Starting /dee2/code/volunteer_pipeline.sh SRR28040805 current disk space = 1550830198784 free memory = 1600056968 SRR28040805 SRAfilesize 72d78ee12b784d91a1ad74984320dcdc SRR28040805.sra SRR28040805.sra file validated SRR28040805 is paired end SRR28040805 is conventional basespace SRR28040805 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040805_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84975 34.0 31.0 34.0 31.0 34.0 2 32.97275 34.0 31.0 34.0 31.0 34.0 3 32.9975 34.0 31.0 34.0 31.0 34.0 4 36.36775 37.0 37.0 37.0 35.0 37.0 5 36.2115 37.0 37.0 37.0 35.0 37.0 6 36.2515 37.0 37.0 37.0 35.0 37.0 7 36.26475 37.0 37.0 37.0 35.0 37.0 8 36.245 37.0 37.0 37.0 35.0 37.0 9 38.088 39.0 39.0 39.0 35.0 39.0 10-11 38.080875 39.0 39.0 39.0 35.0 39.0 12-13 37.927875 39.0 38.0 39.0 35.0 39.0 14-15 39.392375 41.0 39.0 41.0 36.0 41.0 16-17 39.34975 41.0 39.0 41.0 36.0 41.0 18-19 39.350875 41.0 39.0 41.0 36.0 41.0 20-21 39.266625000000005 41.0 39.0 41.0 36.0 41.0 22-23 39.248125 41.0 39.0 41.0 36.0 41.0 24-25 39.12975 41.0 39.0 41.0 35.0 41.0 26-27 39.0745 41.0 39.0 41.0 35.0 41.0 28-29 38.943375 40.0 38.5 41.0 35.0 41.0 30-31 38.724625 40.0 38.0 41.0 35.0 41.0 32-33 38.422375 40.0 38.0 41.0 34.0 41.0 34-35 38.282250000000005 40.0 38.0 41.0 34.0 41.0 36-37 38.125875 40.0 38.0 41.0 33.0 41.0 38-39 37.864999999999995 40.0 37.0 41.0 33.0 41.0 40-41 37.621875 40.0 36.5 41.0 32.5 41.0 42-43 37.493750000000006 40.0 36.0 41.0 32.0 41.0 44-45 37.12775 39.5 35.5 41.0 31.5 41.0 46-47 36.879875 39.0 35.0 41.0 31.0 41.0 48-49 36.781375 39.0 35.0 41.0 31.0 41.0 50-51 36.8245 39.0 35.0 41.0 31.0 41.0 52-53 36.61675 39.0 35.0 41.0 31.0 41.0 54-55 36.4155 38.0 35.0 41.0 31.0 41.0 56-57 36.158249999999995 38.0 35.0 41.0 30.5 41.0 58-59 36.001000000000005 38.0 35.0 40.0 30.0 41.0 60-61 35.78775 37.0 35.0 40.5 30.5 41.0 62-63 35.348124999999996 36.5 34.5 40.0 29.5 41.0 64-65 34.983875 36.0 34.0 39.5 29.0 41.0 66-67 34.857 35.5 34.0 39.0 29.5 41.0 68-69 34.395375 35.0 34.0 39.0 29.0 40.5 70-71 34.0995 35.0 34.0 37.5 28.5 40.0 72-73 33.723875 35.0 33.0 37.0 28.0 39.0 74-75 33.411 35.0 33.0 36.5 27.5 39.0 76-77 32.5295 34.5 32.0 36.0 26.5 38.0 78-79 32.79775 35.0 33.0 36.0 27.0 37.0 80-81 32.567625 35.0 33.0 35.5 26.5 37.0 82-83 32.208375000000004 35.0 33.0 35.0 25.5 36.5 84-85 31.947375 35.0 33.0 35.0 25.0 36.0 86-87 31.787625 35.0 33.0 35.0 25.0 36.0 88-89 31.49375 35.0 32.0 35.0 24.0 36.0 90-91 31.3305 35.0 32.0 35.0 24.0 35.0 92-93 31.089375 35.0 31.5 35.0 24.0 35.0 94-95 30.674125 35.0 31.5 35.0 20.0 35.0 96-97 30.235 34.0 31.0 35.0 13.0 35.0 98-99 29.670375 34.5 31.0 35.0 2.0 35.0 100 29.3425 34.0 31.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 4.0 10 5.0 11 10.0 12 8.0 13 3.0 14 7.0 15 5.0 16 8.0 17 11.0 18 11.0 19 8.0 20 13.0 21 13.0 22 22.0 23 11.0 24 13.0 25 22.0 26 17.0 27 47.0 28 31.0 29 74.0 30 78.0 31 92.0 32 121.0 33 163.0 34 248.0 35 384.0 36 570.0 37 771.0 38 1013.0 39 214.