Starting /dee2/code/volunteer_pipeline.sh SRR28040807 current disk space = 1550805549056 free memory = 1599817320 SRR28040807 SRAfilesize 02dab42370d4a1f5fac22de83be45db1 SRR28040807.sra SRR28040807.sra file validated SRR28040807 is paired end SRR28040807 is conventional basespace SRR28040807 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040807_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.214 34.0 31.0 34.0 31.0 34.0 2 32.6795 34.0 31.0 34.0 31.0 34.0 3 32.9545 34.0 31.0 34.0 31.0 34.0 4 36.4395 37.0 37.0 37.0 35.0 37.0 5 36.37325 37.0 37.0 37.0 35.0 37.0 6 36.3135 37.0 37.0 37.0 35.0 37.0 7 36.308 37.0 37.0 37.0 35.0 37.0 8 36.34025 37.0 37.0 37.0 35.0 37.0 9 38.137 39.0 39.0 39.0 37.0 39.0 10-11 38.129625000000004 39.0 39.0 39.0 36.0 39.0 12-13 38.082875 39.0 39.0 39.0 35.0 39.0 14-15 39.630624999999995 41.0 40.0 41.0 37.0 41.0 16-17 39.581500000000005 41.0 39.5 41.0 37.0 41.0 18-19 39.492625000000004 41.0 39.0 41.0 36.5 41.0 20-21 39.422125 41.0 39.0 41.0 36.0 41.0 22-23 39.2905 41.0 39.0 41.0 36.0 41.0 24-25 39.220375000000004 41.0 39.0 41.0 36.0 41.0 26-27 39.07 40.5 38.5 41.0 35.0 41.0 28-29 38.925250000000005 40.0 38.0 41.0 35.0 41.0 30-31 38.780249999999995 40.0 38.0 41.0 34.5 41.0 32-33 38.612750000000005 40.0 38.0 41.0 34.0 41.0 34-35 38.539125 40.0 38.0 41.0 34.0 41.0 36-37 38.710375 40.0 38.0 41.0 35.0 41.0 38-39 38.558625 40.0 38.0 41.0 34.0 41.0 40-41 38.375375 40.0 37.0 41.0 34.0 41.0 42-43 38.21362499999999 40.0 37.0 41.0 33.5 41.0 44-45 38.029624999999996 40.0 36.0 41.0 33.0 41.0 46-47 37.774874999999994 40.0 35.0 41.0 33.0 41.0 48-49 37.720749999999995 40.0 35.0 41.0 33.0 41.0 50-51 37.523125 39.0 35.0 41.0 33.0 41.0 52-53 37.4175 39.0 35.0 41.0 33.0 41.0 54-55 37.168875 39.0 35.0 41.0 33.0 41.0 56-57 36.87125 38.0 35.0 41.0 32.0 41.0 58-59 36.571375 37.5 35.0 40.5 32.0 41.0 60-61 36.297 37.0 35.0 40.0 31.0 41.0 62-63 35.90975 36.0 35.0 40.0 31.0 41.0 64-65 35.588750000000005 36.0 34.5 39.5 30.5 41.0 66-67 35.3465 35.5 34.5 39.0 30.0 41.0 68-69 34.930375 35.0 34.0 39.0 29.5 41.0 70-71 34.529624999999996 35.0 34.0 37.5 29.0 40.0 72-73 34.184 35.0 34.0 37.0 29.0 39.0 74-75 33.847125 35.0 34.0 36.5 29.0 39.0 76-77 32.273125 34.0 31.5 35.0 26.0 37.0 78-79 33.193 35.0 33.0 35.5 29.0 37.0 80-81 33.123999999999995 35.0 33.0 35.0 29.0 37.0 82-83 32.986125 35.0 33.0 35.0 29.0 36.5 84-85 32.75375 35.0 33.0 35.0 28.5 36.0 86-87 32.387375000000006 35.0 33.0 35.0 27.0 36.0 88-89 32.284499999999994 35.0 33.0 35.0 27.0 35.5 90-91 31.988125 35.0 33.0 35.0 26.0 35.0 92-93 31.82775 35.0 33.0 35.0 26.5 35.0 94-95 31.631375 35.0 33.0 35.0 25.0 35.0 96-97 31.393375 35.0 33.0 35.0 24.5 35.0 98-99 31.11925 35.0 33.0 35.0 24.0 35.0 100 30.9115 35.0 32.0 35.0 23.