Starting /dee2/code/volunteer_pipeline.sh SRR28040804 current disk space = 1550861361152 free memory = 1354496744 SRR28040804 SRAfilesize a5b8cfb5268c5de80fc37b7d49c9bbd5 SRR28040804.sra SRR28040804.sra file validated SRR28040804 is paired end SRR28040804 is conventional basespace SRR28040804 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040804_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.212 33.0 31.0 34.0 31.0 34.0 2 32.60425 34.0 31.0 34.0 31.0 34.0 3 32.74275 34.0 31.0 34.0 31.0 34.0 4 36.25875 37.0 37.0 37.0 35.0 37.0 5 36.12175 37.0 35.0 37.0 35.0 37.0 6 36.033 37.0 35.0 37.0 35.0 37.0 7 35.91775 37.0 35.0 37.0 35.0 37.0 8 35.94075 37.0 35.0 37.0 35.0 37.0 9 37.639 39.0 37.0 39.0 35.0 39.0 10-11 37.680499999999995 39.0 37.0 39.0 35.0 39.0 12-13 37.684625 39.0 37.0 39.0 35.0 39.0 14-15 38.8885 40.0 38.0 41.0 35.0 41.0 16-17 38.903999999999996 40.0 38.0 41.0 36.0 41.0 18-19 38.838750000000005 40.0 38.0 41.0 35.0 41.0 20-21 38.762875 40.0 38.0 41.0 34.5 41.0 22-23 38.675625 40.0 38.0 41.0 34.5 41.0 24-25 38.551249999999996 40.0 38.0 41.0 34.0 41.0 26-27 38.30825 40.0 38.0 41.0 34.0 41.0 28-29 38.12125 40.0 37.5 41.0 33.5 41.0 30-31 37.951499999999996 40.0 37.0 41.0 33.0 41.0 32-33 37.733374999999995 40.0 37.0 41.0 33.0 41.0 34-35 37.436875 39.0 36.0 40.0 32.0 41.0 36-37 37.23475 39.0 36.0 40.0 31.0 41.0 38-39 37.563625 39.0 36.0 41.0 32.5 41.0 40-41 37.49925 39.0 35.5 41.0 32.5 41.0 42-43 37.351 39.0 35.0 41.0 32.0 41.0 44-45 37.081375 39.0 35.0 40.0 31.0 41.0 46-47 36.845 38.0 35.0 40.0 31.0 41.0 48-49 36.674125000000004 38.0 35.0 40.0 31.0 41.0 50-51 36.553375 38.0 35.0 40.0 31.0 41.0 52-53 36.336375000000004 38.0 34.5 40.0 31.0 41.0 54-55 35.843625 37.0 34.0 40.0 29.5 41.0 56-57 35.537125 36.5 34.0 40.0 29.0 41.0 58-59 35.12325 36.0 33.0 40.0 28.0 41.0 60-61 35.095749999999995 36.0 33.5 39.0 28.5 41.0 62-63 34.825874999999996 35.0 33.0 39.0 28.0 41.0 64-65 34.457 35.0 33.0 39.0 27.5 40.5 66-67 34.17475 35.0 33.0 38.0 27.5 40.0 68-69 33.90775 35.0 33.0 37.0 27.5 40.0 70-71 33.510374999999996 35.0 33.0 37.0 26.5 39.0 72-73 33.23325 35.0 33.0 36.0 26.0 39.0 74-75 32.771875 35.0 32.0 36.0 26.0 38.5 76-77 31.753875 33.5 30.5 35.0 25.5 37.0 78-79 32.583875 35.0 32.5 35.0 27.0 37.0 80-81 32.479375000000005 35.0 33.0 35.0 27.0 36.5 82-83 32.178375 35.0 32.0 35.0 26.5 36.0 84-85 31.920125 35.0 32.0 35.0 25.5 36.0 86-87 31.616625 34.0 32.0 35.0 24.5 35.5 88-89 31.52225 34.0 32.0 35.0 25.0 35.0 90-91 31.332375 34.0 31.5 35.0 24.5 35.0 92-93 30.915 34.0 31.0 35.0 23.0 35.0 94-95 30.7295 34.0 31.0 35.0 21.5 35.0 96-97 30.523125 34.0 31.0 35.0 23.0 35.0 98-99 30.202875 34.0 31.0 35.0 19.0 35.0 100 29.7645 34.0 31.0 35.0 15.