Starting /dee2/code/volunteer_pipeline.sh SRR28040802 current disk space = 1551057022976 free memory = 1309656536 SRR28040802 SRAfilesize 3dd9a7f561f8999aa63db6dd8cd6e38d SRR28040802.sra SRR28040802.sra file validated SRR28040802 is paired end SRR28040802 is conventional basespace SRR28040802 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040802_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1445 34.0 31.0 34.0 31.0 34.0 2 32.66875 34.0 31.0 34.0 31.0 34.0 3 32.9255 34.0 31.0 34.0 31.0 34.0 4 36.383 37.0 37.0 37.0 35.0 37.0 5 36.32025 37.0 37.0 37.0 35.0 37.0 6 36.37925 37.0 37.0 37.0 35.0 37.0 7 36.34525 37.0 37.0 37.0 35.0 37.0 8 36.32175 37.0 37.0 37.0 35.0 37.0 9 38.14325 39.0 39.0 39.0 37.0 39.0 10-11 38.083625 39.0 39.0 39.0 36.0 39.0 12-13 38.058875 39.0 39.0 39.0 35.0 39.0 14-15 39.606375 41.0 39.5 41.0 37.0 41.0 16-17 39.6365 41.0 40.0 41.0 37.0 41.0 18-19 39.584625 41.0 40.0 41.0 37.0 41.0 20-21 39.501 41.0 39.0 41.0 37.0 41.0 22-23 39.334875 41.0 39.0 41.0 36.0 41.0 24-25 39.2325 41.0 39.0 41.0 36.0 41.0 26-27 39.07275 40.0 39.0 41.0 35.0 41.0 28-29 38.942 40.0 38.0 41.0 35.0 41.0 30-31 38.7795 40.0 38.0 41.0 35.0 41.0 32-33 38.700125 40.0 38.0 41.0 34.5 41.0 34-35 38.703875 40.0 38.0 41.0 34.0 41.0 36-37 38.74275 40.0 38.0 41.0 35.0 41.0 38-39 38.68175 40.0 38.0 41.0 34.5 41.0 40-41 38.505125 40.0 38.0 41.0 34.0 41.0 42-43 38.295625 40.0 37.0 41.0 33.5 41.0 44-45 38.141999999999996 40.0 36.5 41.0 33.0 41.0 46-47 37.9215 40.0 36.0 41.0 33.0 41.0 48-49 37.960625 40.0 35.5 41.0 33.0 41.0 50-51 37.664125 40.0 35.0 41.0 33.0 41.0 52-53 37.526 39.0 35.0 41.0 33.0 41.0 54-55 37.336125 39.0 35.0 41.0 33.0 41.0 56-57 37.145125 39.0 35.0 41.0 33.0 41.0 58-59 36.851 38.0 35.0 41.0 32.0 41.0 60-61 36.5135 37.5 35.0 40.5 32.0 41.0 62-63 36.118 37.0 35.0 40.0 31.0 41.0 64-65 35.902125 36.5 35.0 40.0 31.0 41.0 66-67 35.5725 36.0 35.0 39.0 31.0 41.0 68-69 35.146375 35.0 34.0 39.0 30.5 41.0 70-71 34.7225 35.0 34.0 38.0 30.0 40.0 72-73 34.458625 35.0 34.0 37.0 30.0 39.5 74-75 34.112375 35.0 34.0 37.0 30.0 39.0 76-77 32.581 34.5 32.0 35.5 27.5 37.0 78-79 33.490625 35.0 33.5 36.0 29.0 37.0 80-81 33.369 35.0 34.0 35.5 29.0 37.0 82-83 33.159375 35.0 34.0 35.0 29.0 37.0 84-85 32.845749999999995 35.0 33.0 35.0 29.0 36.0 86-87 32.5695 35.0 33.0 35.0 28.5 36.0 88-89 32.479 35.0 33.0 35.0 28.0 36.0 90-91 32.350375 35.0 33.0 35.0 28.0 35.0 92-93 31.966375 35.0 33.0 35.0 26.5 35.0 94-95 31.933125 35.0 33.0 35.0 27.0 35.0 96-97 31.79475 35.0 33.0 35.0 26.0 35.0 98-99 31.456 35.0 33.0 35.0 25.0 35.0 100 31.4385 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.4703525641025621 1101 2 -0.1394230769230731 1101 3 -0.0835336538461533 1101 4 0.0540865384615401 1101 5 0.0026041666666714036 1101 6 -0.0448717948717956 1101 7 -0.0172275641025621 1101 8 -0.0526842948717956 1101 9 -0.0326522435897445 1101 10-11 -0.0634014423076934 1101 12-13 -0.171875 1101 