Starting /dee2/code/volunteer_pipeline.sh SRR28040806 current disk space = 1550805549056 free memory = 1594234132 SRR28040806 SRAfilesize da3f28f0f8467ff30be2d6fd46c99a35 SRR28040806.sra SRR28040806.sra file validated SRR28040806 is paired end SRR28040806 is conventional basespace SRR28040806 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040806_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.682 34.0 31.0 34.0 31.0 34.0 2 32.84775 34.0 31.0 34.0 31.0 34.0 3 32.77875 34.0 31.0 34.0 31.0 34.0 4 36.24525 37.0 37.0 37.0 35.0 37.0 5 36.2495 37.0 37.0 37.0 35.0 37.0 6 36.1945 37.0 37.0 37.0 35.0 37.0 7 36.16425 37.0 37.0 37.0 35.0 37.0 8 36.17775 37.0 37.0 37.0 35.0 37.0 9 37.90975 39.0 38.0 39.0 35.0 39.0 10-11 37.875375 39.0 38.0 39.0 35.0 39.0 12-13 37.791375 39.0 38.0 39.0 35.0 39.0 14-15 39.226124999999996 41.0 39.0 41.0 36.0 41.0 16-17 39.122125 41.0 38.5 41.0 36.0 41.0 18-19 39.0605 41.0 39.0 41.0 35.5 41.0 20-21 39.016 40.5 39.0 41.0 35.0 41.0 22-23 39.010625000000005 40.0 39.0 41.0 35.0 41.0 24-25 38.850750000000005 40.0 38.0 41.0 35.0 41.0 26-27 38.592124999999996 40.0 38.0 41.0 34.0 41.0 28-29 38.3225 40.0 38.0 41.0 33.5 41.0 30-31 38.2785 40.0 38.0 41.0 33.5 41.0 32-33 38.0835 40.0 38.0 41.0 33.0 41.0 34-35 37.85187500000001 40.0 37.0 41.0 32.5 41.0 36-37 37.433875 40.0 36.5 41.0 31.5 41.0 38-39 37.235125 39.5 36.0 41.0 31.5 41.0 40-41 36.83675 39.0 35.0 41.0 30.5 41.0 42-43 36.589625 39.0 35.0 41.0 30.0 41.0 44-45 36.274375000000006 38.5 35.0 40.5 29.5 41.0 46-47 35.8645 38.0 34.0 40.0 29.0 41.0 48-49 35.789500000000004 38.0 34.5 40.5 28.5 41.0 50-51 35.978125 38.0 35.0 40.5 29.0 41.0 52-53 35.65675 38.0 34.0 40.0 29.0 41.0 54-55 35.421375 37.0 34.0 40.0 28.5 41.0 56-57 35.040125 36.5 34.0 40.0 27.5 41.0 58-59 34.77175 36.0 33.5 40.0 27.0 41.0 60-61 34.516000000000005 35.5 33.0 40.0 27.0 41.0 62-63 34.302375 35.0 33.0 39.0 27.0 41.0 64-65 33.998875 35.0 33.0 39.0 26.0 41.0 66-67 33.698 35.0 33.0 38.5 26.0 41.0 68-69 33.18375 35.0 33.0 37.0 25.5 40.0 70-71 32.832 35.0 33.0 37.0 24.0 39.5 72-73 32.541250000000005 35.0 33.0 36.5 24.0 39.0 74-75 32.13475 35.0 32.0 36.0 24.0 39.0 76-77 31.14075 34.0 30.5 35.0 22.5 37.0 78-79 31.33775 35.0 31.0 35.0 22.5 37.0 80-81 31.147 35.0 31.0 35.0 20.0 36.5 82-83 30.967 35.0 31.0 35.0 20.0 36.0 84-85 30.702375 35.0 31.0 35.0 19.5 36.0 86-87 30.2245 34.0 31.0 35.0 17.5 35.5 88-89 29.977875 34.0 30.5 35.0 15.0 35.0 90-91 29.695500000000003 34.0 30.5 35.0 9.5 35.0 92-93 29.318125000000002 34.0 29.5 35.0 2.0 35.0 94-95 28.9035 34.0 30.0 35.0 2.0 35.0 96-97 28.520125 34.0 29.0 35.0 2.0 35.0 98-99 27.7795 34.0 28.0 35.0 2.0 35.0 100 27.488 34.