745306 current disk space = 1552029663232 free memory = 1605650140 SRR2745306 SRAfilesize f8a951e00d8ff91fc1482554a506cf01 SRR2745306.sra SRR2745306.sra file validated SRR2745306 is single end SRR2745306 is conventional basespace SRR2745306 read1 length is 51 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR2745306_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 51 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.9655 35.0 35.0 35.0 31.0 35.0 2 33.8645 35.0 35.0 35.0 31.0 35.0 3 33.909 35.0 35.0 35.0 31.0 35.0 4 33.849 35.0 35.0 35.0 31.0 35.0 5 33.6875 35.0 35.0 35.0 31.0 35.0 6 38.34 40.0 39.0 40.0 35.0 40.0 7 38.44675 40.0 39.0 40.0 36.0 40.0 8 38.54625 40.0 39.0 40.0 36.0 40.0 9 38.509 40.0 39.0 40.0 36.0 40.0 10 38.492 40.0 39.0 40.0 36.0 40.0 11 38.51 40.0 39.0 40.0 36.0 40.0 12 38.55025 40.0 39.0 40.0 36.0 40.0 13 38.5065 40.0 39.0 40.0 36.0 40.0 14 38.45 40.0 39.0 40.0 36.0 40.0 15 38.369 40.0 39.0 40.0 36.0 40.0 16 38.54525 40.0 39.0 40.0 36.0 40.0 17 38.515 40.0 39.0 40.0 36.0 40.0 18 38.351 40.0 39.0 40.0 36.0 40.0 19 38.5295 40.0 39.0 40.0 36.0 40.0 20 38.42225 40.0 39.0 40.0 36.0 40.0 21 38.5115 40.0 39.0 40.0 36.0 40.0 22 38.39875 40.0 39.0 40.0 36.0 40.0 23 38.41125 40.0 39.0 40.0 36.0 40.0 24 38.40775 40.0 39.0 40.0 36.0 40.0 25 38.39275 40.0 39.0 40.0 35.0 40.0 26 38.13225 40.0 39.0 40.0 35.0 40.0 27 38.36975 40.0 39.0 40.0 35.0 40.0 28 38.3895 40.0 39.0 40.0 36.0 40.0 29 38.328 40.0 39.0 40.0 35.0 40.0 30 38.39725 40.0 39.0 40.0 36.0 40.0 31 38.315 40.0 39.0 40.0 35.0 40.0 32 38.27475 40.0 39.0 40.0 35.0 40.0 33 38.3575 40.0 39.0 40.0 35.0 40.0 34 38.29575 40.0 39.0 40.0 35.0 40.0 35 38.27125 40.0 39.0 40.0 35.0 40.0 36 38.27325 40.0 39.0 40.0 35.0 40.0 37 38.157 40.0 39.0 40.0 35.0 40.0 38 38.273 40.0 39.0 40.0 35.0 40.0 39 38.2965 40.0 39.0 40.0 35.0 40.0 40 38.247 40.0 39.0 40.0 35.0 40.0 41 38.235 40.0 39.0 40.0 35.0 40.0 42 38.20475 40.0 39.0 40.0 35.0 40.0 43 38.15075 40.0 39.0 40.0 34.0 40.0 44 38.281 40.0 39.0 40.0 35.0 40.0 45 38.14075 40.0 39.0 40.0 35.0 40.0 46 38.04275 40.0 39.0 40.0 34.0 40.0 47 38.1375 40.0 39.0 40.0 34.0 40.0 48 38.138 40.0 39.0 40.0 35.0 40.0 49 38.18975 40.0 39.0 40.0 35.0 40.0 50 38.17025 40.0 39.0 40.0 35.0 40.0 51 37.5185 39.0 38.0 40.0 34.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 1.0 25 6.0 26 11.0 27 18.0 28 22.0 29 23.0 30 44.0 31 54.0 32 72.0 33 106.0 34 118.0 35 152.0 36 214.0 37 299.0 38 661.0 39 2191.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.875 13.225000000000001 8.3 42.6 2 24.125 17.625 33.75 24.5 3 22.85 21.875 22.7 32.574999999999996 4 27.775 28.525 18.975 24.725 5 27.583605732964543 32.00905204928338 20.241387980890117 20.165954236861953 6 22.175 33.0 22.35 22.475 7 18.8 20.625 37.925 22.650000000000002 8 21.675 20.75 26.900000000000002 30.675 9 20.075000000000003 20.45 30.775000000000002 28.7 10 23.225 34.475 20.974999999999998 21.325 11 26.275 23.400000000000002 19.875 30.45 12 27.500000000000004 19.35 23.025000000000002 30.125 13 23.25 23.425 25.924999999999997 27.400000000000002 14 23.95 25.275 24.275 26.5 15 25.124999999999996 23.525 23.35 28.000000000000004 16 24.0 24.9 24.15 26.950000000000003 17 25.45 24.2 24.15 26.200000000000003 18 23.925 