Starting /dee2/code/volunteer_pipeline.sh SRR28040801 current disk space = 1551043338240 free memory = 1598010684 SRR28040801 SRAfilesize 7cae8dcb77e27d52d3d45f27f29227ba SRR28040801.sra SRR28040801.sra file validated SRR28040801 is paired end SRR28040801 is conventional basespace SRR28040801 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040801_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76625 34.0 31.0 34.0 31.0 34.0 2 32.8935 34.0 31.0 34.0 31.0 34.0 3 32.8405 34.0 31.0 34.0 31.0 34.0 4 36.33575 37.0 37.0 37.0 35.0 37.0 5 36.2485 37.0 37.0 37.0 35.0 37.0 6 36.24625 37.0 37.0 37.0 35.0 37.0 7 36.21725 37.0 37.0 37.0 35.0 37.0 8 36.21225 37.0 37.0 37.0 35.0 37.0 9 37.927 39.0 38.0 39.0 35.0 39.0 10-11 37.884625 39.0 38.0 39.0 35.0 39.0 12-13 37.872249999999994 39.0 38.0 39.0 35.0 39.0 14-15 39.311125000000004 41.0 39.0 41.0 36.0 41.0 16-17 39.248374999999996 41.0 39.0 41.0 36.0 41.0 18-19 39.19375 41.0 39.0 41.0 36.0 41.0 20-21 39.063125 41.0 39.0 41.0 35.0 41.0 22-23 39.072625 40.0 39.0 41.0 35.0 41.0 24-25 38.894125 40.0 38.0 41.0 35.0 41.0 26-27 38.754374999999996 40.0 38.0 41.0 34.5 41.0 28-29 38.473749999999995 40.0 38.0 41.0 34.0 41.0 30-31 38.381874999999994 40.0 38.0 41.0 34.0 41.0 32-33 38.0925 40.0 37.5 41.0 33.0 41.0 34-35 37.859875 40.0 37.0 41.0 33.0 41.0 36-37 37.461124999999996 40.0 36.5 41.0 32.0 41.0 38-39 37.270875000000004 40.0 36.0 41.0 31.5 41.0 40-41 36.915875 39.5 35.0 41.0 31.0 41.0 42-43 36.60925 39.0 35.0 41.0 30.0 41.0 44-45 36.326499999999996 38.5 35.0 41.0 30.0 41.0 46-47 35.974000000000004 38.0 35.0 40.0 29.0 41.0 48-49 35.90412499999999 38.0 34.5 40.0 29.5 41.0 50-51 36.023250000000004 38.0 35.0 41.0 30.0 41.0 52-53 35.783125 38.0 34.5 40.5 29.5 41.0 54-55 35.511875 37.5 34.0 40.0 29.0 41.0 56-57 35.298375 37.0 34.0 40.0 28.5 41.0 58-59 35.022 36.0 34.0 40.0 28.0 41.0 60-61 34.681250000000006 36.0 34.0 40.0 27.0 41.0 62-63 34.3795 35.0 34.0 39.5 26.5 41.0 64-65 34.064875 35.0 33.0 39.0 26.0 41.0 66-67 33.78175 35.0 33.0 39.0 26.5 41.0 68-69 33.42775 35.0 33.0 37.5 26.0 40.0 70-71 33.1155 35.0 33.0 37.0 26.0 39.5 72-73 32.767875000000004 35.0 33.0 36.5 25.5 39.0 74-75 32.2655 35.0 32.5 36.0 24.0 39.0 76-77 31.323875 34.0 30.5 35.0 23.5 37.0 78-79 31.441499999999998 35.0 31.5 35.0 22.0 37.0 80-81 31.2925 35.0 32.0 35.0 22.0 36.5 82-83 31.051375 35.0 31.5 35.0 20.0 36.0 84-85 30.81075 35.0 31.0 35.0 19.5 36.0 86-87 30.618000000000002 35.0 31.0 35.0 19.0 35.5 88-89 30.225749999999998 34.5 31.0 35.0 16.5 35.0 90-91 29.85575 34.0 30.5 35.0 10.0 35.0 92-93 29.396 34.0 30.0 35.0 3.5 35.0 94-95 29.211624999999998 34.0 30.0 35.0 2.0 35.0 96-97 28.707375 34.0 29.5 35.0 2.0 35.0 98-99 27.956625 34.0 29.0 35.0 2.0 35.0 100 27.57875 34.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 3.0 9 8.0 10 10.0 11 6.0 12 10.0 13 11.0 14 11.0 15 8.0 16 14.0 17 10.0 18 18.0 19 12.0 20 21.0 21 15.0 22 23.0 23 29.0 24 28.0 25 27.0 26 38.0 27 49.0 28 60.0 29 83.0 30 90.0 31 98.0 32 156.0 33 201.0 34 294.0 35 373.0 36 582.0 37 762.0 38 796.0 39 152.