Starting /dee2/code/volunteer_pipeline.sh SRR28040803 current disk space = 1551062810624 free memory = 1597723572 SRR28040803 SRAfilesize 2f9ec03b8e4b81364beea7b9c56ee79e SRR28040803.sra SRR28040803.sra file validated SRR28040803 is paired end SRR28040803 is conventional basespace SRR28040803 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040803_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.21475 34.0 31.0 34.0 31.0 34.0 2 32.649 34.0 31.0 34.0 31.0 34.0 3 32.868 34.0 31.0 34.0 31.0 34.0 4 36.369 37.0 37.0 37.0 35.0 37.0 5 36.233 37.0 37.0 37.0 35.0 37.0 6 36.274 37.0 37.0 37.0 35.0 37.0 7 36.17725 37.0 37.0 37.0 35.0 37.0 8 36.15525 37.0 37.0 37.0 35.0 37.0 9 38.01675 39.0 38.0 39.0 35.0 39.0 10-11 38.03037500000001 39.0 38.0 39.0 35.0 39.0 12-13 37.949375 39.0 38.0 39.0 35.0 39.0 14-15 39.416124999999994 41.0 39.0 41.0 36.0 41.0 16-17 39.300625 41.0 39.0 41.0 36.0 41.0 18-19 39.218875 41.0 39.0 41.0 36.0 41.0 20-21 39.209999999999994 40.5 39.0 41.0 36.0 41.0 22-23 39.109750000000005 40.0 38.5 41.0 35.5 41.0 24-25 38.897875 40.0 38.0 41.0 35.0 41.0 26-27 38.683 40.0 38.0 41.0 34.5 41.0 28-29 38.637375 40.0 38.0 41.0 34.0 41.0 30-31 38.238375000000005 40.0 38.0 41.0 33.0 41.0 32-33 38.121375 40.0 37.5 41.0 33.0 41.0 34-35 38.077125 40.0 37.5 41.0 33.0 41.0 36-37 38.14475 40.0 37.0 41.0 33.0 41.0 38-39 38.15875 40.0 37.0 41.0 33.0 41.0 40-41 37.959375 40.0 36.5 41.0 33.0 41.0 42-43 37.830625 40.0 36.0 41.0 33.0 41.0 44-45 37.622249999999994 40.0 35.5 41.0 32.5 41.0 46-47 37.178749999999994 39.0 35.0 41.0 31.0 41.0 48-49 37.29575 39.0 35.0 41.0 32.0 41.0 50-51 37.097 39.0 35.0 41.0 31.5 41.0 52-53 36.889624999999995 38.5 35.0 41.0 31.5 41.0 54-55 36.6255 38.0 35.0 41.0 31.0 41.0 56-57 36.34725 37.5 35.0 40.5 31.0 41.0 58-59 36.207375 37.0 35.0 40.0 31.0 41.0 60-61 35.867875 36.5 34.5 40.0 30.5 41.0 62-63 35.448 36.0 34.0 39.5 30.0 41.0 64-65 35.115624999999994 35.0 34.0 39.0 29.0 41.0 66-67 34.619625 35.0 33.5 39.0 28.5 41.0 68-69 34.257374999999996 35.0 33.0 38.0 28.5 40.5 70-71 33.934625 35.0 33.0 37.0 28.0 39.5 72-73 33.516625000000005 35.0 33.0 37.0 26.5 39.0 74-75 33.131375 35.0 33.0 36.0 26.0 39.0 76-77 31.341250000000002 33.5 30.0 35.0 24.0 36.5 78-79 32.5045 35.0 32.5 35.0 26.0 37.0 80-81 32.475750000000005 35.0 33.0 35.0 26.5 37.0 82-83 32.239875 35.0 33.0 35.0 25.5 36.0 84-85 32.054 35.0 33.0 35.0 25.5 36.0 86-87 31.756500000000003 35.0 32.0 35.0 25.0 36.0 88-89 31.562 35.0 32.0 35.0 24.5 35.5 90-91 31.13975 35.0 31.5 35.0 23.5 35.0 92-93 30.954875 34.5 31.5 35.0 23.0 35.0 94-95 30.752875 34.0 31.0 35.0 21.5 35.0 96-97 30.500999999999998 34.0 31.0 35.0 19.0 35.0 98-99 30.054000000000002 34.0 31.0 35.0 12.5 35.0 100 29.6665 34.0 31.