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 3.0 9 3.0 10 11.0 11 10.0 12 7.0 13 10.0 14 8.0 15 13.0 16 8.0 17 13.0 18 17.0 19 15.0 20 22.0 21 21.0 22 27.0 23 24.0 24 32.0 25 36.0 26 50.0 27 62.0 28 63.0 29 73.0 30 93.0 31 122.0 32 143.0 33 198.0 34 278.0 35 374.0 36 596.0 37 756.0 38 774.0 39 137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.150000000000002 11.85 13.05 47.949999999999996 2 25.424999999999997 16.25 29.9 28.425 3 25.707133917396746 18.573216520650814 22.302878598247812 33.41677096370463 4 30.4 22.6 17.575 29.425 5 32.78319579894974 24.18104526131533 20.230057514378593 22.80570142535634 6 26.674999999999997 30.425 19.075 23.825 7 24.224999999999998 18.525 34.725 22.525000000000002 8 22.575 20.7 26.950000000000003 29.775000000000002 9 24.05 20.7 29.25 26.0 10-11 26.1125 26.650000000000002 21.275 25.9625 12-13 26.3 22.725 23.875 27.1 14-15 26.237500000000004 23.875 23.4375 26.450000000000003 16-17 26.700000000000003 23.525 23.1375 26.637499999999996 18-19 26.7125 23.3875 22.8625 27.037499999999998 20-21 26.9625 23.65 22.9375 26.450000000000003 22-23 26.224999999999998 23.4625 23.474999999999998 26.8375 24-25 27.200000000000003 22.900000000000002 22.45 27.450000000000003 26-27 26.625 23.25 23.474999999999998 26.650000000000002 28-29 26.875 22.725 22.725 27.675 30-31 26.400000000000002 23.2125 23.150000000000002 27.237499999999997 32-33 26.924999999999997 23.8375 22.7375 26.5 34-35 26.924999999999997 23.5875 22.275 27.212500000000002 36-37 26.937499999999996 23.9 22.625 26.5375 38-39 27.212500000000002 23.5125 22.900000000000002 26.375 40-41 26.85 22.45 23.25 27.450000000000003 42-43 26.825 22.575 23.125 27.474999999999998 44-45 26.787499999999998 23.075000000000003 24.087500000000002 26.05 46-47 26.1125 24.375 22.3875 27.125 48-49 26.2625 23.1375 23.7375 26.8625 50-51 26.775 22.75 22.4625 28.012500000000003 52-53 26.687499999999996 22.8125 22.3875 28.1125 54-55 26.0 23.5625 23.0875 27.35 56-57 27.500000000000004 23.05 22.7625 26.687499999999996 58-59 26.900000000000002 23.075000000000003 21.95 28.075 60-61 26.99286697534727 22.938305593793018 22.587911400325368 27.480916030534353 62-63 26.61573146292585 22.945891783567134 22.319639278557112 28.1187374749499 64-65 26.76021047356552 22.90152843898772 22.86394387371586 27.47431721373089 66-67 26.9125 22.975 22.7125 27.400000000000002 68-69 27.8375 22.8375 22.525000000000002 26.8 70-71 27.250000000000004 21.8625 22.162499999999998 28.725 72-73 27.224999999999998 22.6375 22.5625 27.575 74-75 26.787499999999998 22.55 23.3 27.3625 76-77 27.376330619912338 22.52974326862868 23.080776455854725 27.013149655604256 78-79 27.449748743718594 22.035175879396984 22.48743718592965 28.027638190954775 80-81 26.46652430599171 22.18314282125361 23.188041703303604 28.162291169451077 82-83 27.350213085986464 22.97568312860366 22.336425169215342 27.337678616194534 84-85 27.925 22.625 22.8625 26.5875 86-87 27.6375 23.5125 22.15 26.700000000000003 88-89 27.200000000000003 22.725 22.5125 27.5625 90-91 27.51534895376519 22.95451697782233 22.353088585390303 27.177045483022177 92-93 27.623824451410655 22.808777429467085 23.134796238244515 26.432601880877744 94-95 27.648839556004035 22.666498486377396 22.46468213925328 27.219979818365285 96-97 27.598837943665526 22.748515851964125 21.636983705949223 28.01566249842112 98-99 28.451242829827915 22.511153601019757 22.74059910771192 26.29700446144041 100 27.700000000000003 22.075 23.35 26.