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.225649350649352 1101 2 -0.140625 1101 3 0.03956980519480169 1101 4 -0.004870129870134576 1101 5 0.02577110389610482 1101 6 -0.11911525974026205 1101 7 0.0050730519480524094 1101 8 -0.03287337662337109 1101 9 0.02577110389610482 1101 10-11 -0.09638798701298867 1101 12-13 -0.19094967532467422 1101 14-15 -0.14194399350649434 1101 16-17 -0.3738839285714306 1101 18-19 -0.28540990259740084 1101 20-21 -0.13179788961038952 1101 22-23 -0.22362012987013458 1101 24-25 -0.2706980519480595 1101 26-27 -0.2766842532467493 1101 28-29 -0.2192573051948017 1101 30-31 -0.06381899350649434 1101 32-33 -0.4016842532467493 1101 34-35 -0.6117086038961048 1101 36-37 -0.1629464285714306 1101 38-39 -0.0776176948051912 1101 40-41 -0.19886363636364024 1101 42-43 -0.1522930194805241 1101 44-45 -0.15432224025973795 1101 46-47 -0.34841720779220964 1101 48-49 0.0636160714285765 1101 50-51 -0.18932629870129603 1101 52-53 -0.17451298701298867 1101 54-55 -0.40868506493507084 1101 56-57 -0.45961850649351277 1101 58-59 -0.5504261363636402 1101 60-61 -0.6935876623376629 1101 62-63 -0.4938108766233782 1101 64-65 -0.7811485389610411 1101 66-67 -0.669947240259738 1101 68-69 -0.7347808441558428 1101 70-71 -0.6472199675324646 1101 72-73 -0.720779220779221 1101 74-75 -0.8624188311688314 1101 76-77 -0.728591720779221 1101 78-79 -0.8242694805194759 1101 80-81 -0.7672483766233782 1101 82-83 -0.6018668831168803 1101 84-85 -0.7772930194805205 1101 86-87 -0.7223011363636331 1101 88-89 -0.7038352272727266 1101 90-91 -0.9439935064935057 1101 92-93 -0.9422686688311686 1101 94-95 -1.0348011363636367 1101 96-97 -0.8090503246753258 1101 98-99 -0.9752435064935057 1101 100 -0.6921672077922061 1105 1 0.22564935064934843 1105 2 0.140625 1105 3 -0.039569805194808794 1105 4 0.004870129870127471 1105 5 -0.025771103896097713 1105 6 0.11911525974026205 1105 7 -0.0050730519480524094 1105 8 0.03287337662337819 1105 9 -0.025771103896097713 1105 10-11 0.09638798701298867 1105 12-13 0.19094967532467422 1105 14-15 0.14194399350649434 1105 16-17 0.3738839285714306 1105 18-19 0.28540990259740795 1105 20-21 0.13179788961038952 1105 22-23 0.22362012987012747 1105 24-25 0.2706980519480524 1105 26-27 0.2766842532467493 1105 28-29 0.2192573051948088 1105 30-31 0.06381899350649434 1105 32-33 0.4016842532467564 1105 34-35 0.6117086038961048 1105 36-37 0.1629464285714306 1105 38-39 0.0776176948051912 1105 40-41 0.19886363636363313 1105 42-43 0.152293019480517 1105 44-45 0.15432224025973795 1105 46-47 0.34841720779220253 1105 48-49 -0.0636160714285694 1105 50-51 0.18932629870129603 1105 52-53 0.17451298701298867 1105 54-55 0.40868506493506374 1105 56-57 0.45961850649350566 1105 58-59 0.5504261363636331 1105 60-61 0.6935876623376558 1105 62-63 0.4938108766233782 1105 64-65 0.781148538961034 1105 66-67 0.669947240259738 1105 68-69 0.7347808441558428 1105 70-71 0.6472199675324646 1105 72-73 0.720779220779221 1105 74-75 0.8624188311688314 1105 76-77 0.728591720779221 1105 78-79 0.8242694805194759 1105 80-81 0.7672483766233782 1105 82-83 0.6018668831168839 1105 84-85 0.7772930194805241 1105 86-87 0.7223011363636331 1105 88-89 0.7038352272727266 1105 90-91 0.9439935064935057 1105 92-93 0.9422686688311686 1105 94-95 1.0348011363636367 1105 96-97 0.8090503246753222 1105 98-99 0.9752435064935057 1105 100 0.6921672077922096 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 5.0 17 3.0 18 10.0 19 9.0 20 12.0 21 17.0 22 21.0 23 9.0 24 27.0 25 26.0 26 39.0 27 46.0 28 59.0 29 64.0 30 112.0 31 112.0 32 170.0 33 244.0 34 326.0 35 483.0 36 681.0 37 815.0 38 638.0 39 69.