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.6193028135190488 1101 2 -0.35759245683662755 1101 3 0.02045046639197068 1101 4 -0.15657625319143165 1101 5 0.041545539573796475 1101 6 0.015710710584187382 1101 7 0.04258196617710297 1101 8 0.04246821203771134 1101 9 0.021069794484191107 1101 10-11 0.047170049799035496 1101 12-13 0.0193634823933877 1101 14-15 0.037368234788544896 1101 16-17 0.1914798149599335 1101 18-19 0.09744305973355694 1101 20-21 0.04865517328547497 1101 22-23 -0.15461083444981227 1101 24-25 0.021764958669329815 1101 26-27 6.319674410804055E-5 1101 28-29 0.10692257134912353 1101 30-31 0.31900452488687847 1101 32-33 0.14363987967340108 1101 34-35 0.05094289542202546 1101 36-37 0.10393336535302211 1101 38-39 0.024343385828764497 1101 40-41 0.0947951161556162 1101 42-43 0.12190019970171306 1101 44-45 0.34683005131575584 1101 46-47 0.20976895270355556 1101 48-49 0.0453879016153067 1101 50-51 0.24543087540129704 1101 52-53 0.23916807806062224 1101 54-55 0.10555120200206858 1101 56-57 -0.03976971106448701 1101 58-59 0.14810788948153686 1101 60-61 -0.022384286761550243 1101 62-63 0.19869056346217207 1101 64-65 -0.10618316944311346 1101 66-67 0.3246037564144686 1101 68-69 0.03474556990823885 1101 70-71 0.020753810763665115 1101 72-73 0.14456887181172107 1101 74-75 -0.05991051341035103 1101 76-77 -0.05654844662403136 1101 78-79 -0.3505207411714153 1101 80-81 0.0026542632523600673 1101 82-83 0.009473191941154369 1101 84-85 -0.20495336080285398 1101 86-87 -0.2176938244141624 1101 88-89 -0.24110189843019114 1101 90-91 -0.25914456887181103 1101 92-93 -0.36803887863697327 1101 94-95 -0.6210280846330818 1101 96-97 -1.1246871761166872 1101 98-99 -0.5786041103162383 1101 100 -0.6452640359968669 1104 1 0.6193028135190417 1104 2 0.35759245683662044 1104 3 -0.02045046639197068 1104 4 0.15657625319143875 1104 5 -0.04154553957380358 1104 6 -0.015710710584194487 1104 7 -0.04258196617710297 1104 8 -0.042468212037718445 1104 9 -0.021069794484184 1104 10-11 -0.047170049799035496 1104 12-13 -0.0193634823933877 1104 14-15 -0.037368234788544896 1104 16-17 -0.1914798149599335 1104 18-19 -0.09744305973356404 1104 20-21 -0.04865517328546787 1104 22-23 0.15461083444981227 1104 24-25 -0.021764958669329815 1104 26-27 -6.319674410093512E-5 1104 28-29 -0.10692257134912353 1104 30-31 -0.31900452488687847 1104 32-33 -0.14363987967340108 1104 34-35 -0.050942895422032564 1104 36-37 -0.103933365353015 1104 38-39 -0.02434338582875739 1104 40-41 -0.0947951161556233 1104 42-43 -0.12190019970170596 1104 44-45 -0.34683005131575584 1104 46-47 -0.20976895270355556 1104 48-49 -0.04538790161531381 1104 50-51 -0.24543087540130415 1104 52-53 -0.23916807806061513 1104 54-55 -0.10555120200206858 1104 56-57 0.03976971106448701 1104 58-59 -0.14810788948152975 1104 60-61 0.022384286761550243 1104 62-63 -0.19869056346217207 1104 64-65 0.10618316944311346 1104 66-67 -0.3246037564144686 1104 68-69 -0.03474556990823885 1104 70-71 -0.020753810763665115 1104 72-73 -0.14456887181172107 1104 74-75 0.05991051341035103 1104 76-77 0.05654844662403136 1104 78-79 0.3505207411714082 1104 80-81 -0.002654263252352962 1104 82-83 -0.009473191941154369 1104 84-85 0.20495336080284687 1104 86-87 0.2176938244141695 1104 88-89 0.24110189843019114 1104 90-91 0.2591445688718146 1104 92-93 0.36803887863697327 1104 94-95 0.6210280846330818 1104 96-97 1.1246871761166872 1104 98-99 0.5786041103162383 1104 100 0.6452640359968669 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 5.0 17 3.0 18 11.0 19 13.0 20 16.0 21 17.0 22 13.0 23 20.0 24 15.0 25 30.0 26 32.0 27 44.0 28 71.0 29 61.0 30 96.0 31 109.0 32 138.0 33 170.0 34 279.0 35 385.0 36 583.0 37 825.0 38 912.0 39 149.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.24961870869344 11.032028469750891 12.73512963904423 48.98322318251144 2 26.0 18.55 28.199999999999996 27.250000000000004 3 28.499999999999996 20.825 20.325 30.349999999999998 4 31.525 22.85 17.25 28.375 5 30.225 29.5 19.3 20.974999999999998 6 26.200000000000003 33.800000000000004 19.425 20.575 7 22.875 19.525000000000002 34.825 22.775000000000002 8 23.1 23.175 25.15 28.575 9 22.125 20.575 30.225 27.075 10-11 25.6125 28.8625 20.2375 25.2875 12-13 25.674999999999997 22.9375 24.5 26.887499999999996 14-15 25.087500000000002 24.5375 24.3125 26.0625 16-17 26.5375 23.599999999999998 23.3125 26.55 18-19 26.3125 25.087500000000002 22.6875 25.912499999999998 20-21 26.724999999999998 23.599999999999998 23.7625 25.912499999999998 22-23 25.1 24.4 23.2625 27.237499999999997 24-25 26.2125 24.3 23.2375 26.25 26-27 25.324999999999996 24.7 23.674999999999997 26.3 28-29 26.6125 23.962500000000002 23.3 26.125 30-31 25.8 24.675 22.975 26.55 32-33 25.15 24.5 23.7875 26.5625 34-35 25.95 24.275 23.6875 26.087500000000002 36-37 26.075 24.6 22.825 26.5 38-39 25.2875 25.174999999999997 23.5875 25.95 40-41 25.374999999999996 24.725 23.2375 26.6625 42-43 25.4625 23.575 23.4375 27.525 44-45 25.7125 24.4375 23.225 26.625 46-47 26.487500000000004 24.075 23.7125 25.724999999999998 48-49 25.674999999999997 24.1875 24.224999999999998 25.912499999999998 50-51 25.937500000000004 24.5375 23.8125 25.7125 52-53 26.325 24.212500000000002 22.662499999999998 26.8 54-55 25.9875 24.3125 23.525 26.174999999999997 56-57 25.937500000000004 24.2875 23.325000000000003 26.450000000000003 58-59 25.8625 23.775 23.4875 26.875 60-61 26.0 24.3 23.6125 26.087500000000002 62-63 26.125 24.425 24.2375 25.2125 64-65 26.900000000000002 23.7125 23.674999999999997 25.7125 66-67 26.887499999999996 23.1375 24.2625 25.7125 68-69 26.125 23.5125 23.7875 26.575 70-71 26.900000000000002 23.1875 23.5375 26.375 72-73 25.6125 24.2 23.724999999999998 26.4625 74-75 26.125 23.3125 24.45 26.1125 76-77 25.9625 23.2375 24.275 26.525 78-79 25.8625 23.9125 23.75 26.474999999999998 80-81 26.174999999999997 23.0125 24.0 26.8125 82-83 26.075 24.0625 23.425 26.437500000000004 84-85 25.974999999999998 23.3875 24.5125 26.125 86-87 26.674999999999997 23.7375 23.599999999999998 25.9875 88-89 26.3125 23.8375 23.4875 26.3625 90-91 26.737499999999997 23.8375 23.5 25.924999999999997 92-93 27.5625 23.5125 22.8 26.125 94-95 26.775 24.2625 23.2375 25.724999999999998 96-97 26.5625 24.925 23.3125 25.2 98-99 27.4125 22.75 23.400000000000002 26.437500000000004 100 26.525 24.125 23.25 26.