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.9411264505802315 1101 2 -0.500300120048017 1101 3 -0.20908363345338188 1101 4 -0.029411764705884025 1101 5 -0.04986994797918953 1101 6 -0.03091236494597638 1101 7 -0.10174069627851168 1101 8 -0.056422569027610336 1101 9 -0.05607242897158926 1101 10-11 0.014880952380948997 1101 12-13 -0.02310924369748335 1101 14-15 -0.02478491396558269 1101 16-17 -0.150610244097642 1101 18-19 -0.13007703081232336 1101 20-21 0.05112044817927597 1101 22-23 -0.10534213685473759 1101 24-25 -0.05919867947179114 1101 26-27 0.044967987194880266 1101 28-29 -0.05877350940375692 1101 30-31 0.01860744297719208 1101 32-33 -0.2982442977190871 1101 34-35 -0.06717687074830536 1101 36-37 -0.3238295318127271 1101 38-39 -0.22801620648259302 1101 40-41 -0.12662565026010952 1101 42-43 -0.07267907162864873 1101 44-45 -0.1402811124449812 1101 46-47 -0.18644957983192967 1101 48-49 0.001975790316130599 1101 50-51 0.07335434173669597 1101 52-53 0.19827931172468993 1101 54-55 -0.16354041616646953 1101 56-57 0.00220088035214161 1101 58-59 -0.18679971988795785 1101 60-61 -0.15331132452980967 1101 62-63 -0.07703081232492792 1101 64-65 0.121423569427769 1101 66-67 0.053696478591440666 1101 68-69 -0.12952681072429328 1101 70-71 -0.5200580232092875 1101 72-73 -0.3930822328931569 1101 74-75 -0.49252200880352603 1101 76-77 -0.672894157663066 1101 78-79 -0.5603741496598644 1101 80-81 -0.5042517006802711 1101 82-83 -0.46478591436574135 1101 84-85 -0.4583333333333357 1101 86-87 -0.3246298519407773 1101 88-89 -0.13722989195678537 1101 90-91 -0.4439775910364112 1101 92-93 -0.6466336534613824 1101 94-95 -0.6660414165666246 1101 96-97 -0.586334533813524 1101 98-99 -0.45605742296918805 1101 100 -0.5250100040016008 1105 1 0.941126450580235 1105 2 0.500300120048017 1105 3 0.20908363345338188 1105 4 0.029411764705884025 1105 5 0.04986994797918953 1105 6 0.03091236494597638 1105 7 0.10174069627851168 1105 8 0.056422569027610336 1105 9 0.05607242897158926 1105 10-11 -0.014880952380948997 1105 12-13 0.023109243697476245 1105 14-15 0.02478491396558269 1105 16-17 0.150610244097642 1105 18-19 0.13007703081232336 1105 20-21 -0.05112044817927597 1105 22-23 0.1053421368547447 1105 24-25 0.05919867947178403 1105 26-27 -0.04496798719487316 1105 28-29 0.058773509403764024 1105 30-31 -0.018607442977184974 1105 32-33 0.29824429771908 1105 34-35 0.06717687074829826 1105 36-37 0.32382953181272 1105 38-39 0.22801620648259302 1105 40-41 0.12662565026010242 1105 42-43 0.07267907162864873 1105 44-45 0.1402811124449741 1105 46-47 0.18644957983192967 1105 48-49 -0.001975790316130599 1105 50-51 -0.07335434173669597 1105 52-53 -0.19827931172468993 1105 54-55 0.16354041616646242 1105 56-57 -0.00220088035214161 1105 58-59 0.18679971988795074 1105 60-61 0.15331132452980967 1105 62-63 0.07703081232493503 1105 64-65 -0.121423569427769 1105 66-67 -0.05369647859143356 1105 68-69 0.12952681072429328 1105 70-71 0.5200580232092804 1105 72-73 0.3930822328931569 1105 74-75 0.49252200880351893 1105 76-77 0.672894157663066 1105 78-79 0.5603741496598644 1105 80-81 0.5042517006802782 1105 82-83 0.46478591436574135 1105 84-85 0.4583333333333357 1105 86-87 0.3246298519407773 1105 88-89 0.13722989195677826 1105 90-91 0.44397759103641476 1105 92-93 0.6466336534613824 1105 94-95 0.6660414165666282 1105 96-97 0.5863345338135275 1105 98-99 0.45605742296918805 1105 100 0.5250100040016008 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 7.0 18 4.0 19 4.0 20 13.0 21 13.0 22 17.0 23 17.0 24 23.0 25 18.0 26 19.0 27 35.0 28 49.0 29 46.0 30 70.0 31 84.0 32 117.0 33 143.0 34 218.0 35 382.0 36 570.0 37 920.0 38 1045.0 39 184.