14-15 -0.1467347756410291 1101 16-17 0.0209334935897445 1101 18-19 -0.062399839743584096 1101 20-21 -0.055188301282058205 1101 22-23 -0.0375600961538467 1101 24-25 0.0706129807692335 1101 26-27 0.028545673076926903 1101 28-29 0.1696714743589709 1101 30-31 0.2353766025641022 1101 32-33 0.0514823717948758 1101 34-35 0.0884415064102555 1101 36-37 0.0392628205128176 1101 38-39 0.0885416666666643 1101 40-41 0.185296474358978 1101 42-43 0.1124799679487225 1101 44-45 0.1215945512820582 1101 46-47 0.3804086538461533 1101 48-49 0.3541666666666643 1101 50-51 0.4031450320512775 1101 52-53 0.4703525641025692 1101 54-55 0.4072516025641022 1101 56-57 0.2438902243589709 1101 58-59 0.1888020833333286 1101 60-61 0.3509615384615401 1101 62-63 0.3680889423076934 1101 64-65 0.2702323717948758 1101 66-67 0.3100961538461533 1101 68-69 0.3316306089743577 1101 70-71 0.419671474358978 1101 72-73 0.2357772435897445 1101 74-75 0.5385616987179418 1101 76-77 0.6665665064102555 1101 78-79 0.3295272435897445 1101 80-81 0.2431891025641022 1101 82-83 -0.0225360576923066 1101 84-85 -0.1623597756410291 1101 86-87 0.3053886217948758 1101 88-89 0.1425280448717956 1101 90-91 -0.020833333333335702 1101 92-93 0.25741185897436125 1101 94-95 0.20512820512820795 1101 96-97 0.36848958333333215 1101 98-99 0.2964743589743577 1101 100 0.0444711538461533 1104 1 0.4703525641025621 1104 2 0.1394230769230802 1104 3 0.0835336538461533 1104 4 -0.0540865384615401 1104 5 -0.002604166666664298 1104 6 0.044871794871788495 1104 7 0.0172275641025621 1104 8 0.052684294871788495 1104 9 0.0326522435897445 1104 10-11 0.0634014423076934 1104 12-13 0.171875 1104 14-15 0.1467347756410291 1104 16-17 -0.020933493589737395 1104 18-19 0.0623998397435912 1104 20-21 0.0551883012820511 1104 22-23 0.0375600961538467 1104 24-25 -0.0706129807692264 1104 26-27 -0.028545673076919797 1104 28-29 -0.1696714743589709 1104 30-31 -0.2353766025641022 1104 32-33 -0.0514823717948758 1104 34-35 -0.0884415064102555 1104 36-37 -0.0392628205128247 1104 38-39 -0.0885416666666643 1104 40-41 -0.1852964743589709 1104 42-43 -0.1124799679487225 1104 44-45 -0.1215945512820511 1104 46-47 -0.3804086538461533 1104 48-49 -0.3541666666666643 1104 50-51 -0.4031450320512775 1104 52-53 -0.4703525641025692 1104 54-55 -0.4072516025641022 1104 56-57 -0.2438902243589709 1104 58-59 -0.1888020833333357 1104 60-61 -0.3509615384615401 1104 62-63 -0.3680889423076934 1104 64-65 -0.2702323717948687 1104 66-67 -0.3100961538461533 1104 68-69 -0.3316306089743577 1104 70-71 -0.4196714743589709 1104 72-73 -0.2357772435897445 1104 74-75 -0.5385616987179489 1104 76-77 -0.6665665064102555 1104 78-79 -0.3295272435897374 1104 80-81 -0.2431891025641022 1104 82-83 0.0225360576923066 1104 84-85 0.1623597756410291 1104 86-87 -0.30538862179487225 1104 88-89 -0.1425280448717885 1104 90-91 0.020833333333335702 1104 92-93 -0.25741185897436125 1104 94-95 -0.2051282051282044 