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 1.0 27 2.0 28 3.5 29 4.5 30 8.0 31 11.0 32 9.0 33 9.0 34 12.0 35 24.5 36 34.0 37 43.0 38 61.5 39 69.0 40 86.5 41 109.0 42 117.5 43 123.0 44 130.0 45 138.0 46 143.5 47 133.5 48 131.5 49 132.0 50 119.0 51 114.0 52 105.5 53 101.0 54 98.0 55 99.0 56 108.5 57 113.0 58 107.0 59 106.0 60 99.0 61 88.5 62 92.5 63 89.0 64 85.5 65 95.0 66 101.0 67 95.5 68 82.5 69 70.0 70 68.5 71 65.0 72 55.5 73 54.5 74 54.5 75 41.0 76 35.0 77 31.0 78 21.0 79 15.0 80 9.5 81 7.5 82 7.5 83 7.0 84 6.0 85 3.5 86 2.0 87 3.0 88 1.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.125 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.11249999999999999 62-63 0.2 64-65 0.22499999999999998 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.1875 78-79 0.5 80-81 0.4875 82-83 0.27499999999999997 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.2375 92-93 0.3125 94-95 0.8999999999999999 96-97 1.0375 98-99 1.9375 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6045340050377833 1.2 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTTC 20 0.0020136633 70.453125 3 >>END_MODULE SRR28040806 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040806_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.30825 34.0 31.0 34.0 31.0 34.0 2 32.31225 34.0 31.0 34.0 30.0 34.0 3 32.13375 34.0 31.0 34.0 30.0 34.0 4 35.35 37.0 35.0 37.0 33.0 37.0 5 35.197 37.0 35.0 37.0 33.0 37.0 6 35.28625 37.0 35.0 37.0 33.0 37.0 7 35.1905 37.0 35.0 37.0 33.0 37.0 8 34.82175 37.0 35.0 37.0 32.0 37.0 9 36.62275 39.0 37.0 39.0 33.0 39.0 10-11 36.870875 39.0 37.0 39.0 33.5 39.0 12-13 36.978875 39.0 37.0 39.0 33.5 39.0 14-15 38.439625 41.0 38.0 41.0 34.0 41.0 16-17 38.502875 40.0 38.0 41.0 34.0 41.0 18-19 38.468374999999995 40.0 38.0 41.0 34.0 41.0 20-21 38.06625 40.0 38.0 41.0 33.5 41.0 22-23 37.60525 40.0 38.0 41.0 32.0 41.0 24-25 37.082375 40.0 38.0 41.0 31.0 41.0 26-27 37.18625 40.0 37.5 41.0 30.5 41.0 28-29 37.22575 40.0 37.0 41.0 31.0 41.0 30-31 37.024875 40.0 37.0 41.0 31.0 41.0 32-33 36.723625 40.0 36.0 41.0 30.0 41.0 34-35 36.694874999999996 40.0 36.0 41.0 30.0 41.0 36-37 36.665 40.0 36.0 41.0 30.0 41.0 38-39 36.43025 39.5 35.5 41.0 29.5 41.0 40-41 35.951 39.0 35.0 41.0 29.0 41.0 42-43 35.197625 38.5 34.5 41.0 26.0 41.0 44-45 34.789500000000004 38.0 34.0 40.5 24.5 41.0 46-47 34.662125 38.0 33.0 40.0 25.0 41.0 48-49 34.579125000000005 38.0 33.0 40.0 25.0 41.0 50-51 33.802499999999995 36.5 32.5 39.5 23.5 40.5 52-53 34.298125 37.0 33.0 40.0 25.5 41.0 54-55 34.500249999999994 37.0 34.0 40.0 26.0 41.0 56-57 34.087125 36.5 33.5 40.0 24.0 41.0 58-59 33.48075 35.5 33.0 40.0 22.5 41.0 60-61 32.891 35.0 33.0 39.5 20.0 41.0 62-63 32.841625 35.0 32.0 39.0 22.0 41.0 64-65 32.64725 35.0 32.0 39.0 22.0 41.0 66-67 32.3785 35.0 32.0 38.0 21.0 40.5 68-69 32.011624999999995 35.0 32.0 37.0 19.5 40.0 70-71 31.69275 35.0 31.0 37.0 19.5 39.5 72-73 31.11925 35.0 31.0 36.0 16.0 39.0 74-75 30.732374999999998 35.0 31.0 36.0 11.5 38.5 76-77 30.262625 35.0 30.0 35.0 