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 0.0 27 1.0 28 3.0 29 3.0 30 4.5 31 9.0 32 14.5 33 19.5 34 21.0 35 25.5 36 39.5 37 53.5 38 65.5 39 79.0 40 111.0 41 135.0 42 143.5 43 152.0 44 151.5 45 153.5 46 158.0 47 156.0 48 143.5 49 144.0 50 140.5 51 135.5 52 118.5 53 97.0 54 102.0 55 100.0 56 92.0 57 78.5 58 80.0 59 89.0 60 86.0 61 85.0 62 86.0 63 88.0 64 77.0 65 76.0 66 80.0 67 76.0 68 75.0 69 71.0 70 58.0 71 47.5 72 42.0 73 42.5 74 47.0 75 37.5 76 27.0 77 22.5 78 14.5 79 10.0 80 9.0 81 6.0 82 4.0 83 4.0 84 3.0 85 1.0 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040803 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040803_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.761 34.0 31.0 34.0 31.0 34.0 2 32.762 34.0 31.0 34.0 31.0 34.0 3 32.86325 34.0 31.0 34.0 31.0 34.0 4 36.19275 37.0 37.0 37.0 35.0 37.0 5 36.14575 37.0 37.0 37.0 35.0 37.0 6 36.16975 37.0 37.0 37.0 35.0 37.0 7 36.25225 37.0 37.0 37.0 35.0 37.0 8 36.211 37.0 37.0 37.0 35.0 37.0 9 37.88375 39.0 38.0 39.0 35.0 39.0 10-11 37.929375 39.0 38.0 39.0 35.0 39.0 12-13 37.926125 39.0 38.0 39.0 35.0 39.0 14-15 39.41925 41.0 39.0 41.0 36.5 41.0 16-17 39.2635 41.0 39.0 41.0 36.0 41.0 18-19 39.247375000000005 41.0 39.0 41.0 36.0 41.0 20-21 39.240875 41.0 39.0 41.0 36.0 41.0 22-23 39.223375000000004 41.0 39.0 41.0 36.0 41.0 24-25 39.1075 41.0 39.0 41.0 35.5 41.0 26-27 39.0185 41.0 39.0 41.0 35.0 41.0 28-29 38.939125 40.0 38.0 41.0 35.0 41.0 30-31 38.74125 40.0 38.0 41.0 34.5 41.0 32-33 38.552625 40.0 38.0 41.0 34.0 41.0 34-35 38.415375 40.0 38.0 41.0 34.0 41.0 36-37 38.21025 40.0 37.5 41.0 33.0 41.0 38-39 38.027875 40.0 37.0 41.0 33.0 41.0 40-41 37.80025 40.0 36.5 41.0 33.0 41.0 42-43 37.633125 40.0 35.5 41.0 32.5 41.0 44-45 37.3245 39.0 35.0 41.0 32.0 41.0 46-47 37.09225 39.0 35.0 41.0 31.0 41.0 48-49 37.038250000000005 39.0 35.0 41.0 31.0 41.0 50-51 35.769625 38.0 34.0 40.0 29.5 40.5 52-53 35.87025 37.5 33.5 39.5 30.0 40.5 54-55 36.209625 38.0 35.0 40.0 30.0 41.0 56-57 36.194500000000005 37.5 34.5 40.5 30.5 41.0 58-59 36.330124999999995 37.0 35.0 41.0 31.0 41.0 60-61 36.316874999999996 37.0 35.0 40.5 31.0 41.0 62-63 35.969375 36.0 35.0 40.0 31.0 41.0 64-65 35.629625 36.0 35.0 39.5 30.5 41.0 66-67 35.370999999999995 35.0 34.0 39.0 30.0 41.0 68-69 35.052 35.0 34.0 39.0 30.0 41.0 70-71 34.791875 35.0 34.0 37.5 30.0 40.5 72-73 34.468625 35.0 34.0 37.0 30.0 39.5 74-75 34.103 35.0 34.0 36.5 29.0 39.0 76-77 33.73575 35.0 33.5 36.0 29.0 39.0 78-79 33.598875 35.0 33.5 36.0 29.0 37.0 80-81 33.243375 35.0 33.0 35.0 29.0 37.0 82-83 32.93 35.0 33.0 35.0 28.0 36.5 84-85 32.65375 35.0 33.0 35.0 27.0 36.0 86-87 32.619125 35.0 33.0 35.0 28.0 36.0 88-89 32.293625 35.0 33.0 35.0 27.0 36.0 90-91 32.14475 35.0 33.0 35.0 27.0 35.0 92-93 31.74025 35.0 32.5 35.0 25.0 35.0 94-95 31.423125 35.0 32.0 35.0 24.0 35.0 96-97 31.156125000000003 35.0 32.0 35.0 23.5 35.0 98-99 31.026 35.0 32.0 35.0 24.0 35.0 100 30.66375 35.0 32.