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.776728757336056 11.482521051288593 11.992855320234753 51.7478948711406 2 24.75 17.599999999999998 30.725 26.924999999999997 3 26.525 19.925 21.475 32.074999999999996 4 29.875 24.2 17.325 28.599999999999998 5 29.475 29.15 19.975 21.4 6 24.4 33.5 20.375 21.725 7 21.975 18.4 36.15 23.474999999999998 8 21.875 21.9 26.974999999999998 29.25 9 23.75 21.9 28.449999999999996 25.900000000000002 10-11 26.35 27.375 20.325 25.95 12-13 24.212500000000002 23.1625 25.374999999999996 27.250000000000004 14-15 24.3 24.212500000000002 24.474999999999998 27.0125 16-17 26.3125 24.474999999999998 22.787499999999998 26.424999999999997 18-19 26.125 24.675 23.599999999999998 25.6 20-21 25.587500000000002 24.775 23.6375 26.0 22-23 26.8125 24.0625 23.625 25.5 24-25 25.775 24.837500000000002 23.4625 25.924999999999997 26-27 26.325 24.0125 23.724999999999998 25.937500000000004 28-29 25.85 24.3625 23.825 25.9625 30-31 25.4375 24.837500000000002 23.799999999999997 25.924999999999997 32-33 25.387500000000003 24.85 22.825 26.937499999999996 34-35 26.375 23.799999999999997 23.1625 26.6625 36-37 25.7625 24.962500000000002 23.5375 25.7375 38-39 26.687499999999996 24.05 23.2375 26.025 40-41 26.4625 24.0625 23.2625 26.2125 42-43 25.4 24.712500000000002 23.35 26.5375 44-45 25.825 24.25 23.1625 26.7625 46-47 26.075 23.3 24.3875 26.237500000000004 48-49 26.237500000000004 23.95 23.75 26.0625 50-51 25.0375 25.0 24.025 25.937500000000004 52-53 25.924999999999997 24.099999999999998 23.925 26.05 54-55 25.687500000000004 24.1875 23.400000000000002 26.724999999999998 56-57 26.137500000000003 23.8375 24.3625 25.662499999999998 58-59 25.900000000000002 23.6875 23.3125 27.1 60-61 25.6125 23.5625 24.0 26.825 62-63 26.1 23.95 23.9375 26.0125 64-65 25.75 24.275 23.849999999999998 26.125 66-67 25.387500000000003 24.075 23.962500000000002 26.575 68-69 25.8625 23.150000000000002 24.65 26.337500000000002 70-71 26.0125 24.087500000000002 24.0 25.900000000000002 72-73 25.174999999999997 24.0375 23.925 26.8625 74-75 25.887500000000003 24.375 23.8625 25.874999999999996 76-77 27.224999999999998 23.575 23.65 25.55 78-79 26.424999999999997 25.424999999999997 22.6875 25.4625 80-81 25.387500000000003 24.0375 24.175 26.400000000000002 82-83 26.2125 23.6125 22.8625 27.3125 84-85 25.624999999999996 24.525 23.599999999999998 26.25 86-87 26.687499999999996 24.125 24.075 25.112499999999997 88-89 27.437499999999996 23.5875 22.875 26.1 90-91 26.6125 23.25 24.087500000000002 26.05 92-93 26.2875 24.7 23.724999999999998 25.2875 94-95 26.687499999999996 25.15 22.787499999999998 25.374999999999996 96-97 26.8375 24.587500000000002 23.6125 24.962500000000002 98-99 26.8125 24.1375 23.5125 25.5375 100 26.900000000000002 24.7 22.575 25.