7.0 37.0 78-79 29.848625 34.5 30.0 35.0 3.5 37.0 80-81 29.314375 34.0 29.0 35.0 2.0 36.5 82-83 29.085375 34.0 29.0 35.0 2.0 36.0 84-85 28.651 34.0 28.5 35.0 2.0 35.5 86-87 28.338875 34.0 28.0 35.0 2.0 35.0 88-89 28.182875 34.0 27.0 35.0 2.0 35.0 90-91 27.891750000000002 34.0 27.0 35.0 2.0 35.0 92-93 27.199624999999997 33.5 25.5 35.0 2.0 35.0 94-95 26.511125 33.0 24.0 35.0 2.0 35.0 96-97 26.0895 33.0 24.0 35.0 2.0 35.0 98-99 25.105375 33.0 11.0 35.0 2.0 35.0 100 22.71175 30.0 2.0 34.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 1.0 4 5.0 5 4.0 6 9.0 7 10.0 8 17.0 9 17.0 10 15.0 11 9.0 12 16.0 13 8.0 14 19.0 15 22.0 16 25.0 17 24.0 18 16.0 19 23.0 20 29.0 21 22.0 22 32.0 23 38.0 24 38.0 25 55.0 26 54.0 27 73.0 28 76.0 29 81.0 30 96.0 31 130.0 32 166.0 33 204.0 34 292.0 35 371.0 36 520.0 37 673.0 38 666.0 39 113.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.300075206818754 11.556781148157432 12.133366758586112 49.009776886437706 2 26.074930852401305 16.595423686195627 28.865979381443296 28.463666079959772 3 25.893083354446418 19.432480364834053 21.003293640739802 33.67114263997973 4 30.350788002033553 21.581087951194714 17.310625317742755 30.757498729028974 5 33.282286881061765 24.834099030117407 18.759571209800917 23.124042879019907 6 26.805696846388607 30.34079348931841 19.430315361139368 23.42319430315361 7 23.937929280081406 18.49402187738489 33.452047824980916 24.116001017552787 8 24.22296429488826 20.549704597996403 25.89262779347547 29.334703313639864 9 23.19099974431092 20.097161851188954 30.29915622602915 26.41268217847098 10-11 26.03102534998108 26.57333837810569 21.364610921932147 26.03102534998108 12-13 25.254301142785383 22.59198794424212 24.81476830340324 27.338942609569255 14-15 25.782133433848475 23.043095866314864 23.281819324035684 27.89295137580098 16-17 27.257902659307575 22.44104365278475 22.829904666332162 27.471149021575513 18-19 26.65995975855131 23.252012072434606 22.83702213279678 27.2510060362173 20-21 25.65756196256955 23.73545776428933 22.23065250379363 28.376327769347498 22-23 26.845381781222212 23.17367551772329 22.11917164273917 27.861771058315334 24-25 26.55163533350502 23.21658511460211 23.03631212979655 27.19546742209632 26-27 26.7625 23.400000000000002 23.275000000000002 26.5625 28-29 26.533166458072593 22.07759699624531 23.266583229036293 28.122653316645806 30-31 26.42317380352645 23.2367758186398 22.972292191435766 27.367758186397985 32-33 26.86810431293882 23.45787362086259 22.743229689067203 26.930792377131397 34-35 26.737499999999997 22.8375 22.662499999999998 27.762500000000003 36-37 25.912499999999998 23.4875 23.0875 27.5125 38-39 26.36261120160381 24.01954642275404 21.851898258363615 27.765944117278536 40-41 27.308274470232092 22.46468213925328 21.594349142280524 28.63269424823411 42-43 26.39314928425358 23.453476482617585 22.226482617586914 27.926891615541923 44-45 27.185203952368887 23.169495819609832 22.84013174562959 26.80516848239169 46-47 27.400000000000002 23.1375 21.349999999999998 28.1125 48-49 26.82376535472549 