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.924999999999997 10.9 12.65 49.525000000000006 2 24.7 17.599999999999998 31.35 26.35 3 25.782227784730914 18.89862327909887 23.078848560700877 32.24030037546934 4 29.7 22.675 17.599999999999998 30.025000000000002 5 30.861723446893784 26.728456913827653 20.390781563126254 22.019038076152306 6 25.074999999999996 31.75 20.025000000000002 23.150000000000002 7 22.775000000000002 18.275 36.35 22.6 8 22.85 22.275 27.200000000000003 27.675 9 22.875 20.525 30.599999999999998 26.0 10-11 25.7375 28.15 22.3875 23.724999999999998 12-13 25.224999999999998 23.425 24.9375 26.4125 14-15 24.75 24.7375 24.8625 25.650000000000002 16-17 25.8125 23.549999999999997 24.05 26.5875 18-19 25.5625 25.0 22.8 26.637499999999996 20-21 26.125 24.4 23.962500000000002 25.5125 22-23 25.5375 24.3625 24.8 25.3 24-25 25.775 23.225 24.4125 26.5875 26-27 24.762500000000003 24.1125 24.2625 26.8625 28-29 25.575 24.0 24.6625 25.7625 30-31 26.150000000000002 24.6 23.400000000000002 25.85 32-33 26.224999999999998 24.337500000000002 24.65 24.7875 34-35 25.3 24.85 23.375 26.474999999999998 36-37 25.7 23.7875 23.6625 26.85 38-39 25.650000000000002 24.462500000000002 23.875 26.0125 40-41 24.95 23.4125 24.575 27.0625 42-43 25.15 24.099999999999998 24.1125 26.637499999999996 44-45 26.0375 24.3875 24.474999999999998 25.1 46-47 25.5625 23.7125 24.5375 26.187500000000004 48-49 25.4875 23.825 24.0375 26.650000000000002 50-51 24.975 24.775 23.974999999999998 26.275 52-53 25.2 24.637500000000003 23.3 26.8625 54-55 26.1 24.1125 23.8625 25.924999999999997 56-57 25.974999999999998 24.4 23.425 26.200000000000003 58-59 25.112499999999997 24.9875 23.200000000000003 26.700000000000003 60-61 25.078134766845857 24.315539442430303 23.702962870358796 26.903362920365048 62-63 25.726872246696036 24.644430459408433 23.67526746381372 25.953429830081813 64-65 25.565042692114513 24.020592667001505 24.22149673530889 26.192867905575092 66-67 25.724999999999998 23.875 24.1625 26.237500000000004 68-69 26.1625 23.6875 23.775 26.375 70-71 26.187500000000004 24.45 23.575 25.7875 72-73 25.2375 24.0625 24.675 26.025 74-75 25.912499999999998 24.712500000000002 24.1875 25.1875 76-77 24.5 24.15 24.65 26.700000000000003 78-79 25.857089036795177 23.383147055129978 24.488258194147935 26.271505713926913 80-81 25.135237136746763 24.229462825512645 23.801736067429864 26.83356397031073 82-83 26.207502195458538 24.400953456279012 23.648224814954208 25.743319533308238 84-85 26.150000000000002 23.7625 24.462500000000002 25.624999999999996 86-87 26.0625 22.975 24.725 26.237500000000004 88-89 26.2875 22.900000000000002 23.962500000000002 26.85 90-91 26.400000000000002 23.45 24.175 25.974999999999998 92-93 26.094043887147333 24.84012539184953 22.984326018808776 26.08150470219436 94-95 25.90817356205853 24.94954591321897 24.0539858728557 25.0882946518668 96-97 26.860963916225085 23.845571536714612 23.568004037345442 25.725460509714864 98-99 26.732167921398492 23.886691335970397 23.567691718769936 25.813449023861175 100 25.525 23.599999999999998 23.425 27.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 3.0 28 4.5 29 5.5 30 4.5 31 4.0 32 9.0 33 13.5 34 21.0 35 29.0 36 39.5 37 52.5 38 62.0 39 74.0 40 88.0 41 114.0 42 139.5 43 155.0 44 168.0 45 182.5 46 188.0 47 181.5 48 172.5 49 159.0 50 148.5 51 137.5 52 133.5 53 116.5 54 104.5 55 99.0 56 85.0 57 86.0 58 89.0 59 77.0 60 73.0 61 83.5 62 78.5 63 69.5 64 69.0 65 77.0 66 81.5 67 76.0 68 69.5 69 65.0 70 49.0 71 42.0 72 41.0 73 35.0 74 33.0 75 26.0 76 19.0 77 15.5 78 14.0 79 9.5 80 6.0 81 7.5 82 7.0 83 2.