Starting /dee2/code/volunteer_pipeline.sh SRR28040800 current disk space = 1551068438528 free memory = 1595477476 SRR28040800 SRAfilesize 1c66b53632133b1cb34b5c84b06d34fa SRR28040800.sra SRR28040800.sra file validated SRR28040800 is paired end SRR28040800 is conventional basespace SRR28040800 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040800_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87925 34.0 31.0 34.0 31.0 34.0 2 32.9755 34.0 31.0 34.0 31.0 34.0 3 33.06275 34.0 31.0 34.0 31.0 34.0 4 36.4165 37.0 37.0 37.0 35.0 37.0 5 36.266 37.0 37.0 37.0 35.0 37.0 6 36.27125 37.0 37.0 37.0 35.0 37.0 7 36.31125 37.0 37.0 37.0 35.0 37.0 8 36.318 37.0 37.0 37.0 35.0 37.0 9 38.078 39.0 39.0 39.0 35.0 39.0 10-11 38.11325 39.0 39.0 39.0 36.0 39.0 12-13 38.030874999999995 39.0 38.5 39.0 35.0 39.0 14-15 39.43875 41.0 39.0 41.0 36.5 41.0 16-17 39.396125 41.0 39.0 41.0 36.0 41.0 18-19 39.3805 41.0 39.0 41.0 36.0 41.0 20-21 39.341375 41.0 39.0 41.0 36.0 41.0 22-23 39.2945 41.0 39.0 41.0 36.0 41.0 24-25 39.269125 41.0 39.0 41.0 36.0 41.0 26-27 39.088375 41.0 39.0 41.0 35.0 41.0 28-29 38.92075 40.0 38.0 41.0 35.0 41.0 30-31 38.807625 40.0 38.0 41.0 34.5 41.0 32-33 38.47025 40.0 38.0 41.0 34.0 41.0 34-35 38.3675 40.0 38.0 41.0 34.0 41.0 36-37 38.105625 40.0 37.5 41.0 33.0 41.0 38-39 37.835375 40.0 37.0 41.0 33.0 41.0 40-41 37.61425 40.0 36.5 41.0 32.5 41.0 42-43 37.351124999999996 40.0 36.0 41.0 31.0 41.0 44-45 37.0 39.0 35.0 41.0 31.0 41.0 46-47 36.848124999999996 39.0 35.0 41.0 31.0 41.0 48-49 36.73125 39.0 35.0 41.0 30.5 41.0 50-51 36.861999999999995 39.0 35.0 41.0 31.0 41.0 52-53 36.628249999999994 39.0 35.0 41.0 31.0 41.0 54-55 36.449375 38.5 35.0 41.0 31.0 41.0 56-57 36.189875 38.0 35.0 40.5 31.0 41.0 58-59 35.91 37.5 35.0 40.0 30.0 41.0 60-61 35.73425 37.0 35.0 40.0 30.0 41.0 62-63 35.349375 36.5 34.0 40.0 29.5 41.0 64-65 34.985749999999996 36.0 34.0 39.5 29.0 41.0 66-67 34.8255 35.5 34.0 39.0 29.0 41.0 68-69 34.41575 35.0 34.0 39.0 29.0 40.5 70-71 34.02025 35.0 34.0 37.5 28.5 40.0 72-73 33.629374999999996 35.0 33.0 37.0 27.5 39.0 74-75 33.28425 35.0 33.0 36.5 27.5 39.0 76-77 32.2825 34.5 31.5 35.5 25.5 37.0 78-79 32.547124999999994 35.0 33.0 36.0 26.5 37.0 80-81 32.330124999999995 35.0 33.0 35.0 26.5 37.0 82-83 32.042625 35.0 33.0 35.0 25.0 36.0 84-85 31.859125 35.0 33.0 35.0 25.0 36.0 86-87 31.674 35.0 32.5 35.0 25.0 36.0 88-89 31.33425 35.0 32.5 35.0 24.0 35.0 90-91 31.043750000000003 35.0 32.0 35.0 23.0 35.0 92-93 30.83025 35.0 32.0 35.0 21.5 35.0 94-95 30.429375 35.0 31.5 35.0 18.0 35.0 96-97 29.965 35.0 31.0 35.0 5.0 35.0 98-99 29.198 34.0 30.5 35.0 2.0 35.0 100 28.882 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 4.0 10 3.0 11 6.0 12 4.0 13 8.0 14 8.0 15 5.0 16 10.0 17 8.0 18 7.0 19 14.0 20 11.0 21 14.0 22 14.0 23 13.0 24 20.0 25 25.0 26 28.0 27 31.0 28 47.0 29 73.0 30 91.0 31 100.0 32 130.0 33 163.0 34 250.0 35 369.0 36 529.0 37 870.0 38 973.0 39 169.