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.54205372834547 10.946522721566659 13.155912628671857 48.35551092141602 2 25.4 15.6 29.375 29.625 3 26.1 18.5 23.0 32.4 4 30.099999999999998 22.075 17.549999999999997 30.275000000000002 5 31.674999999999997 25.324999999999996 20.375 22.625 6 25.55 31.075000000000003 19.475 23.9 7 23.200000000000003 17.7 36.65 22.45 8 23.849999999999998 21.875 25.624999999999996 28.65 9 22.755688922230558 20.38009502375594 30.607651912978245 26.25656414103526 10-11 26.6125 27.525 21.512500000000003 24.349999999999998 12-13 25.412499999999998 22.912499999999998 24.5 27.175 14-15 25.924999999999997 24.45 24.224999999999998 25.4 16-17 26.400000000000002 23.925 23.575 26.1 18-19 26.525 23.5375 24.837500000000002 25.1 20-21 25.912499999999998 23.1 24.0375 26.950000000000003 22-23 26.0 23.775 23.375 26.85 24-25 26.224999999999998 24.349999999999998 23.175 26.25 26-27 25.650000000000002 23.974999999999998 23.3875 26.987499999999997 28-29 26.474999999999998 23.65 23.3625 26.5125 30-31 25.324999999999996 23.724999999999998 23.7875 27.1625 32-33 26.174999999999997 23.549999999999997 24.075 26.200000000000003 34-35 25.6125 23.7875 24.0625 26.5375 36-37 25.5375 23.7875 24.349999999999998 26.325 38-39 26.775 23.6125 23.125 26.487500000000004 40-41 26.325 23.8125 23.925 25.937500000000004 42-43 26.0 24.375 23.8625 25.7625 44-45 26.325 23.875 23.825 25.974999999999998 46-47 26.2125 23.4875 23.625 26.674999999999997 48-49 25.8625 24.025 23.8125 26.3 50-51 26.487500000000004 23.6625 24.275 25.575 52-53 26.2875 22.537499999999998 23.525 27.650000000000002 54-55 26.3625 22.9875 23.7125 26.937499999999996 56-57 27.35 23.974999999999998 22.925 25.75 58-59 26.987499999999997 23.1125 23.1125 26.787499999999998 60-61 26.5375 24.1625 23.3 26.0 62-63 26.375 24.337500000000002 22.575 26.7125 64-65 26.075 24.087500000000002 23.2125 26.625 66-67 26.724999999999998 23.7125 24.075 25.4875 68-69 27.0625 23.599999999999998 22.8625 26.474999999999998 70-71 26.5375 24.2875 23.3125 25.8625 72-73 26.474999999999998 24.2 23.1625 26.1625 74-75 27.325 23.4875 23.5625 25.624999999999996 76-77 25.937500000000004 23.6375 24.0 26.424999999999997 78-79 26.1 23.5 24.3125 26.087500000000002 80-81 26.2625 23.599999999999998 23.7 26.437500000000004 82-83 26.450000000000003 23.4875 23.225 26.8375 84-85 26.7125 23.2875 23.0125 26.987499999999997 86-87 26.8 23.7375 22.4625 27.0 88-89 26.0375 24.762500000000003 22.875 26.325 90-91 26.575 24.2875 22.4625 26.674999999999997 92-93 27.212500000000002 23.875 22.787499999999998 26.125 94-95 26.9625 24.6125 22.5 25.924999999999997 96-97 26.487500000000004 23.674999999999997 23.400000000000002 