Starting /dee2/code/volunteer_pipeline.sh SRR28040808 current disk space = 1550805549056 free memory = 1599814980 SRR28040808 SRAfilesize b6b0b68b1504c7434c74721826881f8c SRR28040808.sra SRR28040808.sra file validated SRR28040808 is paired end SRR28040808 is conventional basespace SRR28040808 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040808_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.601 34.0 31.0 34.0 31.0 34.0 2 32.983 34.0 33.0 34.0 31.0 34.0 3 33.15625 34.0 34.0 34.0 31.0 34.0 4 36.56075 37.0 37.0 37.0 35.0 37.0 5 36.50525 37.0 37.0 37.0 35.0 37.0 6 36.479 37.0 37.0 37.0 35.0 37.0 7 36.42275 37.0 37.0 37.0 35.0 37.0 8 36.44075 37.0 37.0 37.0 35.0 37.0 9 38.34675 39.0 39.0 39.0 37.0 39.0 10-11 38.341375 39.0 39.0 39.0 37.0 39.0 12-13 38.234750000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.78775 41.0 40.0 41.0 37.0 41.0 16-17 39.73925 41.0 40.0 41.0 37.5 41.0 18-19 39.700375 41.0 40.0 41.0 37.0 41.0 20-21 39.590875 41.0 39.5 41.0 37.0 41.0 22-23 39.496 41.0 39.0 41.0 36.0 41.0 24-25 39.423625 41.0 39.0 41.0 36.5 41.0 26-27 39.195125 41.0 39.0 41.0 35.5 41.0 28-29 39.09875 40.5 39.0 41.0 35.0 41.0 30-31 38.913375 40.0 38.0 41.0 35.0 41.0 32-33 38.704375 40.0 38.0 41.0 34.5 41.0 34-35 38.646 40.0 38.0 41.0 34.5 41.0 36-37 38.7 40.0 38.0 41.0 35.0 41.0 38-39 38.583625 40.0 38.0 41.0 34.5 41.0 40-41 38.441375 40.0 37.0 41.0 34.0 41.0 42-43 38.208625 40.0 37.0 41.0 33.5 41.0 44-45 37.985125 40.0 36.0 41.0 33.0 41.0 46-47 37.789 40.0 35.0 41.0 33.0 41.0 48-49 37.699 39.5 35.0 41.0 33.0 41.0 50-51 37.52575 39.0 35.0 41.0 33.0 41.0 52-53 37.2885 39.0 35.0 41.0 33.0 41.0 54-55 36.9305 38.0 35.0 41.0 32.5 41.0 56-57 36.654375 37.5 35.0 41.0 32.0 41.0 58-59 36.370875 37.0 35.0 40.0 31.0 41.0 60-61 36.033625 36.5 35.0 40.0 31.0 41.0 62-63 35.701499999999996 36.0 35.0 40.0 31.0 41.0 64-65 35.39025 35.0 35.0 39.0 31.0 41.0 66-67 35.052499999999995 35.0 34.0 39.0 30.5 41.0 68-69 34.713875 35.0 34.0 38.0 30.0 40.5 70-71 34.35575 35.0 34.0 37.0 30.0 40.0 72-73 34.052125000000004 35.0 34.0 37.0 29.0 39.0 74-75 33.538624999999996 35.0 33.5 36.0 28.5 39.0 76-77 31.817375 33.5 31.0 35.0 25.5 36.5 78-79 33.0235 35.0 33.0 35.0 28.0 37.0 80-81 33.036625 35.0 33.0 35.0 29.0 37.0 82-83 32.872 35.0 33.0 35.0 29.0 36.5 84-85 32.683375 35.0 33.5 35.0 28.5 36.0 86-87 32.400625000000005 35.0 33.0 35.0 27.0 36.0 88-89 32.24275 35.0 33.0 35.0 27.0 36.0 90-91 31.920125 35.0 33.0 35.0 25.5 35.0 92-93 31.749000000000002 35.0 33.0 35.0 25.0 35.0 94-95 31.5885 35.0 33.0 35.0 24.5 35.0 96-97 31.341375 35.0 33.0 35.0 24.0 35.0 98-99 31.056125 35.0 32.5 35.0 24.0 35.0 100 30.80875 35.0 32.0 35.0 20.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.6216640305289829 1101 2 -0.3882528683688591 1101 3 -0.2410685144736462 1101 4 -0.15939845848710377 1101 5 -0.14923049885767625 1101 6 -0.15718912404911123 1101 7 -0.21086590846325493 1101 8 -0.1899902086314711 1101 9 -0.1472220130049493 1101 10-11 -0.25182646682232956 1101 12-13 -0.1282543747332454 1101 14-15 -0.20453917802716148 1101 16-17 -0.2437674173382547 1101 18-19 -0.36627877783635654 1101 20-21 -0.36605909969622275 1101 22-23 -0.4131078807963604 1101 24-25 -0.49035299138861177 1101 26-27 -0.4656862745098067 1101 28-29 -0.4410823228138838 1101 30-31 -0.2842509603072969 1101 32-33 -0.4865494213050141 1101 34-35 -0.35558359067058376 1101 36-37 -0.5367239085134727 1101 38-39 -0.4261002736561963 1101 40-41 -0.45608320152644666 1101 42-43 -0.4839132836233091 1101 44-45 -0.3181504355903684 1101 46-47 -0.600568652557051 