24.575 24.45 27.05 19 24.7 25.5 23.674999999999997 26.125 20 25.924999999999997 24.375 24.224999999999998 25.474999999999998 21 24.875 24.425 24.375 26.325 22 25.650000000000002 23.849999999999998 23.525 26.974999999999998 23 24.474999999999998 25.85 24.075 25.6 24 26.1 23.925 24.425 25.55 25 24.9 24.075 23.9 27.125 26 25.4 25.5 23.75 25.35 27 24.75 24.375 23.575 27.3 28 24.825 24.975 23.625 26.575 29 25.424999999999997 24.6 23.625 26.35 30 25.5 23.425 24.6 26.474999999999998 31 24.75 24.05 24.2 27.0 32 26.125 24.7 23.849999999999998 25.324999999999996 33 24.474999999999998 23.45 25.174999999999997 26.900000000000002 34 24.6 24.25 23.474999999999998 27.675 35 24.099999999999998 23.875 25.924999999999997 26.1 36 24.025 24.925 24.075 26.974999999999998 37 25.874999999999996 24.099999999999998 23.35 26.674999999999997 38 24.75 24.6 23.825 26.825 39 24.224999999999998 24.575 24.2 27.0 40 25.324999999999996 24.925 21.65 28.1 41 25.5 24.375 24.725 25.4 42 23.724999999999998 25.5 24.075 26.700000000000003 43 25.775 24.349999999999998 22.35 27.525 44 25.2 24.5 24.05 26.25 45 23.9 23.875 24.8 27.425 46 24.525 23.799999999999997 23.175 28.499999999999996 47 25.025 24.325 23.225 27.425 48 24.4 24.525 24.075 27.0 49 25.45 23.25 24.2 27.1 50 25.0 24.3 24.224999999999998 26.474999999999998 51 25.424999999999997 23.45 23.474999999999998 27.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 3.0 23 4.5 24 6.0 25 8.0 26 15.0 27 20.0 28 22.5 29 25.0 30 31.0 31 37.0 32 51.0 33 65.0 34 86.0 35 107.0 36 118.5 37 130.0 38 158.0 39 186.0 40 217.0 41 248.0 42 253.0 43 258.0 44 282.5 45 307.0 46 296.5 47 286.0 48 285.5 49 285.0 50 259.0 51 233.0 52 233.0 53 233.0 54 224.5 55 216.0 56 196.5 57 177.0 58 168.0 59 159.0 60 168.0 61 177.0 62 166.0 63 155.0 64 141.0 65 127.0 66 121.0 67 115.0 68 103.5 69 92.0 70 92.0 71 92.0 72 88.5 73 85.0 74 77.0 75 53.5 76 38.0 77 32.5 78 27.0 79 19.0 80 11.0 81 11.0 82 11.0 83 8.0 84 5.0 85 4.5 86 4.0 87 2.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.575 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 51 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.025 0.0 0.0 0.0 36 0.0 0.025 0.0 0.0 0.0 37 0.0 0.025 0.0 0.0 0.0 38 0.0 0.025 0.0 0.0 0.0 39 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277589 spots for SRR2745306.sra Written 1277589 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra Read 1277586 spots for SRR2745306.sra Written 1277586 spots for SRR2745306.sra SRR ids: ['SRR2745306.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e5y5iuim SRR2745306.sra spots: 25551723 blocks: [[1, 1277586], [1277587, 2555172], [2555173, 3832758], [3832759, 5110344], [5110345, 6387930], [6387931, 7665516], [7665517, 8943102], [8943103, 10220688], [10220689, 11498274], [11498275, 12775860], [12775861, 14053446], [14053447, 15331032], [15331033, 16608618], [16608619, 17886204], [17886205, 19163790], [19163791, 20441376], [20441377, 21718962], [21718963, 22996548], [22996549, 24274134], [24274135, 25551723]] SRR2745306 file size 4442968 SRR2745306 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR2745306 SRR2745306_1.fastq Input file: SRR2745306_1.fastq trimmed: SRR2745306-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Fri