26.437500000000004 98-99 27.125 23.3 23.549999999999997 26.025 100 28.625 22.125 22.475 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.0 28 2.0 29 1.5 30 2.0 31 4.0 32 5.0 33 12.0 34 22.0 35 26.0 36 31.5 37 41.0 38 60.0 39 76.0 40 89.5 41 93.5 42 102.0 43 128.0 44 147.0 45 158.5 46 154.5 47 156.5 48 166.0 49 165.5 50 150.5 51 141.5 52 140.0 53 132.5 54 121.0 55 114.5 56 111.0 57 99.0 58 85.0 59 88.5 60 91.5 61 92.5 62 87.0 63 76.0 64 88.5 65 96.0 66 85.0 67 74.5 68 73.0 69 79.5 70 65.5 71 46.5 72 45.5 73 37.0 74 29.0 75 25.5 76 22.5 77 15.5 78 11.5 79 10.0 80 6.5 81 4.5 82 2.5 83 2.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040804 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040804_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.05575 33.0 31.0 34.0 30.0 34.0 2 32.38275 34.0 31.0 34.0 31.0 34.0 3 32.508 34.0 31.0 34.0 31.0 34.0 4 35.9945 37.0 37.0 37.0 35.0 37.0 5 35.92575 37.0 35.0 37.0 35.0 37.0 6 36.003 37.0 35.0 37.0 35.0 37.0 7 35.91875 37.0 35.0 37.0 35.0 37.0 8 36.0225 37.0 35.0 37.0 35.0 37.0 9 37.6925 39.0 38.0 39.0 35.0 39.0 10-11 37.67875 39.0 37.0 39.0 35.0 39.0 12-13 37.614125 39.0 37.5 39.0 35.0 39.0 14-15 38.99275 40.0 38.0 41.0 35.5 41.0 16-17 38.913250000000005 40.0 38.0 41.0 35.0 41.0 18-19 39.0035 40.0 38.0 41.0 35.5 41.0 20-21 38.83775 40.0 38.0 41.0 35.0 41.0 22-23 38.652875 40.0 38.0 41.0 34.5 41.0 24-25 38.54525 40.0 38.0 41.0 34.0 41.0 26-27 38.473 40.0 38.0 41.0 34.0 41.0 28-29 38.152375 40.0 37.5 41.0 33.0 41.0 30-31 37.97125 40.0 37.5 41.0 33.0 41.0 32-33 37.81 40.0 37.0 41.0 33.0 41.0 34-35 37.602999999999994 39.5 36.5 41.0 32.5 41.0 36-37 37.351124999999996 39.0 36.0 40.5 31.5 41.0 38-39 37.17825 39.0 35.5 40.0 31.5 41.0 40-41 36.943 38.5 35.0 40.0 31.0 41.0 42-43 36.49675 38.0 35.0 40.0 30.0 41.0 44-45 36.524 38.0 35.0 40.0 30.0 41.0 46-47 36.434875 38.0 35.0 40.0 30.0 41.0 48-49 36.195625 38.0 34.5 40.0 29.5 41.0 50-51 35.331875 37.0 33.5 39.5 28.5 40.5 52-53 35.378 37.0 33.0 39.5 29.0 40.0 54-55 35.729875 37.0 34.0 40.0 30.0 41.0 56-57 35.375125 37.0 33.5 40.0 28.0 41.0 58-59 34.931 36.0 33.0 40.0 27.0 41.0 60-61 35.326375 36.0 33.5 39.5 28.5 41.0 62-63 35.30175 35.5 34.0 39.0 29.5 41.0 64-65 35.018 35.0 34.0 39.0 29.0 41.0 66-67 34.627250000000004 35.0 33.0 38.5 29.0 40.5 68-69 34.347375 35.0 33.0 37.5 28.5 40.0 70-71 34.1085 35.0 33.0 37.0 29.0 39.5 72-73 33.639624999999995 35.0 33.0 36.5 28.0 39.0 74-75 33.270125 35.0 33.0 36.0 27.0 39.0 76-77 32.7695 35.0 32.5 35.5 26.0 37.5 78-79 32.3985 35.0 32.0 35.0 25.5 37.0 80-81 32.166125 35.0 32.0 35.0 26.0 36.5 82-83 31.899749999999997 34.5 32.0 35.0 25.0 36.0 84-85 31.562375 34.0 31.5 35.0 24.5 36.0 86-87 31.30775 34.0 31.0 35.0 24.0 35.5 88-89 31.076125 34.0 31.0 35.0 24.0 35.0 90-91 30.595625 34.0 30.5 35.0 21.5 35.0 92-93 30.31225 34.0 30.0 35.0 20.0 35.0 94-95 29.882624999999997 34.0 30.0 35.0 18.0 35.0 96-97 29.54875 34.0 30.0 35.0 11.5 35.0 98-99 28.66875 34.0 29.0 35.0 2.0 35.0 100 28.08375 33.