1104 96-97 -0.36848958333333215 1104 98-99 -0.29647435897436125 1104 100 -0.0444711538461533 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 5.0 17 5.0 18 8.0 19 6.0 20 12.0 21 14.0 22 7.0 23 17.0 24 16.0 25 13.0 26 29.0 27 28.0 28 38.0 29 52.0 30 62.0 31 77.0 32 107.0 33 142.0 34 188.0 35 316.0 36 609.0 37 895.0 38 1140.0 39 212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.128073770491806 11.885245901639344 10.19467213114754 52.792008196721305 2 24.175 18.425 32.824999999999996 24.575 3 25.124999999999996 20.674999999999997 22.425 31.775 4 29.049999999999997 26.224999999999998 17.625 27.1 5 29.25 29.475 20.95 20.325 6 24.55 32.725 19.375 23.35 7 21.45 18.825 36.325 23.400000000000002 8 21.65 23.075000000000003 26.724999999999998 28.549999999999997 9 22.95 20.05 30.5 26.5 10-11 25.424999999999997 30.112499999999997 20.6875 23.775 12-13 23.7375 23.2625 25.5625 27.437499999999996 14-15 24.0 24.5625 25.0125 26.424999999999997 16-17 25.124999999999996 24.2875 25.137500000000003 25.45 18-19 24.975 24.762500000000003 24.1125 26.150000000000002 20-21 24.975 24.825 24.2625 25.937500000000004 22-23 25.424999999999997 24.4875 24.125 25.9625 24-25 25.162499999999998 25.874999999999996 23.6125 25.35 26-27 26.174999999999997 25.1875 23.962500000000002 24.675 28-29 25.2375 25.05 23.7625 25.95 30-31 25.5125 25.525 23.6625 25.3 32-33 24.3875 26.0 24.325 25.2875 34-35 24.553069133641706 25.015626953369168 24.24053006625828 26.190773846730842 36-37 25.074999999999996 24.825 24.05 26.05 38-39 24.712500000000002 25.05 24.887500000000003 25.35 40-41 25.5375 25.275 23.7875 25.4 42-43 25.424999999999997 25.7 23.8125 25.0625 44-45 25.137500000000003 25.0375 24.349999999999998 25.474999999999998 46-47 25.687500000000004 24.625 23.65 26.0375 48-49 25.724999999999998 24.15 23.724999999999998 26.400000000000002 50-51 24.65 24.45 24.275 26.625 52-53 25.362499999999997 24.975 24.1375 25.525 54-55 25.3125 24.8125 24.337500000000002 25.5375 56-57 25.224999999999998 25.35 23.5875 25.837500000000002 58-59 26.0 24.587500000000002 24.5625 24.85 60-61 25.8625 24.85 24.0125 25.275 62-63 26.0125 25.0 24.125 24.8625 64-65 25.724999999999998 24.7375 23.674999999999997 25.8625 66-67 25.074999999999996 24.4875 24.462500000000002 25.974999999999998 68-69 26.35 24.3 24.337500000000002 25.0125 70-71 25.7375 24.825 23.95 25.4875 72-73 25.775 24.025 24.1875 26.0125 74-75 25.2875 24.525 25.0375 25.15 76-77 25.275 24.5125 24.712500000000002 25.5 78-79 25.525 24.962500000000002 24.425 25.087500000000002 80-81 25.900000000000002 24.4875 23.7375 25.874999999999996 82-83 26.1125 24.6 23.8875 25.4 84-85 25.35 24.9875 24.05 25.6125 86-87 25.15 24.887500000000003 24.1375 25.825 88-89 25.724999999999998 24.275 24.175 25.825 90-91 26.0125 24.2375 23.8375 25.912499999999998 92-93 26.387500000000003 25.0 23.825 24.7875 94-95 26.187500000000004 24.825 24.212500000000002 24.775 96-97 26.375 24.3625 24.15 25.112499999999997 98-99 26.075 25.337500000000002 23.974999999999998 24.6125 100 26.025 24.825 23.799999999999997 25.