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.6 11.325000000000001 11.700000000000001 49.375 2 25.25 15.7 31.2 27.85 3 25.650650650650654 18.493493493493492 22.922922922922922 32.932932932932935 4 30.975 22.3 17.375 29.349999999999998 5 31.44072036018009 26.21310655327664 18.584292146073036 23.761880940470235 6 26.375 30.625000000000004 19.400000000000002 23.599999999999998 7 23.35 18.45 35.699999999999996 22.5 8 23.974999999999998 20.95 26.474999999999998 28.599999999999998 9 24.075 19.85 30.525000000000002 25.55 10-11 26.125 27.462500000000002 20.9875 25.424999999999997 12-13 24.9375 23.0875 24.6875 27.287499999999998 14-15 25.387500000000003 22.975 24.1625 27.474999999999998 16-17 27.224999999999998 22.5875 22.975 27.212500000000002 18-19 27.287499999999998 23.175 22.7625 26.775 20-21 26.4625 23.5625 23.5 26.474999999999998 22-23 26.4625 23.1875 23.4375 26.9125 24-25 26.8375 24.224999999999998 22.3 26.637499999999996 26-27 26.775 23.8125 23.7375 25.674999999999997 28-29 26.7125 23.25 22.912499999999998 27.125 30-31 26.6125 23.4625 22.6375 27.287499999999998 32-33 26.224999999999998 23.4125 23.325000000000003 27.037499999999998 34-35 27.287499999999998 23.1125 22.8875 26.7125 36-37 25.724999999999998 23.3375 23.65 27.287499999999998 38-39 26.700000000000003 23.1625 23.150000000000002 26.987499999999997 40-41 27.55 23.5125 22.9625 25.974999999999998 42-43 26.27235213204952 23.43378767037639 23.071151681880707 27.222708515693384 44-45 26.424999999999997 23.925 22.6 27.05 46-47 27.175 23.4125 23.0 26.4125 48-49 25.887500000000003 23.45 23.5375 27.125 50-51 26.424999999999997 23.2125 22.725 27.6375 52-53 26.9625 23.125 22.85 27.0625 54-55 26.224999999999998 24.349999999999998 22.650000000000002 26.775 56-57 26.737499999999997 23.425 22.075 27.762500000000003 58-59 27.425 22.925 23.125 26.525 60-61 26.4021031547321 24.111166750125186 22.108162243365047 27.378567851777667 62-63 27.729722953491287 23.3546446032343 22.25147298483139 26.664159458443027 64-65 27.510971786833853 23.272727272727273 22.771159874608152 26.445141065830718 66-67 27.5625 23.1875 21.9375 27.3125 68-69 26.937499999999996 23.275000000000002 22.575 27.212500000000002 70-71 25.974999999999998 24.0 22.825 27.200000000000003 72-73 28.15 22.5625 22.675 26.6125 74-75 26.650000000000002 23.799999999999997 23.400000000000002 26.150000000000002 76-77 28.213480330744172 22.751190177900277 22.538210974693058 26.49711851666249 78-79 27.104334677419356 22.883064516129032 22.782258064516128 27.23034274193548 80-81 26.74477198286722 22.91509196271101 23.11665406903502 27.223481985386748 82-83 26.93851944792974 23.387703889585946 22.936010037641154 26.73776662484316 84-85 26.8 22.7625 23.3625 27.075 86-87 26.7625 24.0125 22.2625 26.9625 88-89 27.1125 22.375 22.525000000000002 27.987499999999997 90-91 26.940925623980938 23.73008905054559 21.93653580835319 27.392449517120284 92-93 27.393817542096006 23.34757476752953 23.410404624277454 25.848203066097007 94-95 27.684903748733536 22.885005065856127 