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.125 12.35 10.825 48.699999999999996 2 24.85 16.150000000000002 31.574999999999996 27.425 3 24.474999999999998 19.1 22.525000000000002 33.900000000000006 4 29.33966983491746 22.686343171585793 17.83391695847924 30.14007003501751 5 31.681681681681685 25.975975975975974 20.07007007007007 22.27227227227227 6 24.45 32.425 20.474999999999998 22.650000000000002 7 23.075000000000003 17.925 37.025000000000006 21.975 8 23.375 21.349999999999998 27.175 28.1 9 23.7 20.225 30.599999999999998 25.474999999999998 10-11 25.924999999999997 28.549999999999997 21.9375 23.5875 12-13 24.5 22.975 26.025 26.5 14-15 24.5125 25.0625 24.337500000000002 26.087500000000002 16-17 26.1125 24.4125 23.525 25.95 18-19 25.4375 24.075 23.9375 26.55 20-21 26.025 24.85 24.075 25.05 22-23 25.2875 25.2 24.1125 25.4 24-25 25.5375 24.4 23.4125 26.650000000000002 26-27 25.3 24.925 24.224999999999998 25.55 28-29 26.700000000000003 24.05 22.75 26.5 30-31 25.1875 25.412499999999998 22.9875 26.4125 32-33 26.3 24.65 24.275 24.775 34-35 26.937499999999996 24.1125 23.425 25.525 36-37 26.224999999999998 24.2375 23.2875 26.25 38-39 26.5 24.0125 23.925 25.5625 40-41 25.837500000000002 24.7375 23.65 25.775 42-43 26.21310655327664 23.1615807903952 24.54977488744372 26.075537768884445 44-45 25.924999999999997 24.175 23.5875 26.3125 46-47 26.875 23.3625 23.1875 26.575 48-49 26.325 24.087500000000002 23.9125 25.674999999999997 50-51 25.837500000000002 24.0375 23.3625 26.7625 52-53 26.5375 23.7625 23.7625 25.937500000000004 54-55 26.6625 24.675 23.4875 25.174999999999997 56-57 25.7625 24.3875 23.25 26.6 58-59 26.76919229807452 24.118529632408105 23.63090772693173 25.481370342585645 60-61 26.281570392598148 23.543385846461614 24.406101525381345 25.76894223555889 62-63 25.9249937075258 24.024666498867354 23.89881701485024 26.151522778756608 64-65 27.493092187892486 23.474001507159006 23.411203215272543 25.62170308967596 66-67 25.662499999999998 24.4 24.462500000000002 25.474999999999998 68-69 26.6 23.95 23.974999999999998 25.474999999999998 70-71 26.825 23.799999999999997 23.4125 25.9625 72-73 26.487500000000004 23.9875 24.075 25.45 74-75 26.900000000000002 23.3625 24.0625 25.674999999999997 76-77 25.4625 23.6875 24.3875 26.4625 78-79 26.307866014301844 24.225316773303224 24.17513486388157 25.291682348513362 80-81 26.735412474849095 23.516096579476862 24.09456740442656 25.653923541247487 82-83 26.674191121143714 23.739653875094056 23.07499372962127 26.51116127414096 84-85 25.7375 24.3 23.925 26.0375 86-87 26.9125 23.974999999999998 23.4875 25.624999999999996 88-89 27.0125 23.799999999999997 23.525 25.662499999999998 90-91 25.95 23.5 24.25 26.3 92-93 26.06569709127382 24.749247743229688 23.909227683049146 25.275827482447344 94-95 26.723049734915428 23.693511739459733 23.024488765463268 26.558949760161575 96-97 25.649432534678436 23.90920554854981 24.401008827238336 26.04035308953342 98-99 27.03462373834164 24.134406541459054 22.741791235466973 26.08917848473234 100 26.875 23.7 23.375 26.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.5 28 4.0 29 5.0 30 3.5 31 6.5 32 12.5 33 17.5 34 20.5 35 21.5 36 32.5 37 49.5 38 65.5 39 81.0 40 103.0 41 116.0 42 125.0 43 136.5 44 152.0 45 170.5 46 184.0 47 175.5 48 163.5 49 159.5 50 151.0 51 149.0 52 140.0 53 128.0 54 116.0 55 108.5 56 99.0 57 81.0 58 75.5 59 76.5 60 72.0 61 76.0 62 74.0 63 67.5 64 73.5 65 72.5 66 71.0 67 68.5 68 61.5 69 72.0 70 64.5 71 46.0 72 40.5 73 40.0 74 33.0 75 26.0 76 26.0 77 25.5 78 17.5 79 11.0 80 9.5 81 4.0 82 3.0 83 2.5 84 2.0 85 2.0 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.05 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.025 60-61 0.025 62-63 0.675 64-65 0.475 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.36250000000000004 