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.5 28 3.0 29 3.0 30 6.5 31 6.5 32 7.0 33 13.0 34 19.5 35 28.0 36 33.5 37 49.5 38 70.5 39 91.5 40 110.5 41 109.5 42 124.5 43 137.5 44 151.0 45 168.5 46 171.5 47 168.5 48 161.5 49 162.0 50 159.0 51 138.5 52 121.0 53 121.0 54 118.0 55 100.0 56 94.5 57 99.0 58 87.5 59 81.5 60 78.5 61 68.5 62 75.0 63 79.0 64 72.0 65 76.5 66 75.5 67 64.5 68 63.0 69 65.0 70 62.0 71 57.0 72 51.5 73 39.0 74 31.0 75 28.0 76 20.0 77 18.5 78 17.5 79 11.5 80 6.5 81 6.0 82 4.5 83 3.0 84 1.5 85 1.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0125 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040807 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040807_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.836 34.0 31.0 34.0 31.0 34.0 2 32.87 34.0 31.0 34.0 31.0 34.0 3 32.9505 34.0 31.0 34.0 31.0 34.0 4 36.34625 37.0 37.0 37.0 35.0 37.0 5 36.296 37.0 37.0 37.0 35.0 37.0 6 36.30075 37.0 37.0 37.0 35.0 37.0 7 36.24 37.0 37.0 37.0 35.0 37.0 8 36.26575 37.0 37.0 37.0 35.0 37.0 9 38.0195 39.0 39.0 39.0 35.0 39.0 10-11 37.962125 39.0 38.5 39.0 35.0 39.0 12-13 38.0195 39.0 39.0 39.0 35.0 39.0 14-15 39.62075 41.0 40.0 41.0 37.0 41.0 16-17 39.620999999999995 41.0 40.0 41.0 37.0 41.0 18-19 39.47225 41.0 40.0 41.0 36.5 41.0 20-21 39.493875 41.0 39.0 41.0 37.0 41.0 22-23 39.4075 41.0 39.0 41.0 36.0 41.0 24-25 39.301125 41.0 39.0 41.0 36.0 41.0 26-27 39.264250000000004 41.0 39.0 41.0 35.5 41.0 28-29 39.089124999999996 41.0 39.0 41.0 35.0 41.0 30-31 38.983625 40.0 38.0 41.0 35.0 41.0 32-33 38.830125 40.0 38.0 41.0 35.0 41.0 34-35 38.69575 40.0 38.0 41.0 34.5 41.0 36-37 38.519125 40.0 38.0 41.0 34.0 41.0 38-39 38.297375 40.0 37.0 41.0 33.5 41.0 40-41 38.123999999999995 40.0 37.0 41.0 33.0 41.0 42-43 37.829125 40.0 36.5 41.0 33.0 41.0 44-45 37.550375 40.0 35.5 41.0 32.0 41.0 46-47 37.440625 39.5 35.0 41.0 32.0 41.0 48-49 37.398250000000004 39.0 35.0 41.0 32.5 41.0 50-51 36.161375 38.0 34.0 40.0 30.5 40.5 52-53 36.187250000000006 38.0 34.5 39.5 31.0 40.5 54-55 36.608125 38.0 35.0 40.5 31.0 41.0 56-57 36.6705 38.0 35.0 41.0 31.5 41.0 58-59 36.774625 38.0 35.0 41.0 32.0 41.0 60-61 36.661375 37.5 35.0 41.0 32.0 41.0 62-63 36.265375 37.0 35.0 40.0 31.0 41.0 64-65 35.9975 36.5 35.0 40.0 31.0 41.0 66-67 35.631625 36.0 35.0 39.0 31.0 41.0 68-69 35.432500000000005 35.0 35.0 39.0 31.0 41.0 70-71 35.137375000000006 35.0 35.0 38.5 31.0 40.5 72-73 34.759125 35.0 34.0 37.0 31.0 39.5 74-75 34.46825 35.0 34.0 37.0 30.5 39.0 76-77 34.006375000000006 35.0 34.0 36.0 29.5 39.0 78-79 33.828125 35.0 34.0 36.0 30.0 37.0 80-81 33.5325 35.0 34.0 35.5 29.0 37.0 82-83 33.369375 35.0 34.0 35.0 29.0 36.5 84-85 33.0215 35.0 33.0 35.0 29.0 36.0 86-87 32.839375 35.0 33.0 35.0 29.0 36.0 88-89 32.506625 35.0 33.0 35.0 27.0 36.0 90-91 32.483000000000004 35.0 33.0 35.0 28.0 35.0 92-93 32.270125 35.0 33.0 35.0 27.5 35.0 94-95 32.090374999999995 35.0 33.0 35.0 27.0 35.0 96-97 31.962875 35.0 33.0 35.0 27.0 35.0 98-99 31.63925 35.0 33.0 35.0 25.5 35.0 100 31.47475 35.0 33.0 35.0 25.