22.56838905775076 26.861702127659576 96-97 27.674153026265703 23.423423423423422 21.735820327369623 27.166603222941248 98-99 27.16932907348243 23.43769968051118 22.91373801916933 26.479233226837064 100 28.425 23.225 22.375 25.974999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 3.5 29 7.5 30 7.5 31 9.5 32 11.5 33 11.0 34 14.0 35 18.0 36 27.5 37 43.0 38 51.0 39 61.5 40 87.5 41 106.5 42 130.0 43 147.0 44 145.0 45 148.0 46 148.5 47 145.5 48 137.0 49 137.0 50 149.0 51 142.5 52 125.5 53 107.0 54 92.0 55 89.0 56 93.0 57 99.0 58 95.5 59 87.0 60 86.0 61 89.0 62 85.5 63 81.0 64 78.5 65 88.5 66 91.5 67 84.5 68 84.0 69 78.5 70 71.5 71 66.5 72 62.5 73 58.5 74 50.5 75 34.0 76 26.5 77 23.0 78 17.5 79 14.5 80 12.5 81 12.5 82 7.5 83 4.5 84 3.5 85 1.5 86 2.5 87 1.5 88 1.0 89 1.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.1 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0375 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.15 62-63 0.2875 64-65 0.3125 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.22499999999999998 78-79 0.8 80-81 0.775 82-83 0.375 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.3375 92-93 0.525 94-95 1.3 96-97 1.4874999999999998 98-99 2.1875 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040801 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040801_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46925 34.0 31.0 34.0 31.0 34.0 2 32.34675 34.0 31.0 34.0 31.0 34.0 3 32.18375 34.0 31.0 34.0 30.0 34.0 4 35.43525 37.0 37.0 37.0 35.0 37.0 5 35.29575 37.0 35.0 37.0 33.0 37.0 6 35.2775 37.0 36.0 37.0 33.0 37.0 7 35.273 37.0 35.0 37.0 33.0 37.0 8 34.96 37.0 35.0 37.0 33.0 37.0 9 36.78225 39.0 38.0 39.0 33.0 39.0 10-11 36.9875 39.0 37.5 39.0 33.5 39.0 12-13 37.12075 39.0 38.0 39.0 34.0 39.0 14-15 38.616125 41.0 38.0 41.0 34.0 41.0 16-17 38.649 41.0 38.0 41.0 35.0 41.0 18-19 38.553 41.0 38.0 41.0 35.0 41.0 20-21 38.13775 40.0 38.0 41.0 33.5 41.0 22-23 37.75575 40.0 38.0 41.0 33.0 41.0 24-25 37.231750000000005 40.0 38.0 41.0 32.0 41.0 26-27 37.31975 40.0 38.0 41.0 30.5 41.0 28-29 37.60775 40.0 37.5 41.0 32.0 41.0 30-31 37.30875 40.0 37.5 41.0 31.5 41.0 32-33 37.180625 40.0 37.0 41.0 31.0 41.0 34-35 37.072625 40.0 36.5 41.0 31.0 41.0 36-37 36.983875 40.0 37.0 41.0 31.0 41.0 38-39 36.771375000000006 40.0 36.0 41.0 30.5 41.0 40-41 36.24275 39.0 35.0 41.0 29.5 41.0 42-43 35.60225 39.0 35.0 41.0 27.0 41.0 44-45 35.26375 38.5 34.5 41.0 26.0 41.0 46-47 35.170625 38.0 34.0 40.5 26.0 41.0 48-49 35.023375 38.0 34.0 40.0 26.0 41.0 50-51 34.295375 37.5 33.0 39.5 25.0 40.5 52-53 34.778499999999994 37.5 33.5 40.0 26.5 41.0 54-55 34.931124999999994 37.0 34.0 40.0 27.0 41.0 56-57 34.589875 37.0 34.0 40.0 26.0 41.0 58-59 34.05375 36.0 33.5 40.0 25.5 41.0 60-61 33.437 35.0 33.0 40.0 22.0 41.0 62-63 33.353750000000005 35.0 33.0 39.0 23.0 41.0 64-65 33.217375000000004 35.0 33.0 39.0 23.0 41.0 66-67 32.96875 35.0 33.0 38.5 23.0 41.0 68-69 32.574875 35.0 33.0 37.5 22.0 40.0 70-71 32.239875 35.0 32.0 37.0 22.5 39.5 72-73 31.814375 35.0 31.5 