80-81 0.6 82-83 0.325 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.3 94-95 0.975 96-97 0.8750000000000001 98-99 2.1624999999999996 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040800 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040800_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.01075 34.0 31.0 34.0 30.0 34.0 2 32.40675 34.0 31.0 34.0 31.0 34.0 3 32.299 34.0 31.0 34.0 31.0 34.0 4 35.75175 37.0 37.0 37.0 35.0 37.0 5 35.626 37.0 37.0 37.0 35.0 37.0 6 35.43775 37.0 36.0 37.0 35.0 37.0 7 35.56475 37.0 37.0 37.0 35.0 37.0 8 35.18225 37.0 37.0 37.0 35.0 37.0 9 37.115 39.0 38.0 39.0 35.0 39.0 10-11 37.388 39.0 38.0 39.0 35.0 39.0 12-13 37.491375000000005 39.0 38.0 39.0 35.0 39.0 14-15 39.058125000000004 41.0 39.0 41.0 36.0 41.0 16-17 39.045500000000004 41.0 39.0 41.0 36.0 41.0 18-19 38.989125 41.0 39.0 41.0 36.0 41.0 20-21 38.5985 41.0 39.0 41.0 34.5 41.0 22-23 38.096374999999995 40.0 38.5 41.0 34.0 41.0 24-25 37.73350000000001 40.0 38.0 41.0 33.0 41.0 26-27 37.906125 40.0 38.0 41.0 32.5 41.0 28-29 38.120875 40.0 38.0 41.0 33.0 41.0 30-31 38.08525 40.0 38.0 41.0 33.5 41.0 32-33 37.97 40.0 38.0 41.0 33.0 41.0 34-35 37.91625 40.0 38.0 41.0 33.0 41.0 36-37 37.78175 40.0 37.5 41.0 33.0 41.0 38-39 37.611125 40.0 37.0 41.0 32.0 41.0 40-41 37.166875000000005 40.0 36.5 41.0 31.5 41.0 42-43 36.403499999999994 40.0 35.5 41.0 29.5 41.0 44-45 36.025 39.0 35.0 41.0 28.0 41.0 46-47 36.1075 39.0 35.0 41.0 28.5 41.0 48-49 36.0715 39.0 35.0 41.0 29.0 41.0 50-51 35.504875 38.5 34.0 40.5 28.0 40.5 52-53 35.920249999999996 38.5 35.0 40.5 30.0 41.0 54-55 36.051249999999996 38.5 35.0 41.0 30.0 41.0 56-57 35.58925 38.5 35.0 41.0 29.0 41.0 58-59 35.15175 37.5 35.0 40.5 28.0 41.0 60-61 34.714875 37.0 34.0 40.0 26.5 41.0 62-63 34.45275 36.5 34.0 40.0 26.0 41.0 64-65 34.274375 36.0 34.0 39.5 26.0 41.0 66-67 33.95 35.0 34.0 39.0 26.0 41.0 68-69 33.286500000000004 35.0 33.0 38.0 25.0 40.5 70-71 33.08375 35.0 33.0 37.5 25.0 40.0 72-73 32.739375 35.0 33.0 37.0 25.0 39.0 74-75 32.20775 35.0 33.0 36.5 23.5 39.0 76-77 31.682 35.0 32.5 36.0 21.5 38.5 78-79 31.271250000000002 35.0 32.0 35.5 20.0 37.0 80-81 30.969875000000002 35.0 31.5 35.0 18.5 37.0 82-83 30.6035 35.0 31.0 35.0 16.0 36.5 84-85 30.289749999999998 35.0 31.0 35.0 15.0 36.0 86-87 29.9615 34.0 31.0 35.0 7.5 36.0 88-89 29.505875 34.0 29.5 35.0 6.0 35.0 90-91 29.406875 34.0 30.0 35.0 2.0 35.0 92-93 28.922125 34.0 29.5 35.0 2.0 35.0 94-95 28.029875 34.0 28.0 35.0 2.0 35.0 96-97 27.659125 34.0 27.0 35.0 2.0 35.0 98-99 27.188125 34.0 27.0 35.0 2.0 35.0 100 25.72275 33.0 23.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 3.0 5 7.0 6 3.0 7 2.0 8 10.0 9 5.0 10 10.0 11 10.0 12 14.0 13 13.0 14 10.0 15 7.0 16 15.0 17 15.0 18 23.0 19 12.0 20 23.0 21 17.0 22 28.0 23 30.0 24 31.0 25 44.0 26 49.0 27 48.0 28 59.0 29 67.0 30 85.0 31 99.0 32 135.0 33 173.0 34 241.0 35 327.0 36 570.0 37 796.0 38 853.0 39 155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.595696772579437 11.43357518138604 11.48361270953215 49.48711533650238 2 23.625 16.05 32.4 27.925 3 24.595959595959595 19.67171717171717 21.91919191919192 33.813131313131315 4 29.509853461344115 21.77867609903992 18.039413845376455 30.672056594239518 5 31.51760831010894 25.411705092475295 20.167215606789966 22.90347099062579 6 24.416243654822335 