22.612183504637752 23.31411381298571 27.24993732765104 50-51 27.15322984476715 22.421131697546322 22.421131697546322 28.004506760140206 52-53 26.424999999999997 22.725 22.7375 28.1125 54-55 26.854990583804145 23.804143126177024 22.435655994978028 26.905210295040803 56-57 27.62096774193548 22.719254032258064 22.605846774193548 27.053931451612907 58-59 27.445514445007603 22.731880385200203 22.301064368981248 27.521540800810946 60-61 26.313112043749204 22.268854126923564 22.904743736487347 28.51329009283988 62-63 27.189575241197844 22.879338428768325 22.67886229795765 27.25222403207618 64-65 27.248809822099723 22.86394387371586 22.337759959909796 27.549486344274616 66-67 26.7017017017017 22.42242242242242 23.323323323323322 27.55255255255255 68-69 26.674999999999997 23.1625 22.275 27.8875 70-71 27.481870467616904 22.768192048012004 21.9679919979995 27.781945486371594 72-73 27.78616352201258 23.056603773584904 22.0125786163522 27.144654088050313 74-75 27.482941622441242 22.276977508213296 23.110942633308063 27.129138236037402 76-77 27.040364418575223 22.965962292800203 22.52309249652031 27.470580792104265 78-79 26.824007105697245 23.042761070930084 23.106204796345644 27.027027027027028 80-81 27.559055118110237 22.555245110490223 22.466344932689868 27.419354838709676 82-83 27.584028304270912 22.415971695729088 22.378064190042963 27.621935809957037 84-85 26.21966474856142 22.792094070552913 22.742056542406804 28.246184638478862 86-87 26.437500000000004 23.0125 22.6875 27.8625 88-89 27.61128526645768 22.946708463949843 22.106583072100314 27.335423197492165 90-91 28.156932004541442 21.58445818090072 22.5810521004163 27.677557714141543 92-93 27.972560975609756 22.700711382113823 22.370426829268293 26.956300813008134 94-95 28.243500317057705 22.28281547241598 22.435003170577044 27.03868103994927 96-97 27.725 22.5625 21.8875 27.825 98-99 27.834147563572593 22.973819366153077 22.134535888763622 27.05749718151071 100 27.491840321365807 23.374340949033392 22.37007280944012 26.76374592016068 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.5 13 1.0 14 0.5 15 0.5 16 1.5 17 2.0 18 2.0 19 4.0 20 3.0 21 1.0 22 0.5 23 1.0 24 1.0 25 1.0 26 3.0 27 4.0 28 6.0 29 11.0 30 12.0 31 9.0 32 10.5 33 16.0 34 16.5 35 22.0 36 34.0 37 49.0 38 57.0 39 65.5 40 87.0 41 96.0 42 97.0 43 114.5 44 137.5 45 139.5 46 133.5 47 125.5 48 129.5 49 136.0 50 123.5 51 113.0 52 111.5 53 106.0 54 98.0 55 95.0 56 93.0 57 92.0 58 103.5 59 113.0 60 106.5 61 101.5 62 97.0 63 90.5 64 94.5 65 102.0 66 96.0 67 83.0 68 72.0 69 68.0 70 68.5 71 61.0 72 51.0 73 46.0 74 41.5 75 40.0 76 38.0 77 35.0 78 29.0 79 21.5 80 16.5 81 14.5 82 13.5 83 6.5 84 4.0 85 5.0 86 3.5 87 3.0 88 2.0 89 2.0 90 1.5 91 1.5 92 1.