Dec 6 10:04:24 2024 >> started Fri Dec 6 10:04:38 2024 >> done (13.923s) 25551723 reads processed; of these: 892 ( 0.00%) short reads filtered out after trimming by size control 2279 ( 0.01%) empty reads filtered out after trimming by size control 25548552 (99.99%) reads available; of these: 331111 ( 1.30%) trimmed reads available after processing 25217441 (98.70%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 100 0.00% 19 132 0.00% 20 143 0.00% 21 166 0.00% 22 275 0.00% 23 303 0.00% 24 459 0.00% 25 526 0.00% 26 533 0.00% 27 554 0.00% 28 565 0.00% 29 816 0.00% 30 688 0.00% 31 879 0.00% 32 951 0.00% 33 1056 0.00% 34 1199 0.00% 35 1397 0.01% 36 1655 0.01% 37 2029 0.01% 38 2803 0.01% 39 3929 0.02% 40 3540 0.01% 41 6327 0.02% 42 5624 0.02% 43 10522 0.04% 44 10492 0.04% 45 13196 0.05% 46 19929 0.08% 47 26102 0.10% 48 36719 0.14% 49 64835 0.25% 50 112667 0.44% 51 25217441 98.70% 25548552 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=111.02 fanout-score-rank=9 prefix-density=0.49 prefix-fanout=17.7 sequence=CGCCGCCGCCGCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=329.91 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=17.7 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACG Started job on | Dec 06 10:04:56 Started mapping on | Dec 06 10:04:56 Finished on | Dec 06 10:05:21 Mapping speed, Million of reads per hour | 3678.99 Number of input reads | 25548552 Average input read length | 50 UNIQUE READS: Uniquely mapped reads number | 24302379 Uniquely mapped reads % | 95.12% Average mapped length | 50.79 Number of splices: Total | 3579131 Number of splices: Annotated (sjdb) | 3435519 Number of splices: GT/AG | 3513504 Number of splices: GC/AG | 60900 Number of splices: AT/AC | 1655 Number of splices: Non-canonical | 3072 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 554523 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 385696 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.15% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 691650 691650 691650 N_multimapping 554523 554523 554523 N_noFeature 1179932 23689637 1416881 N_ambiguous 415513 1308 39866 UnstrandedReadsAssigned:22706934 PositiveStrandReadsAssigned:611434 NegativeStrandReadsAssigned:22845632 Dataset is classified negative stranded MeadianReadLen=51 20thPercentileLength=51 echo kmer=47 SRR2745306 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR2745306-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,548,552 reads, 22,263,507 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52973 SRR2745306.ke.tsv 35125 SRR2745306.se.tsv 88098 total ==> SRR2745306.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 175.668 15.8838 PNS24247 1044 945 84.7403 6.78647 PNS24249 1928 1829 550.785 22.7905 PNS24246 1044 945 84.7403 6.78647 PNS24248 1044 945 84.7403 6.78647 PNS24244 1471 1372 31.3254 1.72794 PNS24243 293 194 0 0 KQK14069 1603 1504 32932.1 1657.13 KQK14071 474 375 11185.3 2257.37 ==> SRR2745306.se.tsv <== BRADI_1g14170v3 49238 BRADI_1g53295v3 150 BRADI_1g59795v3 674 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 341 BRADI_1g74790v3 704 BRADI_1g09890v3 0 BRADI_1g77505v3 472 BRADI_1g48960v3 0 SRR2745306 completed mapping pipeline successfully