1101 48-49 -0.32534960206874075 1101 50-51 -0.25848585272777314 1101 52-53 -0.3283623308478312 1101 54-55 -0.3060555848459785 1101 56-57 -0.4153046621977836 1101 58-59 -0.23148427104516855 1101 60-61 -0.23489869699480437 1101 62-63 -0.36711355476889196 1101 64-65 -0.35228841856845605 1101 66-67 -0.5900303783485228 1101 68-69 -0.6104165097537049 1101 70-71 -0.6126948858928998 1101 72-73 -0.7063907509226439 1101 74-75 -0.7117257914689574 1101 76-77 -0.8061936682483477 1101 78-79 -0.9709083377268968 1101 80-81 -0.880080841555575 1101 82-83 -0.872461148351789 1101 84-85 -1.1030541537998033 1101 86-87 -0.9928761517411075 1101 88-89 -1.1057781627375647 1101 90-91 -0.9592653962993651 1101 92-93 -1.2230235243905518 1101 94-95 -1.395521076548416 1101 96-97 -1.6378825537897619 1101 98-99 -2.0009163716703107 1101 100 -1.9208656574025262 1104 1 0.6216640305289829 1104 2 0.388252868368852 1104 3 0.2410685144736533 1104 4 0.15939845848711087 1104 5 0.14923049885767625 1104 6 0.15718912404910412 1104 7 0.21086590846325493 1104 8 0.18999020863146399 1104 9 0.1472220130049422 1104 10-11 0.25182646682232246 1104 12-13 0.1282543747332454 1104 14-15 0.2045391780271686 1104 16-17 0.24376741733824758 1104 18-19 0.36627877783635654 1104 20-21 0.36605909969621564 1104 22-23 0.4131078807963675 1104 24-25 0.4903529913886189 1104 26-27 0.4656862745098067 1104 28-29 0.4410823228138909 1104 30-31 0.284250960307304 1104 32-33 0.4865494213050141 1104 34-35 0.35558359067058376 1104 36-37 0.5367239085134727 1104 38-39 0.4261002736561963 1104 40-41 0.45608320152645376 1104 42-43 0.4839132836233091 1104 44-45 0.3181504355903684 1104 46-47 0.6005686525570582 1104 48-49 0.32534960206874075 1104 50-51 0.25848585272778024 1104 52-53 0.3283623308478312 1104 54-55 0.3060555848459714 1104 56-57 0.4153046621977836 1104 58-59 0.23148427104516855 1104 60-61 0.23489869699480437 1104 62-63 0.36711355476889906 1104 64-65 0.35228841856844895 1104 66-67 0.5900303783485228 1104 68-69 0.610416509753712 1104 70-71 0.6126948858928927 1104 72-73 0.706390750922651 1104 74-75 0.7117257914689574 1104 76-77 0.8061936682483548 1104 78-79 0.9709083377268968 1104 80-81 0.880080841555575 1104 82-83 0.8724611483517819 1104 84-85 1.1030541537998033 1104 86-87 0.9928761517411075 1104 88-89 1.1057781627375647 1104 90-91 0.9592653962993651 1104 92-93 1.2230235243905518 1104 94-95 1.395521076548416 1104 96-97 1.6378825537897583 1104 98-99 2.0009163716703107 1104 100 1.9208656574025227 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 6.0 18 13.0 19 16.0 20 6.0 21 15.0 22 12.0 23 14.0 24 19.0 25 20.0 26 27.0 27 32.0 28 38.0 29 60.0 30 64.0 31 68.0 32 100.0 33 156.0 34 197.0 35 369.0 36 651.0 37 887.0 38 1020.0 39 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.209231549581535 12.908952574182095 10.88004057823992 51.00177529799645 2 25.25 16.8 30.2 27.750000000000004 3 25.25 20.175 22.05 32.525 4 29.525000000000002 22.85 18.075 29.549999999999997 5 31.874999999999996 27.500000000000004 18.725 21.9 6 24.975 33.275 19.225 22.525000000000002 7 23.599999999999998 19.15 34.025 23.225 8 23.200000000000003 22.275 25.3 29.225 9 22.175 20.65 30.025000000000002 27.150000000000002 10-11 26.125 26.787499999999998 20.150000000000002 26.937499999999996 12-13 25.4875 22.8125 24.6 27.1 14-15 25.424999999999997 24.575 23.775 26.224999999999998 16-17 26.724999999999998 23.6875 22.175 27.4125 18-19 25.45 24.425 22.900000000000002 27.224999999999998 20-21 25.75 24.425 23.3 26.525 22-23 26.125 24.275 23.45 26.150000000000002 24-25 