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.02841136454581772 1101 2 0.06862745098039369 1101 3 0.11149459783913329 1101 4 -0.03331332533013409 1101 5 0.07147859143657342 1101 6 0.055722288915568186 1101 7 -0.046468587434979725 1101 8 0.015206082432975165 1101 9 -0.20468187274909866 1101 10-11 0.004651860744296243 1101 12-13 -0.07565526210484563 1101 14-15 -0.06134953981592872 1101 16-17 0.06820228091236658 1101 18-19 0.22048819527811503 1101 20-21 0.0569477791116455 1101 22-23 0.023559423769505372 1101 24-25 -0.0688525410164047 1101 26-27 -0.1930522208883545 1101 28-29 -0.1339285714285694 1101 30-31 0.11434573829532013 1101 32-33 0.09653861544617826 1101 34-35 0.03581432573029275 1101 36-37 -0.10274109643857798 1101 38-39 0.04944477791116242 1101 40-41 -0.05944877951180416 1101 42-43 -0.08205782312925436 1101 44-45 -0.022333933573428055 1101 46-47 -0.1380802320928396 1101 48-49 -0.27826130452180564 1101 50-51 0.028536414565827783 1101 52-53 -0.19982993197279342 1101 54-55 -0.013305322128850605 1101 56-57 0.013530412164868721 1101 58-59 0.19457783113245597 1101 60-61 0.14550820328131664 1101 62-63 0.31520108043216766 1101 64-65 -0.0567476990796294 1101 66-67 -0.12127350940375692 1101 68-69 -0.11839735894358228 1101 70-71 0.1607142857142847 1101 72-73 -0.06139955982392564 1101 74-75 0.173044217687071 1101 76-77 -0.0029261704681857736 1101 78-79 -0.2845388155262114 1101 80-81 -0.18785014005602108 1101 82-83 -0.039865946378554895 1101 84-85 -0.11532112845137732 1101 86-87 -0.22591536614645946 1101 88-89 -0.28819027611044135 1101 90-91 -0.3062975190076074 1101 92-93 -0.2676570628251298 1101 94-95 -0.20860844337735074 1101 96-97 -0.3764005602240914 1101 98-99 -0.4292216886754687 1101 100 -0.3335334133653447 1105 1 0.02841136454581772 1105 2 -0.06862745098039369 1105 3 -0.1114945978391404 1105 4 0.033313325330126986 1105 5 -0.07147859143658053 1105 6 -0.055722288915568186 1105 7 0.04646858743497262 1105 8 -0.015206082432975165 1105 9 0.20468187274909866 1105 10-11 -0.004651860744296243 1105 12-13 0.07565526210484563 1105 14-15 0.06134953981592162 1105 16-17 -0.06820228091236658 1105 18-19 -0.22048819527811503 1105 20-21 -0.0569477791116455 1105 22-23 -0.023559423769505372 1105 24-25 0.0688525410164047 1105 26-27 0.1930522208883545 1105 28-29 0.1339285714285765 1105 30-31 -0.11434573829532013 1105 32-33 -0.09653861544617826 1105 34-35 -0.03581432573029275 1105 36-37 0.10274109643857798 1105 38-39 -0.04944477791116242 1105 40-41 0.05944877951180416 1105 42-43 0.08205782312924725 1105 44-45 0.022333933573428055 1105 46-47 0.1380802320928396 1105 48-49 0.27826130452180564 1105 50-51 -0.028536414565820678 1105 52-53 0.1998299319727863 