36.5 21.5 39.0 74-75 31.24425 35.0 31.0 36.0 18.5 39.0 76-77 30.699125000000002 35.0 31.0 35.5 15.0 37.5 78-79 30.31225 35.0 30.5 35.0 9.0 37.0 80-81 29.838375 34.0 30.0 35.0 7.0 36.5 82-83 29.54275 34.0 30.0 35.0 3.5 36.0 84-85 29.18625 34.0 29.0 35.0 2.0 36.0 86-87 28.902625 34.0 29.0 35.0 2.0 35.0 88-89 28.639 34.0 29.0 35.0 2.0 35.0 90-91 28.451875 34.0 28.5 35.0 2.0 35.0 92-93 27.8275 34.0 28.0 35.0 2.0 35.0 94-95 27.055125 34.0 25.0 35.0 2.0 35.0 96-97 26.512875 33.0 24.0 35.0 2.0 35.0 98-99 25.54975 33.0 20.5 35.0 2.0 35.0 100 23.0185 30.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 0.0 4 2.0 5 2.0 6 6.0 7 8.0 8 10.0 9 9.0 10 12.0 11 10.0 12 23.0 13 17.0 14 15.0 15 19.0 16 16.0 17 18.0 18 15.0 19 25.0 20 23.0 21 24.0 22 33.0 23 38.0 24 34.0 25 48.0 26 42.0 27 60.0 28 78.0 29 73.0 30 94.0 31 117.0 32 161.0 33 213.0 34 250.0 35 404.0 36 523.0 37 731.0 38 695.0 39 119.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.978957915831664 10.345691382765532 11.723446893787576 50.95190380761523 2 24.64132897055122 16.687641580669517 31.135162345834384 27.535867102944877 3 25.158831003811944 17.63659466327827 23.024142312579414 34.18043202033037 4 31.36954858454476 22.188217291507268 17.597551644988524 28.84468247895945 5 34.534764826175866 24.284253578732105 18.66053169734151 22.52044989775051 6 26.396327467482784 31.420555980617188 18.362662586074983 23.820453965825045 7 23.18877551020408 18.367346938775512 33.11224489795918 25.331632653061227 8 23.438704703161143 21.228475970187613 26.882549473143154 28.450269853508097 9 22.90174002047083 20.138178096212897 31.141248720573184 25.818833162743093 10-11 27.33358595427561 26.979916635089047 21.119110774283186 24.567386636352154 12-13 25.141491636272168 22.613507734876116 24.877373915230788 27.36762671362093 14-15 26.026706979087933 22.53716301335349 25.08188460569413 26.35424540186445 16-17 27.229339361969355 22.820899271539812 23.51168048229088 26.438080884199948 18-19 27.089118909366324 22.734158040898762 23.61777328957334 26.558949760161575 20-21 25.53623556288869 23.924355882726232 23.77205229089986 26.767356263485215 22-23 26.14070864134591 23.476930920214123 23.61712974764211 26.765230690797857 24-25 27.08117890382627 22.50517063081696 23.4358841778697 26.977766287487075 26-27 27.128391048881113 23.102887860982623 23.19039879984998 26.578322290286287 28-29 26.743458119444096 22.92475272317516 22.386377864029047 27.945411293351697 30-31 26.186269560827864 23.674911660777383 23.13225643614336 27.00656234225139 32-33 25.97663610099234 23.91659339278985 23.414143951764853 26.692626554452957 34-35 26.787499999999998 22.4375 22.9875 27.787499999999998 36-37 26.875 23.549999999999997 23.150000000000002 26.424999999999997 38-39 25.47371062868616 23.89258376207805 23.428284602835987 27.2054210063998 40-41 26.88607594936709 24.202531645569618 22.556962025316455 26.354430379746834 42-43 25.361484325015994 23.160588611644272 23.96673064619322 27.51119641714651 44-45 26.739323279685717 23.25434038778355 