31.065989847715734 20.888324873096447 23.629441624365484 7 22.188372683422187 18.684945417618685 35.59279004823559 23.533891850723535 8 23.00385109114249 22.41335044929397 28.010269576379976 26.572528883183566 9 22.621457489878544 19.888663967611336 30.870445344129553 26.619433198380566 10-11 25.42096004021111 28.813772304599144 22.304599145513947 23.4606685096758 12-13 24.560301507537687 23.178391959798994 25.90452261306533 26.356783919597994 14-15 24.878048780487806 24.90306441525954 24.1776110068793 26.04127579737336 16-17 25.943985996499126 23.355838959739934 24.33108277069267 26.36909227306827 18-19 25.972726135368447 24.32128112098086 23.54560240210184 26.160390341548855 20-21 25.51906379765949 25.003145841197938 23.09047439285265 26.387315968289922 22-23 25.9977049598368 24.73543287007523 23.026902970801988 26.23995919928599 24-25 24.692465402357765 24.320861096873397 24.46181445412609 26.524859046642746 26-27 25.85 24.625 23.225 26.3 28-29 25.912499999999998 24.125 24.05 25.912499999999998 30-31 25.962981490745374 23.074037018509255 24.262131065532767 26.700850425212607 32-33 24.9125 24.9375 23.8375 26.3125 34-35 25.35 24.9 23.3125 26.437500000000004 36-37 24.7875 24.462500000000002 23.674999999999997 27.075 38-39 26.224999999999998 23.775 23.974999999999998 26.025 40-41 25.68991470145509 24.096838936276967 24.422980431510286 25.79026593075765 42-43 25.47121752419766 23.80285277636271 24.15944982170148 26.566479877738157 44-45 25.654980382230097 25.13605872674345 23.553980508796354 25.654980382230097 46-47 25.4375 24.325 23.849999999999998 26.387500000000003 48-49 24.3125 24.75 23.825 27.1125 50-51 26.387500000000003 23.7875 24.0125 25.8125 52-53 25.9875 23.7125 23.9875 26.3125 54-55 24.5125 25.0625 24.1375 26.2875 56-57 25.689112649465073 23.82630585273757 24.17872876022656 26.305852737570802 58-59 26.461655277145024 23.89268539610225 24.120475828904077 25.525183497848648 60-61 25.846814964610722 22.611223458038424 24.16582406471183 27.376137512639033 62-63 25.569747057350362 24.417731029301276 23.478587528174305 26.533934385174057 64-65 25.8726385587389 23.958463655698736 23.145252095583636 27.023645689978732 66-67 24.762500000000003 24.45 23.724999999999998 27.0625 68-69 25.224999999999998 24.2875 24.099999999999998 26.387500000000003 70-71 25.275 23.9125 24.0625 26.75 72-73 25.9875 23.9125 23.6125 26.487500000000004 74-75 25.98564050888021 24.373346769114498 23.655372213125077 25.98564050888021 76-77 26.40030345176381 23.618662283474524 23.251991402200026 26.729042862561634 78-79 26.188068756319517 23.97623862487361 23.90040444893832 25.935288169868553 80-81 26.38976826643029 24.56629099658098 23.325313410155754 25.718627326832976 82-83 26.418172690763054 23.657128514056225 23.343373493975903 26.581325301204817 84-85 25.45 23.375 24.7875 26.387500000000003 86-87 26.25 24.65 23.95 25.15 88-89 26.6 22.7125 23.8375 26.85 90-91 26.278924327704818 23.22701688555347 24.853033145716072 25.64102564102564 92-93 27.022920096239076 23.64188932506015 23.629226288463972 25.7059642902368 94-95 26.437072676626993 23.297037224613824 23.778171689035197 26.487718409723982 96-97 25.424999999999997 23.7875 23.6625 27.125 98-99 27.030075187969928 23.458646616541355 23.258145363408524 26.2531328320802 100 26.401810409856672 23.258737742016596 23.283882323359318 27.055569524767414 