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.11972402597402976 1101 2 0.22625811688312325 1101 3 0.15969967532467422 1101 4 -0.034496753246756384 1101 5 -0.05539772727272663 1101 6 0.011769480519483011 1101 7 0.10978084415584277 1101 8 0.24675324675324362 1101 9 -0.10349025974026205 1101 10-11 -0.05012175324674928 1101 12-13 -0.12226055194805241 1101 14-15 -0.0011160714285693984 1101 16-17 -0.0078125 1101 18-19 0.09080762987012747 1101 20-21 -0.029829545454546746 1101 22-23 -0.038555194805191206 1101 24-25 -1.0146103895891656E-4 1101 26-27 0.0012175324675354204 1101 28-29 -0.08715503246753542 1101 30-31 -0.0870535714285694 1101 32-33 0.16081574675325072 1101 34-35 0.04494724025973795 1101 36-37 0.32721185064934843 1101 38-39 0.1679180194805241 1101 40-41 0.13859577922077904 1101 42-43 0.5027394480519476 1101 44-45 0.31990665584415723 1101 46-47 0.012581168831168554 1101 48-49 0.0033482142857153008 1101 50-51 0.10765016233766289 1101 52-53 -0.13037743506492916 1101 54-55 0.12682629870129603 1101 56-57 0.0602678571428541 1101 58-59 -0.16670048701298867 1101 60-61 -0.06280438311688386 1101 62-63 -0.13971185064934843 1101 64-65 -0.3548092532467493 1101 66-67 -0.3447646103896105 1101 68-69 -0.2956574675324646 1101 70-71 -0.3545048701298654 1101 72-73 -0.24188311688311614 1101 74-75 -0.4496753246753187 1101 76-77 -0.49025974025973795 1101 78-79 -0.4393262987012996 1101 80-81 -0.5515422077922096 1101 82-83 -0.5935470779220822 1101 84-85 -0.5516436688311686 1101 86-87 -0.6336241883116891 1101 88-89 -0.3946834415584419 1101 90-91 -0.33005275974026205 1101 92-93 -0.12936282467532578 1101 94-95 -0.3369521103896105 1101 96-97 -0.06422483766233711 1101 98-99 -0.41274350649350566 1101 100 -0.42552759740259916 1105 1 -0.11972402597402265 1105 2 -0.22625811688311614 1105 3 -0.15969967532467422 1105 4 0.034496753246756384 1105 5 0.05539772727272663 1105 6 -0.011769480519483011 1105 7 -0.10978084415584988 1105 8 -0.24675324675324362 1105 9 0.10349025974026205 1105 10-11 0.05012175324674928 1105 12-13 0.1222605519480453 1105 14-15 0.0011160714285693984 1105 16-17 0.0078125 1105 18-19 -0.09080762987012747 1105 20-21 0.029829545454546746 1105 22-23 0.038555194805191206 1105 24-25 1.0146103896602199E-4 1105 26-27 -0.0012175324675354204 1105 28-29 0.08715503246753542 1105 30-31 0.0870535714285694 1105 32-33 -0.16081574675325072 1105 34-35 -0.04494724025973795 1105 36-37 -0.32721185064935554 1105 38-39 -0.1679180194805241 1105 40-41 -0.13859577922077904 1105 42-43 -0.5027394480519476 1105 44-45 -0.31990665584415723 1105 46-47 -0.012581168831168554 1105 48-49 -0.0033482142857153008 1105 50-51 -0.10765016233765579 1105 52-53 0.13037743506493626 1105 54-55 -0.12682629870129603 1105 56-57 -0.0602678571428541 1105 58-59 0.16670048701298867 1105 60-61 0.06280438311688386 1105 62-63 0.13971185064935554 1105 64-65 0.3548092532467564 1105 66-67 0.3447646103896105 1105 68-69 0.2956574675324646 1105 70-71 0.35450487012987253 1105 72-73 0.24188311688311614 