1105 54-55 0.01330532212885771 1105 56-57 -0.013530412164868721 1105 58-59 -0.19457783113245597 1105 60-61 -0.14550820328131664 1105 62-63 -0.31520108043217476 1105 64-65 0.0567476990796294 1105 66-67 0.12127350940376402 1105 68-69 0.11839735894357517 1105 70-71 -0.1607142857142847 1105 72-73 0.06139955982392564 1105 74-75 -0.173044217687071 1105 76-77 0.002926170468192879 1105 78-79 0.2845388155262114 1105 80-81 0.18785014005602108 1105 82-83 0.03986594637854779 1105 84-85 0.11532112845137732 1105 86-87 0.22591536614645946 1105 88-89 0.28819027611044135 1105 90-91 0.30629751900760027 1105 92-93 0.2676570628251227 1105 94-95 0.20860844337735074 1105 96-97 0.3764005602240843 1105 98-99 0.4292216886754687 1105 100 0.3335334133653447 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 2.0 17 6.0 18 6.0 19 8.0 20 6.0 21 11.0 22 12.0 23 10.0 24 10.0 25 20.0 26 31.0 27 29.0 28 47.0 29 44.0 30 65.0 31 78.0 32 107.0 33 133.0 34 232.0 35 373.0 36 603.0 37 871.0 38 1070.0 39 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.900000000000002 12.0 11.975 53.125 2 24.825 18.525 29.275000000000002 27.375 3 25.25 20.3 21.9 32.550000000000004 4 29.775000000000002 24.25 18.0 27.975 5 31.574999999999996 28.225 18.6 21.6 6 23.95 34.599999999999994 19.2 22.25 7 21.825 18.95 35.699999999999996 23.525 8 22.575 22.7 25.85 28.875 9 23.425 20.225 29.299999999999997 27.05 10-11 26.025 26.987499999999997 21.6875 25.3 12-13 24.474999999999998 23.1125 24.637500000000003 27.775 14-15 24.4125 24.5 24.1875 26.900000000000002 16-17 26.187500000000004 24.1375 23.25 26.424999999999997 18-19 25.85 23.325000000000003 24.4125 26.4125 20-21 25.5 24.525 23.75 26.224999999999998 22-23 25.624999999999996 24.7375 23.95 25.687500000000004 24-25 25.587500000000002 24.9375 23.849999999999998 25.624999999999996 26-27 26.325 24.0625 23.549999999999997 26.0625 28-29 25.387500000000003 24.45 23.525 26.637499999999996 30-31 25.4375 24.325 24.55 25.687500000000004 32-33 25.974999999999998 24.762500000000003 22.912499999999998 26.35 34-35 25.912499999999998 23.925 24.0375 26.125 36-37 25.4 24.587500000000002 23.974999999999998 26.0375 38-39 24.9375 24.6875 24.1125 26.2625 40-41 26.2125 25.137500000000003 22.9875 25.662499999999998 42-43 25.45 23.35 23.5 27.700000000000003 44-45 24.4375 24.275 25.224999999999998 26.0625 46-47 26.1125 24.9 23.3625 25.624999999999996 48-49 25.8125 23.724999999999998 23.5875 26.875 50-51 25.387500000000003 24.1625 24.825 25.624999999999996 52-53 26.375 23.962500000000002 22.912499999999998 26.75 54-55 26.487500000000004 23.7 22.400000000000002 27.4125 56-57 25.8 24.7 23.275000000000002 26.224999999999998 58-59 25.837500000000002 23.849999999999998 24.0625 26.25 60-61 25.55 23.7 24.3 26.450000000000003 62-63 26.400000000000002 24.05 24.525 25.025 64-65 26.75 23.6125 24.087500000000002 25.55 66-67 25.8625 23.674999999999997 24.2625 26.200000000000003 68-69 26.125 24.525 24.2 25.15 70-71 25.8125 24.4875 23.9125 25.7875 