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.575 3 1.325 4 1.6500000000000001 5 2.0500000000000003 6 1.7000000000000002 7 1.725 8 2.675 9 2.225 10-11 0.8875 12-13 0.46249999999999997 14-15 0.5125000000000001 16-17 0.35000000000000003 18-19 0.6 20-21 1.15 22-23 1.6125 24-25 2.9250000000000003 26-27 0.0 28-29 0.125 30-31 0.75 32-33 0.3 34-35 0.0 36-37 0.0 38-39 0.2375 40-41 0.8999999999999999 42-43 2.1999999999999997 44-45 1.325 46-47 0.0 48-49 0.27499999999999997 50-51 0.15 52-53 0.0 54-55 0.43750000000000006 56-57 0.8 58-59 1.35 60-61 1.7125000000000001 62-63 0.2375 64-65 0.22499999999999998 66-67 0.1 68-69 0.0 70-71 0.025 72-73 0.625 74-75 1.075 76-77 1.2125000000000001 78-79 1.4874999999999998 80-81 1.575 82-83 1.075 84-85 0.075 86-87 0.0 88-89 0.3125 90-91 0.9125 92-93 1.6 94-95 1.4375 96-97 0.0 98-99 0.21250000000000002 100 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.7054673721340388 1.4000000000000001 3 0.0 0.0 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827346 spots for SRR28040806.sra Written 827346 spots for SRR28040806.sra Read 827357 spots for SRR28040806.sra Written 827357 spots for SRR28040806.sra SRR ids: ['SRR28040806.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__13az8rl SRR28040806.sra spots: 16546931 blocks: [[1, 827346], [827347, 1654692], [1654693, 2482038], [2482039, 3309384], [3309385, 4136730], [4136731, 4964076], [4964077, 5791422], [5791423, 6618768], [6618769, 7446114], [7446115, 8273460], [8273461, 9100806], [9100807, 9928152], [9928153, 10755498], [10755499, 11582844], [11582845, 12410190], [12410191, 13237536], [13237537, 14064882], [14064883, 14892228], [14892229, 15719574], [15719575, 16546931]] SRR28040806 file size 4311789 SRR28040806 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040806 SRR28040806_1.fastq SRR28040806_2.fastq Input file: SRR28040806_1.fastq Paired file: SRR28040806_2.fastq trimmed: SRR28040806-trimmed-pair1.fastq, SRR28040806-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:51:56 2024 >> started Fri Dec 6 13:52:35 2024 >> done (38.745s) 16546931 read pairs processed; of these: 123597 ( 0.75%) short read pairs filtered out after trimming by size control 65666 ( 0.40%) empty read pairs filtered out after trimming by size control 16357668 (98.86%) read pairs available; of these: 4916559 (30.06%) trimmed read pairs available after processing 11441109 (69.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 48 0.00% 19 96 0.00% 20 175 0.00% 21 259 0.00% 22 460 0.00% 23 630 0.00% 24 899 0.01% 25 1177 0.01% 26 1371 0.01% 27 1736 0.01% 28 2054 0.01% 29 2395 0.01% 30 2773 0.02% 31 3145 0.02% 32 3571 0.02% 33 3946 0.02% 34 4309 0.03% 35 4627 0.03% 36 5152 0.03% 37 5553 0.03% 38 5743 0.04% 39 6186 0.04% 40 6557 0.04% 41 6806 0.04% 42 7530 0.05% 43 7785 0.05% 44 8390 0.05% 45 8802 0.05% 46 9086 0.06% 47 9905 0.06% 48 10224 0.06% 49 10770 0.07% 50 11261 0.07% 51 11780 0.07% 52 12475 0.08% 53 13130 0.08% 54 14410 0.09% 55 15104 0.09% 56 16440 0.10% 57 18267 0.11% 58 19681 0.12% 59 31238 0.19% 60 31815 0.19% 61 31299 0.19% 62 34023 0.21% 63 35552 0.22% 64 37209 0.23% 65 39069 0.24% 66 40944 0.25% 67 41785 0.26% 68 42647 0.26% 69 47091 0.29% 70 44496 0.27% 71 45348 0.28% 72 46000 0.28% 73 46218 0.28% 74 45488 0.28% 75 43573 0.27% 76 46377 0.28% 77 53380 0.33% 78 53552 0.33% 79 55094 0.34% 80 58942 0.36% 81 62283 0.38% 82 67042 0.41% 83 71862 0.44% 84 75710 0.46% 85 83163 0.51% 86 88529 0.54% 87 95664 0.58% 88 93209 0.57% 89 106942 0.65% 90 119157 0.73% 91 131154 0.80% 92 147355 0.90% 93 167213 1.02% 94 195955 1.20% 95 238921 1.46% 96 293685 1.80% 97 380313 2.32% 98 519981 3.18% 99 752573 4.60% 100 11441109 69.94% 16357668 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=19 prefix-density=0.49 prefix-fanout=2.