1105 74-75 0.4496753246753258 1105 76-77 0.49025974025973795 1105 78-79 0.439326298701296 1105 80-81 0.5515422077922096 1105 82-83 0.5935470779220751 1105 84-85 0.5516436688311686 1105 86-87 0.6336241883116891 1105 88-89 0.3946834415584419 1105 90-91 0.33005275974026205 1105 92-93 0.12936282467532578 1105 94-95 0.3369521103896105 1105 96-97 0.06422483766233711 1105 98-99 0.41274350649350566 1105 100 0.4255275974025956 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 6.0 17 4.0 18 8.0 19 10.0 20 18.0 21 20.0 22 14.0 23 19.0 24 28.0 25 32.0 26 44.0 27 63.0 28 51.0 29 92.0 30 105.0 31 124.0 32 157.0 33 223.0 34 349.0 35 472.0 36 699.0 37 806.0 38 592.0 39 61.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.544703230653642 9.967443025294266 11.945905334335086 52.54194840971701 2 23.980995248812203 15.57889472368092 31.607901975493874 28.832208052013 3 26.30657664416104 17.854463615903978 22.48062015503876 33.35833958489622 4 29.599999999999998 21.525 17.424999999999997 31.45 5 31.924999999999997 24.975 20.7 22.400000000000002 6 25.71285642821411 30.29014507253627 19.43471735867934 24.562281140570285 7 22.0 17.9 36.425000000000004 23.674999999999997 8 24.425 21.2 25.575 28.799999999999997 9 23.674999999999997 20.7 29.549999999999997 26.075 10-11 26.887499999999996 27.975 21.4125 23.724999999999998 12-13 25.2 23.05 25.0125 26.737499999999997 14-15 25.3 23.2125 24.6625 26.825 16-17 26.687499999999996 23.549999999999997 23.724999999999998 26.0375 18-19 25.124999999999996 25.2375 23.1375 26.5 20-21 26.0 23.9125 23.4625 26.625 22-23 26.5375 23.05 23.425 26.987499999999997 24-25 25.912499999999998 24.2625 23.200000000000003 26.625 26-27 26.5375 23.5375 23.1125 26.8125 28-29 26.1125 23.2125 23.2625 27.4125 30-31 24.8125 24.275 23.375 27.537499999999998 32-33 26.375 23.4375 24.4 25.7875 34-35 28.237499999999997 22.3875 23.05 26.325 36-37 25.324999999999996 24.05 22.7125 27.9125 38-39 26.487500000000004 23.3625 23.175 26.974999999999998 40-41 25.1 24.025 23.3625 27.5125 42-43 25.624999999999996 23.2625 24.4125 26.700000000000003 44-45 26.0125 23.9875 23.5625 26.437500000000004 46-47 26.025 23.25 23.5625 27.1625 48-49 25.8625 23.0125 23.6875 27.437499999999996 50-51 25.5625 23.8125 23.5625 27.0625 52-53 26.9125 23.175 23.150000000000002 26.7625 54-55 26.3125 23.3 23.575 26.8125 56-57 27.325 23.7125 23.325000000000003 25.637500000000003 58-59 27.1 22.925 23.0 26.974999999999998 60-61 26.9625 22.3625 23.3625 27.3125 62-63 26.087500000000002 23.95 23.962500000000002 26.0 64-65 26.337500000000002 22.975 23.0625 27.625 66-67 26.637499999999996 23.3 23.974999999999998 26.087500000000002 68-69 26.400000000000002 23.599999999999998 23.0 27.0 70-71 26.625 24.375 22.8 26.200000000000003 72-73 25.912499999999998 24.55 23.4125 26.125 74-75 25.7 23.0625 24.825 26.4125 76-77 26.025 23.35 23.325000000000003 27.3 78-79 26.375 23.225 23.825 26.575 80-81 26.2625 22.8625 23.375 27.500000000000004 82-83 25.275 24.15 23.7875 26.787499999999998 84-85 