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.125 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0125 62-63 0.6875 64-65 0.44999999999999996 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.46249999999999997 80-81 0.6375 82-83 0.36250000000000004 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.3125 94-95 0.8999999999999999 96-97 0.9249999999999999 98-99 2.0375 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040805 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040805_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.90875 34.0 31.0 34.0 30.0 34.0 2 32.34075 34.0 31.0 34.0 30.0 34.0 3 32.15775 34.0 31.0 34.0 30.0 34.0 4 35.696 37.0 37.0 37.0 35.0 37.0 5 35.673 37.0 37.0 37.0 35.0 37.0 6 35.5665 37.0 36.0 37.0 35.0 37.0 7 35.57925 37.0 37.0 37.0 35.0 37.0 8 35.21525 37.0 37.0 37.0 35.0 37.0 9 37.131 39.0 38.0 39.0 35.0 39.0 10-11 37.33175 39.0 38.0 39.0 35.0 39.0 12-13 37.439750000000004 39.0 38.0 39.0 35.0 39.0 14-15 39.00475 41.0 39.0 41.0 36.0 41.0 16-17 39.0305 41.0 39.0 41.0 36.0 41.0 18-19 38.950125 41.0 39.0 41.0 36.0 41.0 20-21 38.644499999999994 41.0 39.0 41.0 35.0 41.0 22-23 38.124875 40.5 38.0 41.0 34.0 41.0 24-25 37.82325 40.0 38.0 41.0 33.5 41.0 26-27 37.927875 40.0 38.0 41.0 32.5 41.0 28-29 38.128375 40.0 38.0 41.0 33.5 41.0 30-31 38.028375 40.0 38.0 41.0 33.0 41.0 32-33 37.708 40.0 37.5 41.0 32.5 41.0 34-35 37.676 40.0 37.5 41.0 32.5 41.0 36-37 37.573375 40.0 37.0 41.0 32.5 41.0 38-39 37.45825 40.0 37.0 41.0 32.0 41.0 40-41 37.1305 40.0 36.5 41.0 31.0 41.0 42-43 36.324124999999995 40.0 35.5 41.0 29.5 41.0 44-45 36.00425 39.0 35.0 41.0 28.0 41.0 46-47 36.032375 39.0 35.0 41.0 28.5 41.0 48-49 35.988125 39.0 35.0 41.0 29.5 41.0 50-51 35.3715 38.5 34.0 40.5 27.5 40.5 52-53 35.7815 38.5 34.5 40.5 29.5 41.0 54-55 36.027625 38.5 35.0 41.0 30.0 41.0 56-57 35.6265 38.0 35.0 41.0 29.5 41.0 58-59 35.1575 37.5 34.5 41.0 27.5 41.0 60-61 34.75475 37.0 34.0 40.0 26.5 41.0 62-63 34.536500000000004 36.5 34.0 40.0 26.0 41.0 64-65 34.335875 36.0 34.0 39.5 26.5 41.0 66-67 33.947625 35.0 34.0 39.0 26.0 41.0 68-69 33.3125 35.0 33.0 39.0 25.0 41.0 70-71 33.062 35.0 33.0 37.5 24.5 40.0 72-73 32.645875000000004 35.0 33.0 37.0 24.0 39.0 74-75 32.207125 35.0 33.0 36.5 24.0 39.0 76-77 31.763624999999998 35.0 32.0 36.0 21.5 38.5 78-79 31.238124999999997 35.0 32.0 35.5 19.0 37.0 80-81 30.8885 35.0 31.5 35.0 17.0 37.0 82-83 30.563125 35.0 31.0 35.0 16.5 36.5 84-85 30.2655 35.0 31.0 35.0 14.0 36.0 86-87 29.929875 34.0 31.0 35.0 9.0 36.0 88-89 29.340625000000003 34.0 29.5 35.0 3.5 35.0 90-91 29.357 34.0 30.0 35.0 2.0 35.0 92-93 28.96825 34.0 29.5 35.0 2.0 35.0 94-95 28.1935 34.0 29.0 35.0 2.0 35.0 96-97 27.756875 34.0 27.5 35.0 2.0 35.0 98-99 27.325499999999998 34.0 27.0 35.0 2.0 35.0 100 25.994 33.0 24.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 4.0 4 3.0 5 9.0 6 3.0 7 3.0 8 6.0 9 11.0 10 8.0 11 11.0 12 16.0 13 11.0 14 9.0 15 15.0 16 20.0 17 19.0 18 18.0 19 14.0 20 25.0 21 23.0 22 30.0 23 28.0 24 25.0 25 34.0 26 49.0 27 43.0 28 54.0 29 66.0 30 95.0 31 93.0 32 122.0 33 191.0 34 231.0 35 347.0 36 562.0 37 749.0 38 894.0 39 155.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.479438314944836 10.932798395185557 13.28986960882648 49.29789368104313 2 23.57947434292866 16.49561952440551 32.040050062578224 27.88485607008761 3 24.779207670956346 19.984859954579864 22.05399949533182 33.18193287913197 4 28.1675921251893 22.791519434628977 18.298838970217062 30.742049469964666 5 30.685555274475085 26.56210473058437 21.022008601062485 21.730331393878068 6 25.266092245311704 31.272174353775977 20.349721236695387 23.112012164216928 7 22.008113590263694 17.621703853955374 35.978701825557806 