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 2.0 24 1.0 25 1.0 26 2.0 27 2.5 28 4.5 29 8.0 30 7.0 31 6.0 32 11.0 33 17.0 34 21.5 35 28.0 36 36.5 37 48.5 38 62.0 39 80.5 40 89.5 41 107.0 42 144.5 43 162.0 44 158.0 45 161.5 46 171.0 47 176.0 48 173.0 49 168.0 50 164.0 51 144.5 52 126.0 53 114.0 54 102.0 55 98.5 56 95.5 57 86.5 58 86.0 59 83.5 60 80.0 61 77.5 62 75.0 63 67.5 64 62.0 65 67.0 66 69.0 67 73.5 68 73.5 69 63.5 70 57.0 71 51.5 72 44.5 73 34.5 74 25.0 75 25.5 76 20.0 77 16.0 78 13.0 79 7.5 80 9.5 81 9.5 82 5.5 83 4.0 84 4.0 85 2.5 86 1.0 87 2.0 88 2.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 1.0 4 1.05 5 1.325 6 1.5 7 1.525 8 2.625 9 1.2 10-11 0.525 12-13 0.5 14-15 0.0625 16-17 0.025 18-19 0.08750000000000001 20-21 0.6625 22-23 1.9625 24-25 2.45 26-27 0.0 28-29 0.0 30-31 0.05 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.35000000000000003 42-43 1.8499999999999999 44-45 1.2375 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.6875 58-59 1.225 60-61 1.0999999999999999 62-63 0.17500000000000002 64-65 0.08750000000000001 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.7625 76-77 1.1375 78-79 1.0999999999999999 80-81 1.2874999999999999 82-83 0.4 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0625 92-93 1.2874999999999999 94-95 1.275 96-97 0.0 98-99 0.25 100 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958694 spots for SRR28040800.sra Written 958694 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra Read 958682 spots for SRR28040800.sra Written 958682 spots for SRR28040800.sra SRR ids: ['SRR28040800.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_14_q9k2e SRR28040800.sra spots: 19173652 blocks: [[1, 958682], [958683, 1917364], [1917365, 2876046], [2876047, 3834728], [3834729, 4793410], [4793411, 5752092], [5752093, 6710774], [6710775, 7669456], [7669457, 8628138], [8628139, 9586820], [9586821, 10545502], [10545503, 11504184], [11504185, 12462866], [12462867, 13421548], [13421549, 14380230], [14380231, 15338912], [15338913, 16297594], [16297595, 17256276], [17256277, 18214958], [18214959, 19173652]] SRR28040800 file size 4997963 SRR28040800 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040800 SRR28040800_1.fastq SRR28040800_2.fastq Input file: SRR28040800_1.fastq Paired file: SRR28040800_2.fastq trimmed: SRR28040800-trimmed-pair1.fastq, SRR28040800-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:35:27 2024 >> started Fri Dec 6 13:35:48 2024 >> done (21.145s) 19173652 read pairs processed; of these: 101119 ( 0.53%) short read pairs filtered out after trimming by size control 35934 ( 0.19%) empty read pairs filtered out after trimming by size control 19036599 (99.29%) read pairs available; of these: 4736082 (24.88%) trimmed read pairs available after processing 14300517 (75.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 99 0.00% 19 120 0.00% 20 190 0.00% 21 334 0.00% 22 450 0.00% 23 640 0.00% 24 762 0.00% 25 991 0.01% 26 1236 0.01% 27 1507 0.01% 28 1750 0.01% 29 2050 0.01% 30 2341 0.01% 31 2791 0.01% 32 2889 0.02% 33 3218 0.02% 34 3519 0.02% 35 4001 0.02% 36 4143 0.02% 37 4538 0.02% 38 4641 0.02% 39 5042 0.03% 40 5608 0.03% 41 5555 0.03% 42 5990 0.03% 43 6013 0.03% 44 6671 0.04% 45 6904 0.04% 46 7235 0.04% 47 7783 0.04% 48 8341 0.04% 49 8650 0.05% 50 8978 0.05% 51 9581 0.05% 52 9946 0.05% 53 10608 