26.237500000000004 23.65 23.5625 26.55 86-87 25.75 23.599999999999998 24.05 26.6 88-89 26.7625 23.1375 24.212500000000002 25.887500000000003 90-91 27.287499999999998 22.7 22.787499999999998 27.224999999999998 92-93 25.7375 23.8375 24.3625 26.0625 94-95 26.487500000000004 23.849999999999998 23.125 26.5375 96-97 27.0125 23.575 22.6125 26.8 98-99 26.479049405878673 23.777360850531583 23.564727954971858 26.178861788617887 100 27.631907976994246 22.85571392848212 22.705676419104776 26.806701675418854 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 2.5 28 3.0 29 2.5 30 3.5 31 5.5 32 5.0 33 10.5 34 18.0 35 22.5 36 32.0 37 39.0 38 53.0 39 65.0 40 82.0 41 111.0 42 126.5 43 131.5 44 135.5 45 146.5 46 159.0 47 167.5 48 171.5 49 156.5 50 149.0 51 143.5 52 124.5 53 120.0 54 113.5 55 106.0 56 106.0 57 100.5 58 87.0 59 86.0 60 90.0 61 86.5 62 91.5 63 86.5 64 81.5 65 80.5 66 76.5 67 86.0 68 86.5 69 65.5 70 64.0 71 72.0 72 55.5 73 43.5 74 41.0 75 31.5 76 21.5 77 17.5 78 12.5 79 7.0 80 5.0 81 4.0 82 3.0 83 1.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.025 3 0.025 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0625 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0125 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 688443 spots for SRR28040804.sra Written 688443 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra Read 688433 spots for SRR28040804.sra Written 688433 spots for SRR28040804.sra SRR ids: ['SRR28040804.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t2yzbc7h SRR28040804.sra spots: 13768670 blocks: [[1, 688433], [688434, 1376866], [1376867, 2065299], [2065300, 2753732], [2753733, 3442165], [3442166, 4130598], [4130599, 4819031], [4819032, 5507464], [5507465, 6195897], [6195898, 6884330], [6884331, 7572763], [7572764, 8261196], [8261197, 8949629], [8949630, 9638062], [9638063, 10326495], [10326496, 11014928], [11014929, 11703361], [11703362, 12391794], [12391795, 13080227], [13080228, 13768670]] SRR28040804 file size 3585934 SRR28040804 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040804 SRR28040804_1.fastq SRR28040804_2.fastq Input file: SRR28040804_1.fastq Paired file: SRR28040804_2.fastq trimmed: SRR28040804-trimmed-pair1.fastq, SRR28040804-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:45:39 2024 >> started Fri Dec 6 13:45:54 2024 >> done (14.858s) 13768670 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 13768670 (100.00%) read pairs available; of these: 2844016 (20.66%) trimmed read pairs available after processing 10924654 (79.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 4 0.00% 52 36 0.00% 53 92 0.00% 54 174 0.00% 55 321 0.00% 56 481 0.00% 57 642 0.00% 58 896 0.01% 59 1115 0.01% 60 1404 0.01% 61 1786 0.01% 62 2083 0.02% 63 2403 0.02% 64 2976 0.02% 65 3305 0.02% 66 3727 0.03% 67 4251 0.03% 68 4577 0.03% 69 5353 0.04% 70 6022 0.04% 71 6602 0.05% 72 7730 0.06% 73 8823 0.06% 74 10298 0.07% 75 14527 0.11% 76 22525 0.16% 77 27256 0.20% 78 30711 0.22% 79 33334 