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=26 fanout-score=5.83 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=2.5 sequence=ACGCTGCCGAGGCTGTTGGAGGAGCGGCGGCTGGCGACGGGGAGGCCGGCGGTGGACTTGAG criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=23 prefix-density=0.47 prefix-fanout=2.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=7.37 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.8 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA SRR28040806 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:53:07 Started mapping on | Dec 06 13:53:10 Finished on | Dec 06 13:53:53 Mapping speed, Million of reads per hour | 1369.48 Number of input reads | 16357668 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 15560938 Uniquely mapped reads % | 95.13% Average mapped length | 191.45 Number of splices: Total | 9465005 Number of splices: Annotated (sjdb) | 9014727 Number of splices: GT/AG | 9334325 Number of splices: GC/AG | 114495 Number of splices: AT/AC | 3657 Number of splices: Non-canonical | 12528 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302125 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 34262 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.44% % of reads unmapped: other | 1.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 558030 558030 558030 N_multimapping 302125 302125 302125 N_noFeature 393138 7758191 7905947 N_ambiguous 347787 29599 30427 UnstrandedReadsAssigned:14820013 PositiveStrandReadsAssigned:7773148 NegativeStrandReadsAssigned:7624564 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040806 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040806-trimmed-pair1.fastq SRR28040806-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,357,668 reads, 15,378,581 reads pseudoaligned [quant] estimated average fragment length: 170.051 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52973 SRR28040806.ke.tsv 35125 SRR28040806.se.tsv 88098 total ==> SRR28040806.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 766.99 42.8923 4.44118 PNS24247 1044 874.949 4.13135 0.374988 PNS24249 1928 1758.95 95.3766 4.30623 PNS24246 1044 874.949 4.13135 0.374988 PNS24248 1044 874.949 4.13135 0.374988 PNS24244 1471 1301.95 50.3371 3.07046 PNS24243 293 129.887 2 1.22285 KQK14069 1603 1433.95 7204.69 399.016 KQK14071 474 306.026 626.07 162.47 ==> SRR28040806.se.tsv <== BRADI_1g14170v3 8036 BRADI_1g53295v3 10 BRADI_1g59795v3 333 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 741 BRADI_1g74790v3 226 BRADI_1g09890v3 5 BRADI_1g77505v3 310 BRADI_1g48960v3 0 SRR28040806 completed mapping pipeline successfully