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.5 29 2.5 30 5.0 31 8.0 32 13.5 33 17.5 34 28.0 35 42.0 36 43.5 37 53.0 38 68.0 39 84.5 40 104.5 41 118.5 42 134.0 43 164.0 44 176.0 45 173.5 46 180.0 47 181.0 48 180.5 49 169.0 50 144.5 51 140.0 52 149.5 53 131.0 54 103.0 55 101.0 56 102.0 57 99.5 58 86.5 59 70.0 60 77.5 61 79.0 62 71.0 63 79.0 64 74.0 65 57.0 66 54.5 67 55.5 68 52.5 69 39.0 70 37.5 71 50.5 72 45.5 73 31.0 74 23.0 75 20.5 76 22.5 77 17.5 78 10.5 79 7.0 80 4.0 81 3.5 82 2.5 83 2.5 84 1.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040802 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040802_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.863 34.0 31.0 34.0 31.0 34.0 2 32.934 34.0 33.0 34.0 31.0 34.0 3 33.04275 34.0 33.0 34.0 31.0 34.0 4 36.36675 37.0 37.0 37.0 35.0 37.0 5 36.27925 37.0 37.0 37.0 35.0 37.0 6 36.25 37.0 37.0 37.0 35.0 37.0 7 36.2285 37.0 37.0 37.0 35.0 37.0 8 36.26975 37.0 37.0 37.0 35.0 37.0 9 38.056 39.0 39.0 39.0 35.0 39.0 10-11 38.067125000000004 39.0 39.0 39.0 36.0 39.0 12-13 38.074250000000006 39.0 39.0 39.0 35.0 39.0 14-15 39.530874999999995 41.0 40.0 41.0 37.0 41.0 16-17 39.49787499999999 41.0 40.0 41.0 36.5 41.0 18-19 39.5235 41.0 39.5 41.0 36.5 41.0 20-21 39.45525 41.0 39.0 41.0 36.0 41.0 22-23 39.4135 41.0 39.0 41.0 36.0 41.0 24-25 39.447375 41.0 39.0 41.0 36.0 41.0 26-27 39.334875 41.0 39.0 41.0 36.0 41.0 28-29 39.183 41.0 39.0 41.0 35.5 41.0 30-31 39.074749999999995 41.0 39.0 41.0 35.0 41.0 32-33 38.874375 40.5 38.0 41.0 35.0 41.0 34-35 38.694 40.0 38.0 41.0 34.0 41.0 36-37 38.652 40.0 38.0 41.0 34.5 41.0 38-39 38.4185 40.0 38.0 41.0 34.0 41.0 40-41 38.238749999999996 40.0 37.0 41.0 33.0 41.0 42-43 37.98675 40.0 37.0 41.0 33.0 41.0 44-45 37.799625 40.0 36.0 41.0 33.0 41.0 46-47 37.657624999999996 40.0 36.0 41.0 33.0 41.0 48-49 37.541250000000005 39.5 35.0 41.0 32.5 41.0 50-51 36.305499999999995 38.0 34.0 40.0 30.5 40.5 52-53 36.26475 38.0 34.5 39.5 30.5 40.5 54-55 36.872875 39.0 35.0 40.5 31.0 41.0 56-57 36.849125 39.0 35.0 41.0 31.5 41.0 58-59 36.9685 38.5 35.0 41.0 32.0 41.0 60-61 36.86475 38.0 35.0 41.0 32.0 41.0 62-63 36.4855 37.0 35.0 40.5 32.0 41.0 64-65 36.219375 37.0 35.0 40.0 31.0 41.0 66-67 35.920875 36.0 35.0 39.0 31.0 41.0 68-69 35.584374999999994 35.5 35.0 39.0 31.0 41.0 70-71 35.185625 35.0 35.0 38.5 31.0 41.0 72-73 34.8785 35.0 35.0 37.0 31.0 39.5 74-75 34.48525 35.0 34.0 37.0 30.0 39.0 76-77 34.208625 35.0 34.0 36.5 30.0 39.0 78-79 33.855625 35.0 34.0 36.0 29.5 37.5 80-81 33.521625 35.0 34.0 35.5 29.5 37.0 82-83 33.390625 35.0 34.0 35.0 29.0 37.0 84-85 33.14125 35.0 34.0 35.0 29.0 36.0 86-87 32.951 35.0 33.5 35.0 29.0 36.0 88-89 32.6735 35.0 33.0 35.0 28.0 36.0 90-91 32.510125 35.0 33.0 35.0 28.5 35.5 92-93 32.356375 35.0 33.0 35.0 