24.090736281840073 25.915600050690664 46-47 27.3875 22.5 22.95 27.1625 48-49 27.098231087692888 22.933132605695647 22.9833145151173 26.985321791494165 50-51 27.18507387928876 22.814926120711245 22.58953168044077 27.41046831955923 52-53 26.544136034008503 23.830957739434858 22.31807951987997 27.306826706676667 54-55 26.063428139944627 23.03045557513214 22.829096400704756 28.077019884218473 56-57 25.53057099545225 23.78726629610915 23.47145022738757 27.210712481051036 58-59 26.93970999745612 22.653268888323584 22.640549478504195 27.7664716357161 60-61 26.466088730239672 23.100458949515552 23.31718510963794 27.116267210606832 62-63 26.4761188416698 22.966027328569638 23.392252726588943 27.165601103171618 64-65 27.058528637673895 23.31119187868154 22.97280360947487 26.657475874169695 66-67 26.717557251908396 22.788136653735453 23.526467275685146 26.967838818671 68-69 26.05 23.075000000000003 23.7875 27.0875 70-71 26.760035013129922 22.53345004376641 23.196198574465424 27.51031636863824 72-73 26.8935097668557 22.25582860743541 23.125393824826716 27.72526780088217 74-75 27.218559837728197 22.401115618661258 23.5420892494929 26.838235294117645 76-77 26.90452006094464 23.704926358557643 23.08278313864906 26.307770441848653 78-79 26.266870384517443 22.650878533231474 23.27476445123504 27.807486631016044 80-81 26.18441161487519 23.26795720835456 23.57361181864493 26.974019358125318 82-83 26.974267968056786 22.93066294840918 22.740524781341108 27.354544302192927 84-85 26.670002501876404 22.17913435076307 23.73029772329247 27.420565424068048 86-87 27.0875 22.55 22.650000000000002 27.712500000000002 88-89 25.821831869510664 22.77289836888331 22.685069008782936 28.72020075282309 90-91 27.4420372481946 22.89370328138857 23.4131508931965 26.25110857722032 92-93 26.270862530258633 22.85641482991464 23.327812460186014 27.54491017964072 94-95 27.175708296277474 22.56384195146741 23.08474145597764 27.175708296277474 96-97 27.525 22.425 23.0875 26.9625 98-99 27.63207428786548 22.951436817668466 22.34910277324633 27.067386121219727 100 27.348274993704358 21.934021657013346 22.73986401410224 27.977839335180054 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 1.0 12 1.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 2.0 20 2.5 21 2.5 22 3.0 23 5.0 24 4.0 25 3.5 26 3.5 27 4.0 28 8.5 29 10.5 30 9.5 31 12.5 32 14.0 33 12.5 34 18.5 35 26.0 36 27.5 37 38.5 38 52.5 39 69.0 40 82.0 41 105.0 42 120.5 43 119.5 44 133.0 45 147.0 46 156.5 47 156.5 48 148.0 49 141.5 50 130.0 51 120.0 52 115.0 53 106.0 54 108.0 55 103.5 56 90.5 57 89.0 58 92.5 59 86.5 60 83.5 61 83.0 62 91.0 63 89.5 64 86.5 65 99.0 66 92.0 67 90.0 68 94.0 69 78.0 70 62.5 71 56.0 72 47.0 73 44.5 74 44.0 75 39.0 76 30.5 77 19.0 78 19.0 79 18.5 80 15.0 81 11.5 82 5.0 83 2.5 84 2.0 85 4.0 86 3.0 87 1.5 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.675 3 1.625 4 1.975 5 2.1999999999999997 6 1.975 7 2.0 8 2.725 9 2.3 10-11 1.0375 12-13 0.6125 14-15 0.775 16-17 0.475 18-19 0.975 20-21 1.5125 22-23 1.925 24-25 3.3000000000000003 