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.015811825374754562 1101 2 -0.019022219975227017 1101 3 -0.11097348264618034 1101 4 -0.012727824262491083 1101 5 -0.014990267701413984 1101 6 0.0491417882150742 1101 7 -0.016608104350467556 1101 8 0.005346444551172169 1101 9 0.11427235268838842 1101 10-11 -0.008190298035849253 1101 12-13 -0.03697641497510773 1101 14-15 -0.09930736368462334 1101 16-17 0.0646186708460803 1101 18-19 -0.09706387926894422 1101 20-21 0.01769508834904343 1101 22-23 -0.03237569200435075 1101 24-25 0.08041153719759819 1101 26-27 0.019559392300109835 1101 28-29 0.07046436967566905 1101 30-31 -0.06856214767815061 1101 32-33 0.10035642963674718 1101 34-35 0.09168583634571092 1101 36-37 -0.024469779316966367 1101 38-39 -0.02323112313253972 1101 40-41 0.019414039788664184 1101 42-43 0.07750448696883439 1101 44-45 0.3050064460678996 1101 46-47 0.18928056826511863 1101 48-49 -0.15713870421395626 1101 50-51 -0.021644884855533064 1101 52-53 0.09722187112920011 1101 54-55 0.11575115650041568 1101 56-57 -0.08328066937991707 1101 58-59 -0.14329229758082818 1101 60-61 -0.11223109785383656 1101 62-63 -0.09132561490432067 1101 64-65 -0.04533102454561799 1101 66-67 0.19032331454283735 1101 68-69 0.09326575494830536 1101 70-71 -0.012670947192795268 1101 72-73 -0.17186354559012784 1101 74-75 -0.13127859652670537 1101 76-77 0.19945524406583104 1101 78-79 -0.1484933896205689 1101 80-81 -0.00852524077959771 1101 82-83 0.08312267751965408 1101 84-85 0.2792727318688506 1101 86-87 0.15431380975252296 1101 88-89 0.21932430041204043 1101 90-91 -0.09124345913699017 1101 92-93 0.062191915872496395 1101 94-95 0.12703177532293708 1101 96-97 -0.051593821886299907 1101 98-99 -0.044894967011302356 1101 100 -0.1255972092317812 1104 1 0.015811825374761668 1104 2 0.019022219975227017 1104 3 0.11097348264617324 1104 4 0.012727824262498189 1104 5 0.014990267701406879 1104 6 -0.049141788215067095 1104 7 0.01660810435046045 1104 8 -0.005346444551179275 1104 9 -0.11427235268839553 1104 10-11 0.008190298035849253 1104 12-13 0.036976414975100624 1104 14-15 0.09930736368462334 1104 16-17 -0.0646186708460732 1104 18-19 0.09706387926894422 1104 20-21 -0.017695088349050536 1104 22-23 0.03237569200435075 1104 24-25 -0.0804115371976053 1104 26-27 -0.019559392300109835 1104 28-29 -0.07046436967567615 1104 30-31 0.06856214767815061 1104 32-33 -0.10035642963674718 1104 34-35 -0.09168583634571092 1104 36-37 0.024469779316973472 1104 38-39 0.023231123132532616 1104 40-41 -0.01941403978867129 1104 42-43 -0.07750448696882728 1104 44-45 -0.3050064460678996 1104 46-47 -0.18928056826511863 1104 48-49 0.15713870421395626 1104 50-51 0.021644884855533064 1104 52-53 -0.09722187112920011 1104 54-55 -0.11575115650041568 1104 56-57 0.08328066937991707 1104 58-59 0.14329229758082818 1104 60-61 0.11223109785383656 1104 62-63 0.09132561490432067 1104 64-65 0.04533102454561799 1104 66-67 -0.19032331454283735 1104 68-69 -0.09326575494830536 1104 70-71 0.012670947192802373 1104 72-73 0.17186354559013495 1104 74-75 0.13127859652670537 1104 76-77 -0.19945524406582393 1104 78-79 0.1484933896205618 1104 80-81 0.008525240779590604 1104 82-83 -0.08312267751965408 1104 84-85 -0.2792727318688577 1104 86-87 -0.15431380975252296 1104 88-89 -0.21932430041204753 1104 90-91 0.09124345913698306 1104 92-93 -0.06219191587249284 1104 94-95 -0.12703177532293353 1104 96-97 0.051593821886299907 1104 98-99 0.0448949670112988 1104 100 0.1255972092317812 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 6.0 17 5.0 18 11.0 19 3.0 20 10.0 21 10.0 22 15.0 23 15.0 24 15.0 25 22.0 26 33.0 27 34.0 28 54.0 29 72.0 30 56.0 31 108.0 32 115.0 33 178.0 34 250.0 35 342.0 36 648.0 37 855.0 38 931.0 39 211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.724999999999998 10.549999999999999 12.85 50.875 2 25.95 17.0 28.575 28.475 3 27.375 18.85 21.525 32.25 4 28.225 24.349999999999998 17.299999999999997 30.125 5 31.075000000000003 27.05 20.025000000000002 21.85 6 25.25 32.775 18.2 23.775 7 21.825 20.4 34.050000000000004 23.724999999999998 8 23.799999999999997 23.200000000000003 25.624999999999996 27.375 9 23.825 20.625 28.199999999999996 27.35 10-11 26.424999999999997 28.075 20.0875 25.412499999999998 12-13 24.4375 23.5875 25.2125 26.7625 14-15 25.3 23.6875 24.2625 26.75 16-17 26.674999999999997 24.2625 22.6 26.4625 18-19 25.4 25.15 22.85 26.6 20-21 25.4375 24.7375 23.4125 26.4125 22-23 25.587500000000002 23.974999999999998 23.6625 26.775 24-25 25.2625 24.85 23.25 26.637499999999996 26-27 25.7875 25.687500000000004 22.662499999999998 25.8625 28-29 25.7125 24.474999999999998 23.625 26.187500000000004 30-31 24.725 24.2625 24.45 26.5625 32-33 25.5625 24.325 23.7375 26.375 34-35 26.3 23.525 23.825 26.35 36-37 25.974999999999998 24.5375 23.25 26.237500000000004 38-39 25.224999999999998 23.8625 23.9375 26.974999999999998 40-41 25.837500000000002 24.725 23.0875 26.35 42-43 25.7125 24.975 23.0625 26.25 44-45 25.55 24.975 23.5 25.974999999999998 46-47 26.087500000000002 23.775 23.325000000000003 26.8125 48-49 25.2125 23.875 24.3625 26.55 50-51 25.5625 24.75 24.0 25.687500000000004 52-53 25.8 23.0375 24.1625 27.0 54-55 25.35 24.375 24.099999999999998 26.174999999999997 56-57 26.575 24.25 23.325000000000003 25.85 58-59 25.662499999999998 24.1125 23.6125 26.6125 60-61 25.937500000000004 23.974999999999998 23.625 26.4625 62-63 26.3 23.25 23.849999999999998 26.6 64-65 26.125 23.724999999999998 24.325 25.825 66-67 25.7875 23.2625 24.5125 26.437500000000004 68-69 26.775 23.1375 23.425 26.6625 70-71 26.525 23.75 23.4125 26.3125 72-73 26.1625 24.0 23.025000000000002 26.8125 74-75 25.5625 23.962500000000002 24.8125 