27.0 35.0 94-95 32.1965 35.0 33.0 35.0 27.0 35.0 96-97 32.000750000000004 35.0 33.0 35.0 27.0 35.0 98-99 31.696125000000002 35.0 33.0 35.0 26.0 35.0 100 31.4825 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 6.009615384598987E-4 1101 2 -0.0981570512820511 1101 3 -0.0975560897435912 1101 4 0.0214342948717956 1101 5 -0.1099759615384599 1101 6 0.005608974358978003 1101 7 -0.1854967948717956 1101 8 -0.1179887820512846 1101 9 -0.1602564102564088 1101 10-11 -0.3356370192307665 1101 12-13 -0.186398237179489 1101 14-15 -0.1247996794871824 1101 16-17 -0.078125 1101 18-19 0.0472756410256423 1101 20-21 0.1258012820512846 1101 22-23 0.008213141025642301 1101 24-25 -0.1080729166666643 1101 26-27 -0.008814102564109305 1101 28-29 -0.0087139423076934 1101 30-31 -0.1585536858974379 1101 32-33 0.1842948717948758 1101 34-35 -0.0570913461538467 1101 36-37 0.0382612179487154 1101 38-39 0.2391826923076934 1101 40-41 0.1949118589743577 1101 42-43 -0.032051282051277497 1101 44-45 0.0982572115384599 1101 46-47 0.2380809294871824 1101 48-49 0.1890024038461533 1101 50-51 0.2335737179487225 1101 52-53 0.4526241987179489 1101 54-55 0.3257211538461533 1101 56-57 0.3707932692307665 1101 58-59 0.6311097756410291 1101 60-61 0.3289262820512775 1101 62-63 0.2793469551282044 1101 64-65 0.3863181089743648 1101 66-67 0.1394230769230802 1101 68-69 0.3977363782051242 1101 70-71 0.7309695512820511 1101 72-73 0.5087139423076934 1101 74-75 0.5044070512820511 1101 76-77 0.2005208333333357 1101 78-79 0.0903445512820582 1101 80-81 -0.0416666666666643 1101 82-83 0.1737780448717956 1101 84-85 0.3709935897435912 1101 86-87 -0.0660056089743577 1101 88-89 0.0973557692307665 1101 90-91 0.0324519230769269 1101 92-93 0.023938301282054653 1101 94-95 -0.16075721153846345 1101 96-97 -0.2798477564102555 1101 98-99 0.20122195512820795 1101 100 0.12620192307692335 1104 1 -6.009615384598987E-4 1104 2 0.0981570512820511 1104 3 0.0975560897435912 1104 4 -0.021434294871788495 1104 5 0.1099759615384599 1104 6 -0.005608974358970897 1104 7 0.1854967948717885 1104 8 0.1179887820512846 1104 9 0.1602564102564088 1104 10-11 0.3356370192307736 1104 12-13 0.1863982371794819 1104 14-15 0.1247996794871824 1104 16-17 0.078125 1104 18-19 -0.0472756410256423 1104 20-21 -0.1258012820512775 1104 22-23 -0.008213141025642301 1104 24-25 0.1080729166666643 1104 26-27 0.0088141025641022 1104 28-29 0.0087139423076934 1104 30-31 0.1585536858974308 1104 32-33 -0.1842948717948687 1104 34-35 0.0570913461538467 1104 36-37 -0.038261217948722503 1104 38-39 -0.2391826923076934 1104 40-41 -0.1949118589743577 1104 42-43 0.032051282051277497 1104 44-45 -0.0982572115384599 1104 46-47 -0.2380809294871824 1104 48-49 -0.1890024038461533 1104 50-51 -0.2335737179487225 1104 52-53 -0.4526241987179489 1104 54-55 -0.3257211538461533 1104 56-57 -0.3707932692307736 1104 58-59 -0.6311097756410291 1104 60-61 -0.3289262820512775 1104 62-63 -0.2793469551282044 1104 64-65 -0.3863181089743577 1104 66-67 -0.1394230769230802 1104 68-69 -0.3977363782051313 1104 70-71 -0.7309695512820511 1104 72-73 -0.5087139423076934 1104 74-75 -0.504407051282044 1104 76-77 -0.2005208333333357 1104 78-79 -0.0903445512820511 1104 80-81 0.0416666666666643 1104 82-83 -0.1737780448717956 1104 84-85 -0.3709935897435841 1104 86-87 0.0660056089743577 1104 88-89 -0.0973557692307736 1104 90-91 -0.0324519230769198 1104 92-93 -0.0239383012820511 1104 94-95 0.1607572115384599 1104 96-97 0.2798477564102555 1104 98-99 -0.2012219551282044 1104 100 -0.12620192307692335 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 5.0 16 2.0 17 5.0 18 5.0 19 3.0 20 11.0 21 11.0 22 12.0 23 14.0 24 20.0 25 18.0 26 27.0 27 28.0 28 33.0 29 47.0 30 55.0 31 72.0 32 94.0 33 154.0 34 205.0 35 318.0 36 559.0 37 948.0 38 1118.0 39 236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.275 11.15 10.8 53.77499999999999 2 22.95 18.5 32.550000000000004 26.0 3 24.15 21.075 23.1 31.674999999999997 4 28.4 25.95 16.525000000000002 29.125 5 29.9 27.725 20.525 21.85 6 24.125 33.025 20.424999999999997 22.425 7 21.775 18.525 36.225 23.474999999999998 8 21.4 22.375 27.425 28.799999999999997 9 21.775 21.0 30.275000000000002 26.950000000000003 10-11 25.575 29.25 21.099999999999998 24.075 12-13 24.2875 23.575 25.0625 27.075 14-15 25.224999999999998 24.224999999999998 24.8 25.75 16-17 25.687500000000004 24.6875 23.3375 26.2875 18-19 25.224999999999998 24.9875 23.7 26.087500000000002 20-21 25.4875 24.5375 24.375 25.6 22-23 24.462500000000002 25.337500000000002 23.7125 26.487500000000004 24-25 25.2 24.75 24.3 25.75 26-27 24.7875 25.4375 24.5625 25.2125 28-29 25.074999999999996 23.7375 24.7 26.487500000000004 30-31 25.074999999999996 24.7875 23.8625 26.275 32-33 25.412499999999998 24.4875 25.0125 25.087500000000002 34-35 24.85 24.7875 24.525 25.837500000000002 36-37 25.6125 24.4375 23.8875 26.0625 38-39 25.074999999999996 24.875 24.025 26.025 40-41 25.7 24.2625 24.425 25.6125 42-43 24.95 23.35 25.2875 26.4125 44-45 24.4125 24.887500000000003 24.9125 25.7875 46-47 26.087500000000002 24.349999999999998 23.674999999999997 25.887500000000003 48-49 25.724999999999998 24.087500000000002 24.4125 25.775 50-51 24.7 24.575 24.85 25.874999999999996 52-53 25.7625 24.1125 24.587500000000002 25.5375 54-55 25.25 24.55 24.325 25.874999999999996 56-57 25.2625 24.8 24.5375 25.4 58-59 25.0375 24.2375 24.0125 26.7125 60-61 25.937500000000004 24.2375 24.3 25.525 62-63 25.7375 24.2375 24.5375 25.4875 64-65 25.624999999999996 25.1 23.4125 25.8625 66-67 24.712500000000002 25.1875 24.125 25.974999999999998 68-69 25.0 25.0125 24.675 25.3125 70-71 25.1 24.2 24.462500000000002 26.237500000000004 72-73 24.6875 24.275 25.337500000000002 25.7 74-75 24.85 25.362499999999997 24.175 25.6125 76-77 25.825 24.0125 24.5125 25.650000000000002 78-79 25.025 24.525 25.2625 25.1875 80-81 25.4 24.1625 