0.06% 54 11194 0.06% 55 12084 0.06% 56 12953 0.07% 57 14735 0.08% 58 16270 0.09% 59 28185 0.15% 60 29581 0.16% 61 27228 0.14% 62 29232 0.15% 63 30902 0.16% 64 32691 0.17% 65 34894 0.18% 66 36472 0.19% 67 38008 0.20% 68 39187 0.21% 69 45819 0.24% 70 41138 0.22% 71 41751 0.22% 72 42548 0.22% 73 43553 0.23% 74 43951 0.23% 75 41481 0.22% 76 43824 0.23% 77 51332 0.27% 78 50626 0.27% 79 52440 0.28% 80 55675 0.29% 81 59206 0.31% 82 64177 0.34% 83 68459 0.36% 84 72506 0.38% 85 77058 0.40% 86 85063 0.45% 87 91235 0.48% 88 89090 0.47% 89 101902 0.54% 90 114076 0.60% 91 125889 0.66% 92 142047 0.75% 93 162744 0.85% 94 191583 1.01% 95 232888 1.22% 96 294345 1.55% 97 378104 1.99% 98 525745 2.76% 99 757096 3.98% 100 14300517 75.12% 19036599 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=116.74 fanout-score-rank=16 prefix-density=0.93 prefix-fanout=18.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=310.91 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=24.4 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=117.37 fanout-score-rank=11 prefix-density=0.96 prefix-fanout=18.9 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=346.77 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=21.8 sequence=CCGCCGCCGCCTCC SRR28040800 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:36:29 Started mapping on | Dec 06 13:36:30 Finished on | Dec 06 13:37:42 Mapping speed, Million of reads per hour | 951.83 Number of input reads | 19036599 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 18212078 Uniquely mapped reads % | 95.67% Average mapped length | 193.14 Number of splices: Total | 11085249 Number of splices: Annotated (sjdb) | 10550066 Number of splices: GT/AG | 10923886 Number of splices: GC/AG | 134401 Number of splices: AT/AC | 7976 Number of splices: Non-canonical | 18986 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238601 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 23635 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.38% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 624010 624010 624010 N_multimapping 238601 238601 238601 N_noFeature 585863 9138460 9368939 N_ambiguous 323799 18199 18082 UnstrandedReadsAssigned:17302416 PositiveStrandReadsAssigned:9055419 NegativeStrandReadsAssigned:8825057 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040800 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040800-trimmed-pair1.fastq SRR28040800-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,036,599 reads, 17,838,529 reads pseudoaligned [quant] estimated average fragment length: 180.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR28040800.ke.tsv 35125 SRR28040800.se.tsv 88098 total ==> SRR28040800.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 756.963 15.9554 1.67136 PNS24247 1044 864.822 53.5547 4.9103 PNS24249 1928 1748.82 182.959 8.29557 PNS24246 1044 864.822 53.5547 4.9103 PNS24248 1044 864.822 53.5547 4.9103 PNS24244 1471 1291.82 87.4211 5.366 PNS24243 293 123.323 8 5.1438 KQK14069 1603 1423.82 2413.74 134.422 KQK14071 474 296.65 176.957 47.2999 ==> SRR28040800.se.tsv <== BRADI_1g14170v3 2713 BRADI_1g53295v3 44 BRADI_1g59795v3 314 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 909 BRADI_1g74790v3 219 BRADI_1g09890v3 1 BRADI_1g77505v3 207 BRADI_1g48960v3 0 SRR28040800 completed mapping pipeline successfully