26-27 0.0125 28-29 0.1625 30-31 0.95 32-33 0.4875 34-35 0.0 36-37 0.0 38-39 0.3875 40-41 1.25 42-43 2.3125 44-45 1.3625 46-47 0.0 48-49 0.36250000000000004 50-51 0.17500000000000002 52-53 0.025 54-55 0.675 56-57 1.05 58-59 1.725 60-61 1.95 62-63 0.2875 64-65 0.2625 66-67 0.11249999999999999 68-69 0.0 70-71 0.0375 72-73 0.8125 74-75 1.4000000000000001 76-77 1.55 78-79 1.825 80-81 1.8499999999999999 82-83 1.3875 84-85 0.075 86-87 0.0 88-89 0.375 90-91 1.3375 92-93 1.8875 94-95 1.6125 96-97 0.0 98-99 0.3875 100 0.7250000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.45271629778672035 0.8999999999999999 3 0.07545271629778671 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854972 spots for SRR28040801.sra Written 854972 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra Read 854971 spots for SRR28040801.sra Written 854971 spots for SRR28040801.sra SRR ids: ['SRR28040801.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9t5defnb SRR28040801.sra spots: 17099421 blocks: [[1, 854971], [854972, 1709942], [1709943, 2564913], [2564914, 3419884], [3419885, 4274855], [4274856, 5129826], [5129827, 5984797], [5984798, 6839768], [6839769, 7694739], [7694740, 8549710], [8549711, 9404681], [9404682, 10259652], [10259653, 11114623], [11114624, 11969594], [11969595, 12824565], [12824566, 13679536], [13679537, 14534507], [14534508, 15389478], [15389479, 16244449], [16244450, 17099421]] SRR28040801 file size 4456110 SRR28040801 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040801 SRR28040801_1.fastq SRR28040801_2.fastq Input file: SRR28040801_1.fastq Paired file: SRR28040801_2.fastq trimmed: SRR28040801-trimmed-pair1.fastq, SRR28040801-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:35:55 2024 >> started Fri Dec 6 13:36:12 2024 >> done (16.975s) 17099421 read pairs processed; of these: 128245 ( 0.75%) short read pairs filtered out after trimming by size control 67103 ( 0.39%) empty read pairs filtered out after trimming by size control 16904073 (98.86%) read pairs available; of these: 4963802 (29.36%) trimmed read pairs available after processing 11940271 (70.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 60 0.00% 19 108 0.00% 20 177 0.00% 21 315 0.00% 22 476 0.00% 23 716 0.00% 24 933 0.01% 25 1212 0.01% 26 1488 0.01% 27 1769 0.01% 28 2074 0.01% 29 2587 0.02% 30 2843 0.02% 31 3383 0.02% 32 3767 0.02% 33 4005 0.02% 34 4323 0.03% 35 4745 0.03% 36 5234 0.03% 37 5471 0.03% 38 5844 0.03% 39 6060 0.04% 40 6575 0.04% 41 7036 0.04% 42 7398 0.04% 43 7901 0.05% 44 8305 0.05% 45 8732 0.05% 46 9204 0.05% 47 9635 0.06% 48 10171 0.06% 49 10696 0.06% 50 11332 0.07% 51 11991 0.07% 52 12610 0.07% 53 13391 0.08% 54 14177 0.08% 55 15344 0.09% 56 16470 0.10% 57 18260 0.11% 58 19638 0.12% 59 31270 0.18% 60 32847 0.19% 61 31684 0.19% 62 34624 0.20% 63 36223 0.21% 64 37933 0.22% 65 40260 0.24% 66 41968 0.25% 67 43127 0.26% 68 43648 0.26% 69 47716 0.28% 70 44852 0.27% 71 45867 0.27% 72 47560 0.28% 73 47081 0.28% 74 46448 0.27% 75 44531 0.26% 76 47806 0.28% 77 53870 