72-73 26.2875 23.4125 23.799999999999997 26.5 74-75 26.3125 23.8375 23.5 26.35 76-77 26.424999999999997 24.0625 24.5125 25.0 78-79 26.1125 24.2875 23.875 25.724999999999998 80-81 25.937500000000004 24.5625 23.4125 26.087500000000002 82-83 25.0 24.762500000000003 23.7375 26.5 84-85 25.900000000000002 24.3625 24.25 25.4875 86-87 26.387500000000003 24.087500000000002 23.2875 26.237500000000004 88-89 26.3 24.2625 23.6125 25.825 90-91 25.662499999999998 24.4875 23.775 26.075 92-93 25.687500000000004 24.712500000000002 23.599999999999998 26.0 94-95 27.474999999999998 24.4875 23.0375 25.0 96-97 25.7375 24.5625 23.8125 25.887500000000003 98-99 27.125 24.325 24.25 24.3 100 27.450000000000003 24.625 22.375 25.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 1.0 29 2.0 30 4.0 31 5.0 32 9.0 33 15.5 34 23.5 35 28.0 36 33.0 37 47.0 38 61.5 39 73.0 40 93.5 41 124.5 42 148.0 43 163.5 44 155.5 45 157.0 46 181.0 47 189.0 48 172.0 49 150.5 50 155.0 51 147.0 52 124.0 53 108.0 54 111.5 55 114.0 56 94.0 57 75.0 58 81.5 59 86.5 60 73.0 61 68.5 62 74.0 63 79.5 64 74.5 65 74.5 66 78.0 67 82.5 68 72.5 69 55.5 70 54.0 71 50.0 72 51.0 73 40.0 74 27.5 75 28.5 76 21.5 77 17.5 78 14.5 79 12.5 80 9.0 81 3.0 82 1.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701822 spots for SRR28040807.sra Written 701822 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra Read 701814 spots for SRR28040807.sra Written 701814 spots for SRR28040807.sra SRR ids: ['SRR28040807.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o_h49aj2 SRR28040807.sra spots: 14036288 blocks: [[1, 701814], [701815, 1403628], [1403629, 2105442], [2105443, 2807256], [2807257, 3509070], [3509071, 4210884], [4210885, 4912698], [4912699, 5614512], [5614513, 6316326], [6316327, 7018140], [7018141, 7719954], [7719955, 8421768], [8421769, 9123582], [9123583, 9825396], [9825397, 10527210], [10527211, 11229024], [11229025, 11930838], [11930839, 12632652], [12632653, 13334466], [13334467, 14036288]] SRR28040807 file size 3655791 SRR28040807 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040807 SRR28040807_1.fastq SRR28040807_2.fastq Input file: SRR28040807_1.fastq Paired file: SRR28040807_2.fastq trimmed: SRR28040807-trimmed-pair1.fastq, SRR28040807-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:51:50 2024 >> started Fri Dec 6 13:52:03 2024 >> done (13.491s) 14036288 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 14036288 (100.00%) read pairs available; of these: 2619957 (18.67%) trimmed read pairs available after processing 11416331 (81.