25.662499999999998 76-77 26.0125 23.474999999999998 24.099999999999998 26.4125 78-79 25.912499999999998 23.6875 23.7125 26.687499999999996 80-81 26.8125 24.375 23.2375 25.575 82-83 26.424999999999997 23.5375 23.799999999999997 26.237500000000004 84-85 25.7 23.1875 24.4875 26.625 86-87 26.4125 23.9375 23.9 25.75 88-89 25.7625 23.474999999999998 24.075 26.687499999999996 90-91 26.187500000000004 23.6125 23.200000000000003 27.0 92-93 26.650000000000002 23.724999999999998 23.8375 25.7875 94-95 26.5375 24.474999999999998 22.8375 26.150000000000002 96-97 26.375 23.2875 24.2875 26.05 98-99 27.1625 24.8625 22.35 25.624999999999996 100 27.200000000000003 23.225 23.400000000000002 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.5 28 4.0 29 4.0 30 4.0 31 5.5 32 9.0 33 18.5 34 25.5 35 29.5 36 40.0 37 55.5 38 76.0 39 100.0 40 114.5 41 125.5 42 133.0 43 152.5 44 170.0 45 152.5 46 139.5 47 149.5 48 150.0 49 140.0 50 137.5 51 125.5 52 108.0 53 107.0 54 103.0 55 91.5 56 96.5 57 99.0 58 84.0 59 87.0 60 87.0 61 77.0 62 77.5 63 76.0 64 70.5 65 67.0 66 70.0 67 68.5 68 66.5 69 62.5 70 63.0 71 64.5 72 57.5 73 47.5 74 42.0 75 38.5 76 31.0 77 24.0 78 20.0 79 16.5 80 11.0 81 6.5 82 4.5 83 3.0 84 2.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra Read 877355 spots for SRR28040803.sra Written 877355 spots for SRR28040803.sra Read 877338 spots for SRR28040803.sra Written 877338 spots for SRR28040803.sra SRR ids: ['SRR28040803.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mkutcy13 SRR28040803.sra spots: 17546777 blocks: [[1, 877338], [877339, 1754676], [1754677, 2632014], [2632015, 3509352], [3509353, 4386690], [4386691, 5264028], [5264029, 6141366], [6141367, 7018704], [7018705, 7896042], [7896043, 8773380], [8773381, 9650718], [9650719, 10528056], [10528057, 11405394], [11405395, 12282732], [12282733, 13160070], [13160071, 14037408], [14037409, 14914746], [14914747, 15792084], [15792085, 16669422], [16669423, 17546777]] SRR28040803 file size 4572778 SRR28040803 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040803 SRR28040803_1.fastq SRR28040803_2.fastq Input file: SRR28040803_1.fastq Paired file: SRR28040803_2.fastq trimmed: SRR28040803-trimmed-pair1.fastq, SRR28040803-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:36:06 2024 >> started Fri Dec 6 13:36:23 2024 >> done (16.123s) 17546777 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 17546777 (100.00%) read pairs available; of these: 3335962 (19.01%) trimmed read pairs available after processing 14210815 (80.