0.32% 78 53936 0.32% 79 56062 0.33% 80 59432 0.35% 81 62686 0.37% 82 67998 0.40% 83 72166 0.43% 84 76171 0.45% 85 82861 0.49% 86 88691 0.52% 87 95519 0.57% 88 94688 0.56% 89 105991 0.63% 90 117103 0.69% 91 130324 0.77% 92 147188 0.87% 93 166028 0.98% 94 195876 1.16% 95 239804 1.42% 96 294851 1.74% 97 384403 2.27% 98 527348 3.12% 99 768905 4.55% 100 11940271 70.64% 16904073 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.68 fanout-score-rank=8 prefix-density=0.34 prefix-fanout=4.3 sequence=ACCTCCTCCAGCTCCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=231.37 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=26.0 sequence=GCCGCCGCCGCC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.0 sequence=ATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=222.75 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=24.5 sequence=GCCGCCGCCACC SRR28040801 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:36:50 Started mapping on | Dec 06 13:36:50 Finished on | Dec 06 13:37:36 Mapping speed, Million of reads per hour | 1322.93 Number of input reads | 16904073 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 16450505 Uniquely mapped reads % | 97.32% Average mapped length | 191.71 Number of splices: Total | 9568433 Number of splices: Annotated (sjdb) | 9096447 Number of splices: GT/AG | 9430487 Number of splices: GC/AG | 117845 Number of splices: AT/AC | 4182 Number of splices: Non-canonical | 15919 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.07 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 176271 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 13630 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.09% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 341366 341366 341366 N_multimapping 176271 176271 176271 N_noFeature 506898 8244213 8405982 N_ambiguous 355328 25386 25042 UnstrandedReadsAssigned:15588279 PositiveStrandReadsAssigned:8180906 NegativeStrandReadsAssigned:8019481 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040801 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040801-trimmed-pair1.fastq SRR28040801-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,904,073 reads, 16,061,293 reads pseudoaligned [quant] estimated average fragment length: 178.554 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR28040801.ke.tsv 35125 SRR28040801.se.tsv 88098 total ==> SRR28040801.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 758.545 0 0 PNS24247 1044 866.446 51.3228 4.92597 PNS24249 1928 1750.45 111.559 5.30004 PNS24246 1044 866.446 51.3228 4.92597 PNS24248 1044 866.446 51.3228 4.92597 PNS24244 1471 1293.45 53.4724 3.43798 PNS24243 293 122.704 2 1.35548 KQK14069 1603 1425.45 1484.79 86.6234 KQK14071 474 297.473 179.276 50.1185 ==> SRR28040801.se.tsv <== BRADI_1g14170v3 1723 BRADI_1g53295v3 29 BRADI_1g59795v3 549 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 805 BRADI_1g74790v3 282 BRADI_1g09890v3 1 BRADI_1g77505v3 258 BRADI_1g48960v3 0 SRR28040801 completed mapping pipeline successfully