0.24% 80 35134 0.26% 81 38881 0.28% 82 41400 0.30% 83 44777 0.33% 84 47573 0.35% 85 50948 0.37% 86 55308 0.40% 87 58618 0.43% 88 56542 0.41% 89 66010 0.48% 90 75176 0.55% 91 102522 0.74% 92 116404 0.85% 93 134528 0.98% 94 156398 1.14% 95 185815 1.35% 96 225702 1.64% 97 289483 2.10% 98 390122 2.83% 99 469221 3.41% 100 10924654 79.34% 13768670 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=99.81 fanout-score-rank=17 prefix-density=1.17 prefix-fanout=17.4 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=328.44 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=24.2 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=107.81 fanout-score-rank=18 prefix-density=1.23 prefix-fanout=18.2 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=386.94 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=22.6 sequence=CCGCCGCCGCCTCC SRR28040804 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:46:36 Started mapping on | Dec 06 13:46:36 Finished on | Dec 06 13:47:47 Mapping speed, Million of reads per hour | 698.13 Number of input reads | 13768670 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 13086542 Uniquely mapped reads % | 95.05% Average mapped length | 195.96 Number of splices: Total | 8057089 Number of splices: Annotated (sjdb) | 7654984 Number of splices: GT/AG | 7946405 Number of splices: GC/AG | 93807 Number of splices: AT/AC | 5648 Number of splices: Non-canonical | 11229 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 160762 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 14870 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.11% % of reads unmapped: other | 0.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 521394 521394 521394 N_multimapping 160762 160762 160762 N_noFeature 368280 6552139 6701718 N_ambiguous 222120 11537 11662 UnstrandedReadsAssigned:12496142 PositiveStrandReadsAssigned:6522866 NegativeStrandReadsAssigned:6373162 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040804 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040804-trimmed-pair1.fastq SRR28040804-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,768,670 reads, 12,908,787 reads pseudoaligned [quant] estimated average fragment length: 171.537 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR28040804.ke.tsv 35125 SRR28040804.se.tsv 88098 total ==> SRR28040804.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.717 96.3531 13.7501 PNS24247 1044 873.463 23.9379 2.99468 PNS24249 1928 1757.46 160.343 9.96945 PNS24246 1044 873.463 23.9379 2.99468 PNS24248 1044 873.463 23.9379 2.99468 PNS24244 1471 1300.46 23.4904 1.97379 PNS24243 293 130.615 12 10.0391 KQK14069 1603 1432.46 2055.87 156.827 KQK14071 474 304.995 439.93 157.616 ==> SRR28040804.se.tsv <== BRADI_1g14170v3 2590 BRADI_1g53295v3 23 BRADI_1g59795v3 194 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 681 BRADI_1g74790v3 118 BRADI_1g09890v3 0 BRADI_1g77505v3 117 BRADI_1g48960v3 0 SRR28040804 completed mapping pipeline successfully