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 11 0.00% 52 61 0.00% 53 142 0.00% 54 228 0.00% 55 373 0.00% 56 588 0.00% 57 755 0.00% 58 1048 0.01% 59 1387 0.01% 60 1712 0.01% 61 2099 0.01% 62 2477 0.01% 63 2883 0.02% 64 3251 0.02% 65 3763 0.02% 66 4138 0.02% 67 4613 0.03% 68 5259 0.03% 69 5765 0.03% 70 6391 0.04% 71 7295 0.04% 72 8279 0.05% 73 9399 0.05% 74 10965 0.06% 75 16962 0.10% 76 28297 0.16% 77 34449 0.20% 78 38061 0.22% 79 40903 0.23% 80 44268 0.25% 81 47010 0.27% 82 50611 0.29% 83 53142 0.30% 84 56383 0.32% 85 59437 0.34% 86 62730 0.36% 87 67127 0.38% 88 55892 0.32% 89 67543 0.38% 90 76837 0.44% 91 157823 0.90% 92 176536 1.01% 93 196499 1.12% 94 217949 1.24% 95 242920 1.38% 96 273408 1.56% 97 327819 1.87% 98 403135 2.30% 99 457339 2.61% 100 14210815 80.99% 17546777 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=25 prefix-density=0.23 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=184.85 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=22.4 sequence=GCCGCCGCCGCCA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=26 prefix-density=0.23 prefix-fanout=2.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=177.66 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=22.1 sequence=GCCGCCGCCGCCA SRR28040803 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:36:57 Started mapping on | Dec 06 13:36:57 Finished on | Dec 06 13:37:39 Mapping speed, Million of reads per hour | 1504.01 Number of input reads | 17546777 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 17183785 Uniquely mapped reads % | 97.93% Average mapped length | 196.20 Number of splices: Total | 9150163 Number of splices: Annotated (sjdb) | 8641432 Number of splices: GT/AG | 9014192 Number of splices: GC/AG | 111539 Number of splices: AT/AC | 3288 Number of splices: Non-canonical | 21144 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 144841 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 6761 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.02% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 218193 218193 218193 N_multimapping 144841 144841 144841 N_noFeature 579483 8647078 8754578 N_ambiguous 416282 29096 28492 UnstrandedReadsAssigned:16188020 PositiveStrandReadsAssigned:8507611 NegativeStrandReadsAssigned:8400715 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040803 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040803-trimmed-pair1.fastq SRR28040803-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,546,777 reads, 16,670,808 reads pseudoaligned [quant] estimated average fragment length: 173.514 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR28040803.ke.tsv 35125 SRR28040803.se.tsv 88098 total ==> SRR28040803.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 763.546 0 0 PNS24247 1044 871.486 30.1045 2.67963 PNS24249 1928 1755.49 76.6795 3.38833 PNS24246 1044 871.486 30.1045 2.67963 PNS24248 1044 871.486 30.1045 2.67963 PNS24244 1471 1298.49 112.007 6.69132 PNS24243 293 133.993 5 2.89462 KQK14069 1603 1430.49 901.785 48.9016 KQK14071 474 303.738 46.8328 11.9606 ==> SRR28040803.se.tsv <== BRADI_1g14170v3 990 BRADI_1g53295v3 42 BRADI_1g59795v3 878 BRADI_1g07683v3 1 BRADI_1g00485v3 18 BRADI_1g20270v3 740 BRADI_1g74790v3 417 BRADI_1g09890v3 8 BRADI_1g77505v3 290 BRADI_1g48960v3 2 SRR28040803 completed mapping pipeline successfully