24.391480730223122 8 23.42988977185337 21.17405793386311 27.582671109971802 27.813381184311716 9 22.16038451808753 20.718441689855805 31.292689096888438 25.828484695168225 10-11 26.16235234983664 27.9969841668761 20.34430761497864 25.49635586830862 12-13 24.020592667001505 23.756906077348066 25.85384229030638 26.36865896534405 14-15 25.7007007007007 24.274274274274273 25.45045045045045 24.574574574574577 16-17 26.384894335375762 23.333750156308618 23.721395523321245 26.559959984994375 18-19 25.334835398673178 24.50869946175992 24.008011015145826 26.14845412442108 20-21 25.528169014084508 24.295774647887324 23.80533199195171 26.370724346076457 22-23 25.261146496815286 24.738853503184714 23.528662420382165 26.47133757961783 24-25 25.236633410079307 25.057559478127402 23.89357892044001 25.812228191353288 26-27 25.3 24.9875 24.575 25.137500000000003 28-29 25.825 24.025 23.65 26.5 30-31 26.244683512634477 24.54340755566675 24.055541656242184 25.156367275456592 32-33 25.078134766845857 25.078134766845857 24.20302537817227 25.640705088136016 34-35 25.362499999999997 24.462500000000002 23.8875 26.2875 36-37 26.0125 23.4375 24.3875 26.1625 38-39 25.30316289536192 24.440555069383674 24.678084760595073 25.57819727465933 40-41 25.815763052208833 24.435240963855424 23.09236947791165 26.656626506024097 42-43 25.639069057611596 24.697952435457204 24.723388019839756 24.93959048709144 44-45 25.96384780685122 23.991909998735938 23.359878649981038 26.684363544431804 46-47 25.2625 24.75 23.7375 26.25 48-49 24.775 24.5 24.525 26.200000000000003 50-51 27.05 24.1125 23.674999999999997 25.162499999999998 52-53 25.45 24.975 22.5875 26.987499999999997 54-55 25.4 24.625 24.075 25.900000000000002 56-57 26.204554031953702 24.619448987294 23.323688514278526 25.852308466473772 58-59 26.418910377954745 23.10706611047908 24.055113133611428 26.418910377954745 60-61 26.36501516683519 24.24165824064712 23.7108190091001 25.68250758341759 62-63 26.402805611222448 24.185871743486974 23.897795591182362 25.513527054108216 64-65 26.609065865264213 23.94189832206361 23.065364387678436 26.383671424993736 66-67 25.937500000000004 24.2 23.974999999999998 25.887500000000003 68-69 26.6625 24.025 24.775 24.5375 70-71 25.137500000000003 24.087500000000002 24.712500000000002 26.0625 72-73 26.6 22.9625 24.3875 26.05 74-75 26.401309988663556 23.403451316286684 24.3103665449049 25.884872150144854 76-77 26.5530303030303 23.30808080808081 23.876262626262626 26.262626262626267 78-79 26.206722264341675 23.7553702299722 23.919636087945413 26.11827141774071 80-81 26.476913345983554 23.68121442125237 24.035420619860847 25.806451612903224 82-83 26.706827309236946 24.08383534136546 22.602911646586346 26.606425702811244 84-85 25.7375 24.337500000000002 23.7625 26.1625 86-87 26.450000000000003 22.9875 24.55 26.0125 88-89 26.59082385298162 24.228028503562946 23.540442555319416 25.640705088136016 90-91 25.985730379271498 24.796595318563025 23.645011891350606 25.57266241081487 92-93 26.702100733991397 23.968615540369527 23.500379650721335 25.82890407491774 94-95 26.792261980022758 23.66923757744342 24.04855228221014 25.489948160323685 96-97 25.7625 24.5125 23.8375 25.887500000000003 98-99 25.942156003505694 24.039063478152 23.400525854513585 26.618254663828722 100 25.909204915976925 23.952846751943817 24.981188863807375 25.156759468271883 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 