25.174999999999997 25.2625 82-83 26.575 23.8125 24.725 24.887500000000003 84-85 25.95 23.425 25.1 25.525 86-87 25.587500000000002 23.75 25.35 25.3125 88-89 25.7 24.637500000000003 24.6875 24.975 90-91 25.4875 23.400000000000002 24.4375 26.674999999999997 92-93 25.674999999999997 25.162499999999998 23.974999999999998 25.1875 94-95 27.0125 24.587500000000002 24.0 24.4 96-97 26.150000000000002 24.887500000000003 23.2875 25.674999999999997 98-99 26.0625 25.2625 23.7875 24.887500000000003 100 25.674999999999997 25.05 24.325 24.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.0 28 1.0 29 0.0 30 2.0 31 6.5 32 10.0 33 14.0 34 21.0 35 27.5 36 37.0 37 57.5 38 82.0 39 88.5 40 94.5 41 126.5 42 152.0 43 150.0 44 160.5 45 179.5 46 186.5 47 195.0 48 182.5 49 167.0 50 166.0 51 153.5 52 129.5 53 112.5 54 114.5 55 108.5 56 97.0 57 95.0 58 85.5 59 77.0 60 79.5 61 68.5 62 64.0 63 67.5 64 65.5 65 67.5 66 56.5 67 61.5 68 66.0 69 59.0 70 45.5 71 36.0 72 37.0 73 33.0 74 29.0 75 17.5 76 16.0 77 15.0 78 10.5 79 8.0 80 3.0 81 3.0 82 3.5 83 1.5 84 0.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839423 spots for SRR28040802.sra Written 839423 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra Read 839406 spots for SRR28040802.sra Written 839406 spots for SRR28040802.sra SRR ids: ['SRR28040802.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u36rbi_4 SRR28040802.sra spots: 16788137 blocks: [[1, 839406], [839407, 1678812], [1678813, 2518218], [2518219, 3357624], [3357625, 4197030], [4197031, 5036436], [5036437, 5875842], [5875843, 6715248], [6715249, 7554654], [7554655, 8394060], [8394061, 9233466], [9233467, 10072872], [10072873, 10912278], [10912279, 11751684], [11751685, 12591090], [12591091, 13430496], [13430497, 14269902], [14269903, 15109308], [15109309, 15948714], [15948715, 16788137]] SRR28040802 file size 4374639 SRR28040802 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040802 SRR28040802_1.fastq SRR28040802_2.fastq Input file: SRR28040802_1.fastq Paired file: SRR28040802_2.fastq trimmed: SRR28040802-trimmed-pair1.fastq, SRR28040802-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:36:47 2024 >> started Fri Dec 6 13:37:08 2024 >> done (20.546s) 16788137 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 16788137 (100.00%) read pairs available; of these: 2862601 (17.05%) trimmed read pairs available after processing 13925536 (82.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 4 0.00% 52 28 0.00% 53 81 0.00% 54 153 0.00% 55 262 0.00% 56 315 0.00% 57 499 0.00% 58 646 0.00% 59 912 0.01% 60 1079 0.01% 61 1281 0.01% 62 1552 0.01% 63 1777 0.01% 64 2070 0.01% 65 2346 0.01% 66 2595 0.02% 67 3005 0.02% 68 3393 0.02% 69 3616 0.02% 70 4206 0.03% 71 4771 0.03% 72 5563 0.03% 73 6207 0.04% 74 7223 0.04% 75 11710 0.07% 76 19997 0.12% 77 24855 0.15% 78 27464 0.16% 79 30442 0.18% 80 32908 0.20% 81 35261 0.21% 82 37647 0.22% 83 39562 0.24% 84 41348 0.25% 85 43738 0.26% 86 46710 0.28% 87 49798 0.30% 88 43242 0.26% 89 50830 0.30% 90 58065 0.35% 91 158296 0.94% 92 170543 1.02% 93 185323 1.10% 94 201284 1.20% 95 220517 1.31% 96 246717 1.47% 97 288479 1.72% 98 350527 2.09% 99 393754 2.35% 100 13925536 82.95% 16788137 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=148.56 fanout-score-rank=16 prefix-density=0.89 prefix-fanout=21.