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 14 0.00% 52 18 0.00% 53 80 0.00% 54 130 0.00% 55 225 0.00% 56 340 0.00% 57 445 0.00% 58 664 0.00% 59 763 0.01% 60 1017 0.01% 61 1108 0.01% 62 1401 0.01% 63 1612 0.01% 64 1881 0.01% 65 2123 0.02% 66 2365 0.02% 67 2636 0.02% 68 2963 0.02% 69 3304 0.02% 70 3669 0.03% 71 4172 0.03% 72 4728 0.03% 73 5592 0.04% 74 6412 0.05% 75 10342 0.07% 76 17684 0.13% 77 21345 0.15% 78 23468 0.17% 79 26103 0.19% 80 28102 0.20% 81 30140 0.21% 82 32055 0.23% 83 33654 0.24% 84 35706 0.25% 85 37312 0.27% 86 39566 0.28% 87 43303 0.31% 88 36452 0.26% 89 44109 0.31% 90 50225 0.36% 91 155488 1.11% 92 169047 1.20% 93 182920 1.30% 94 197876 1.41% 95 212671 1.52% 96 228974 1.63% 97 261567 1.86% 98 309622 2.21% 99 344564 2.45% 100 11416331 81.33% 14036288 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=22 prefix-density=0.18 prefix-fanout=2.2 sequence=CGGCGCGGTACCGCGCCG criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=282.10 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=25.4 sequence=GCCGCCGCCGCG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=21 prefix-density=0.19 prefix-fanout=2.4 sequence=CGGCGCGGTACCGCGCCG criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=276.76 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=21.9 sequence=CGCCGCCGCCGT SRR28040807 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:52:41 Started mapping on | Dec 06 13:52:41 Finished on | Dec 06 13:53:21 Mapping speed, Million of reads per hour | 1263.27 Number of input reads | 14036288 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 13569085 Uniquely mapped reads % | 96.67% Average mapped length | 196.55 Number of splices: Total | 8553169 Number of splices: Annotated (sjdb) | 8046052 Number of splices: GT/AG | 8405019 Number of splices: GC/AG | 128724 Number of splices: AT/AC | 6180 Number of splices: Non-canonical | 13246 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 163623 % of reads mapped to multiple loci | 1.17% Number of reads mapped to too many loci | 23811 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 303593 303593 303593 N_multimapping 163623 163623 163623 N_noFeature 383330 6818627 6906594 N_ambiguous 254111 14525 14433 UnstrandedReadsAssigned:12931644 PositiveStrandReadsAssigned:6735933 NegativeStrandReadsAssigned:6648058 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040807 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040807-trimmed-pair1.fastq SRR28040807-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,036,288 reads, 13,294,456 reads pseudoaligned [quant] estimated average fragment length: 165.52 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR28040807.ke.tsv 35125 SRR28040807.se.tsv 88098 total ==> SRR28040807.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.579 0 0 PNS24247 1044 879.48 35.6145 4.17097 PNS24249 1928 1763.48 227.879 13.3097 PNS24246 1044 879.48 35.6145 4.17097 PNS24248 1044 879.48 35.6145 4.17097 PNS24244 1471 1306.48 42.2777 3.33307 PNS24243 293 139.706 11 8.10987 KQK14069 1603 1438.48 5573.68 399.093 KQK14071 474 312.141 280.055 92.4119 ==> SRR28040807.se.tsv <== BRADI_1g14170v3 5939 BRADI_1g53295v3 29 BRADI_1g59795v3 250 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 680 BRADI_1g74790v3 82 BRADI_1g09890v3 0 BRADI_1g77505v3 225 BRADI_1g48960v3 0 SRR28040807 completed mapping pipeline successfully