0.0 25 1.0 26 2.5 27 5.0 28 4.5 29 3.5 30 6.0 31 14.0 32 19.5 33 18.0 34 21.0 35 27.5 36 35.5 37 43.0 38 60.0 39 95.0 40 115.0 41 122.5 42 132.5 43 151.0 44 169.5 45 166.0 46 173.5 47 187.5 48 183.5 49 165.0 50 143.0 51 126.0 52 118.0 53 118.0 54 102.0 55 90.5 56 85.0 57 78.0 58 87.5 59 82.0 60 71.0 61 73.5 62 74.0 63 72.0 64 70.0 65 71.5 66 75.0 67 71.5 68 65.5 69 54.5 70 47.0 71 45.5 72 37.5 73 38.5 74 38.5 75 31.5 76 24.5 77 17.0 78 16.0 79 12.5 80 7.5 81 6.0 82 6.5 83 5.5 84 3.5 85 2.0 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 1.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.125 3 0.9249999999999999 4 0.95 5 1.175 6 1.35 7 1.4000000000000001 8 2.475 9 1.175 10-11 0.525 12-13 0.44999999999999996 14-15 0.1 16-17 0.0375 18-19 0.13749999999999998 20-21 0.6 22-23 1.875 24-25 2.275 26-27 0.0 28-29 0.0 30-31 0.075 32-33 0.0125 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.4 42-43 1.7125000000000001 44-45 1.1125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.6375 58-59 1.1125 60-61 1.0999999999999999 62-63 0.2 64-65 0.17500000000000002 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.7625 76-77 1.0 78-79 1.075 80-81 1.1875 82-83 0.4 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.13749999999999998 92-93 1.225 94-95 1.1375 96-97 0.0 98-99 0.1625 100 0.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799373 spots for SRR28040805.sra Written 799373 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra Read 799357 spots for SRR28040805.sra Written 799357 spots for SRR28040805.sra SRR ids: ['SRR28040805.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nommpc83 SRR28040805.sra spots: 15987156 blocks: [[1, 799357], [799358, 1598714], [1598715, 2398071], [2398072, 3197428], [3197429, 3996785], [3996786, 4796142], [4796143, 5595499], [5595500, 6394856], [6394857, 7194213], [7194214, 7993570], [7993571, 8792927], [8792928, 9592284], [9592285, 10391641], [10391642, 11190998], [11190999, 11990355], [11990356, 12789712], [12789713, 13589069], [13589070, 14388426], [14388427, 15187783], [15187784, 15987156]] SRR28040805 file size 4165553 SRR28040805 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040805 SRR28040805_1.fastq SRR28040805_2.fastq Input file: SRR28040805_1.fastq Paired file: SRR28040805_2.fastq trimmed: SRR28040805-trimmed-pair1.fastq, SRR28040805-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:48:01 2024 >> started Fri Dec 6 13:48:17 2024 >> done (15.982s) 15987156 read pairs processed; of these: 76823 ( 0.48%) short read pairs filtered out after trimming by size control 24095 ( 0.15%) empty read pairs filtered out after trimming by size control 15886238 (99.37%) read pairs available; of these: 3898971 (24.54%) trimmed read pairs available after processing 11987267 (75.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 63 0.00% 19 75 0.00% 20 145 0.00% 21 205 0.00% 22 333 0.00% 23 446 0.00% 24 590 0.00% 25 743 0.00% 26 944 0.01% 27 1182 0.01% 28 1350 0.01% 29 1635 0.01% 30 1767 0.01% 31 2029 0.01% 32 2381 0.01% 33 2607 0.02% 34 2726 0.02% 35 2936 0.02% 36 3214 0.02% 37 3411 0.02% 38 3651 0.02% 39 3872 0.02% 40 4157 0.03% 41 4306 0.03% 42 4500 0.03% 43 4657 0.03% 44 5207 0.03% 45 5295 0.03% 46 5689 0.04% 47 6077 0.04% 48 6281 0.04% 49 6665 0.04% 50 6854 0.04% 51 7102 0.04% 52 7710 0.05% 53 8337 0.05% 54 8872 0.06% 55 9694 0.06% 56 10243 0.06% 57 11584 0.07% 58 12522 