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=341.07 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=32.0 sequence=AGCAGCAGCAGG criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=152.53 fanout-score-rank=18 prefix-density=0.92 prefix-fanout=21.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=412.14 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=21.4 sequence=CGCCGCCGCCACC SRR28040802 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:37:52 Started mapping on | Dec 06 13:37:52 Finished on | Dec 06 13:38:36 Mapping speed, Million of reads per hour | 1373.57 Number of input reads | 16788137 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 16249781 Uniquely mapped reads % | 96.79% Average mapped length | 196.74 Number of splices: Total | 9825485 Number of splices: Annotated (sjdb) | 9272965 Number of splices: GT/AG | 9678224 Number of splices: GC/AG | 120898 Number of splices: AT/AC | 7052 Number of splices: Non-canonical | 19311 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 200441 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 21650 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.20% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 337934 337934 337934 N_multimapping 200441 200441 200441 N_noFeature 702497 8294593 8399181 N_ambiguous 291179 17909 17644 UnstrandedReadsAssigned:15256105 PositiveStrandReadsAssigned:7937279 NegativeStrandReadsAssigned:7832956 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040802 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040802-trimmed-pair1.fastq SRR28040802-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,788,137 reads, 15,650,564 reads pseudoaligned [quant] estimated average fragment length: 171.705 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52973 SRR28040802.ke.tsv 35125 SRR28040802.se.tsv 88098 total ==> SRR28040802.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.504 0 0 PNS24247 1044 873.295 51.6328 5.57371 PNS24249 1928 1757.3 168.648 9.04726 PNS24246 1044 873.295 51.6328 5.57371 PNS24248 1044 873.295 51.6328 5.57371 PNS24244 1471 1300.3 104.454 7.57289 PNS24243 293 135.446 13 9.04807 KQK14069 1603 1432.3 1626.15 107.031 KQK14071 474 305.814 37.3304 11.5076 ==> SRR28040802.se.tsv <== BRADI_1g14170v3 1725 BRADI_1g53295v3 63 BRADI_1g59795v3 411 BRADI_1g07683v3 0 BRADI_1g00485v3 55 BRADI_1g20270v3 882 BRADI_1g74790v3 231 BRADI_1g09890v3 2 BRADI_1g77505v3 204 BRADI_1g48960v3 0 SRR28040802 completed mapping pipeline successfully