0.08% 59 22200 0.14% 60 23294 0.15% 61 21534 0.14% 62 22953 0.14% 63 24361 0.15% 64 25398 0.16% 65 27240 0.17% 66 28552 0.18% 67 29258 0.18% 68 31067 0.20% 69 36221 0.23% 70 32416 0.20% 71 33041 0.21% 72 33992 0.21% 73 33846 0.21% 74 34332 0.22% 75 32934 0.21% 76 34620 0.22% 77 41271 0.26% 78 41161 0.26% 79 41634 0.26% 80 44621 0.28% 81 47196 0.30% 82 50788 0.32% 83 54818 0.35% 84 58837 0.37% 85 63287 0.40% 86 69944 0.44% 87 75225 0.47% 88 74355 0.47% 89 84795 0.53% 90 95153 0.60% 91 105414 0.66% 92 119885 0.75% 93 137532 0.87% 94 161491 1.02% 95 195808 1.23% 96 246569 1.55% 97 315199 1.98% 98 440270 2.77% 99 634402 3.99% 100 11987267 75.46% 15886238 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=16.06 fanout-score-rank=21 prefix-density=0.34 prefix-fanout=7.3 sequence=TTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCTTCCAAATCTCTCTAACCTCAAGCTGATGAAATCAAGGAGGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=314.78 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=21.2 sequence=CGCCGCCGCCACC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=30 prefix-density=0.15 prefix-fanout=1.9 sequence=GGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=344.30 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=24.5 sequence=GCCGCCGCCGCT SRR28040805 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:48:50 Started mapping on | Dec 06 13:48:50 Finished on | Dec 06 13:49:55 Mapping speed, Million of reads per hour | 879.85 Number of input reads | 15886238 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 15251902 Uniquely mapped reads % | 96.01% Average mapped length | 193.38 Number of splices: Total | 9306489 Number of splices: Annotated (sjdb) | 8833562 Number of splices: GT/AG | 9156748 Number of splices: GC/AG | 128413 Number of splices: AT/AC | 6697 Number of splices: Non-canonical | 14631 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 197166 % of reads mapped to multiple loci | 1.24% Number of reads mapped to too many loci | 12802 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.22% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463988 463988 463988 N_multimapping 197166 197166 197166 N_noFeature 417869 7621005 7786158 N_ambiguous 292527 16527 16227 UnstrandedReadsAssigned:14541506 PositiveStrandReadsAssigned:7614370 NegativeStrandReadsAssigned:7449517 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040805 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040805-trimmed-pair1.fastq SRR28040805-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,886,238 reads, 14,984,994 reads pseudoaligned [quant] estimated average fragment length: 172.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR28040805.ke.tsv 35125 SRR28040805.se.tsv 88098 total ==> SRR28040805.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 764.699 0 0 PNS24247 1044 872.571 48.1508 5.31971 PNS24249 1928 1756.57 263.937 14.4851 PNS24246 1044 872.571 48.1508 5.31971 PNS24248 1044 872.571 48.1508 5.31971 PNS24244 1471 1299.57 54.6105 4.051 PNS24243 293 128.566 18 13.4969 KQK14069 1603 1431.57 12364.3 832.614 KQK14071 474 304.301 831.181 263.317 ==> SRR28040805.se.tsv <== BRADI_1g14170v3 13436 BRADI_1g53295v3 29 BRADI_1g59795v3 300 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 523 BRADI_1g74790v3 82 BRADI_1g09890v3 0 BRADI_1g77505v3 184 BRADI_1g48960v3 0 SRR28040805 completed mapping pipeline successfully