25.412499999999998 23.8625 23.200000000000003 27.525 26-27 25.837500000000002 24.325 22.6375 27.200000000000003 28-29 27.1625 23.425 22.225 27.187499999999996 30-31 26.0 23.6625 23.2375 27.1 32-33 25.75 23.4125 23.6625 27.175 34-35 27.125 22.95 22.3875 27.537499999999998 36-37 26.125 23.7 23.150000000000002 27.025 38-39 26.137500000000003 24.775 22.5875 26.5 40-41 26.8 24.212500000000002 22.112499999999997 26.875 42-43 25.337500000000002 24.4375 23.225 27.0 44-45 25.974999999999998 23.8875 22.7 27.437499999999996 46-47 25.9875 23.7625 22.75 27.500000000000004 48-49 25.05 23.175 24.0 27.775 50-51 26.1125 23.5375 22.8 27.55 52-53 26.75 23.2625 23.1625 26.825 54-55 26.5125 23.3875 22.8375 27.2625 56-57 26.650000000000002 24.2625 23.25 25.837500000000002 58-59 27.800000000000004 23.5875 21.9625 26.650000000000002 60-61 26.487500000000004 23.2125 23.3 27.0 62-63 26.737499999999997 23.5 22.625 27.1375 64-65 27.275 22.675 22.775000000000002 27.275 66-67 26.5 23.625 23.0875 26.787499999999998 68-69 26.8625 23.45 23.4125 26.275 70-71 26.937499999999996 23.549999999999997 22.625 26.887499999999996 72-73 26.974999999999998 22.9625 23.5 26.5625 74-75 26.387500000000003 23.6125 23.425 26.575 76-77 26.450000000000003 23.7 22.8625 26.987499999999997 78-79 26.5375 23.275000000000002 23.0875 27.1 80-81 26.937499999999996 24.3875 22.3625 26.3125 82-83 26.487500000000004 23.925 22.275 27.3125 84-85 26.087500000000002 23.4625 24.325 26.125 86-87 27.462500000000002 22.775000000000002 23.6125 26.150000000000002 88-89 27.0 23.3875 22.8375 26.775 90-91 27.0 22.5 23.9875 26.5125 92-93 27.200000000000003 22.8375 23.95 26.0125 94-95 27.8875 24.15 22.3875 25.575 96-97 27.675 23.6125 21.762500000000003 26.950000000000003 98-99 28.1625 22.7625 22.3125 26.7625 100 28.875 23.5 22.05 25.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.0 24 0.5 25 1.5 26 1.0 27 0.5 28 3.0 29 3.5 30 3.0 31 6.0 32 12.5 33 18.0 34 21.5 35 33.0 36 42.5 37 48.5 38 61.5 39 76.0 40 94.5 41 112.0 42 141.5 43 151.0 44 139.0 45 140.0 46 147.0 47 147.0 48 136.0 49 124.0 50 123.0 51 120.0 52 111.0 53 100.5 54 93.0 55 91.5 56 78.0 57 87.5 58 101.0 59 94.5 60 89.5 61 92.0 62 95.5 63 89.5 64 91.0 65 90.0 66 89.0 67 84.5 68 71.0 69 71.0 70 68.0 71 64.5 72 64.5 73 58.0 74 41.0 75 32.5 76 35.0 77 27.5 78 20.5 79 18.0 80 13.5 81 10.5 82 6.0 83 2.0 84 2.0 85 2.0 86 1.5 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040808 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040808_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0125 34.0 33.0 34.0 31.0 34.0 2 33.14525 34.0 33.0 34.0 31.0 34.0 3 33.192 34.0 34.0 34.0 31.0 34.0 4 36.45675 37.0 37.0 37.0 35.0 37.0 5 36.39625 37.0 37.0 37.0 35.0 37.0 6 36.40525 37.0 37.0 37.0 35.0 37.0 7 36.4345 37.0 37.0 37.0 35.0 37.0 8 36.388 37.0 37.0 37.0 35.0 37.0 9 38.24175 39.0 39.0 39.0 37.0 39.0 10-11 38.23475 39.0 39.0 39.0 37.0 39.0 12-13 38.24925 39.0 39.0 39.0 37.0 39.0 14-15 39.831125 41.0 40.0 41.0 38.0 41.0 16-17 39.726875 41.0 40.0 41.0 37.5 41.0 18-19 39.7285 41.0 40.0 41.0 37.0 41.0 20-21 39.696875000000006 41.0 40.0 41.0 37.0 41.0 22-23 39.61150000000001 41.0 40.0 41.0 37.0 41.0 24-25 39.521125 41.0 40.0 41.0 37.0 41.0 26-27 39.43875 41.0 39.0 41.0 36.0 41.0 28-29 39.338499999999996 41.0 39.0 41.0 36.0 41.0 30-31 39.156000000000006 41.0 39.0 41.0 35.0 41.0 32-33 38.987750000000005 40.5 38.5 41.0 35.0 41.0 34-35 38.848 40.0 38.0 41.0 35.0 41.0 36-37 38.60675 40.0 38.0 41.0 34.0 41.0 38-39 38.388875 40.0 37.5 41.0 34.0 41.0 40-41 38.203625 40.0 37.0 41.0 33.5 41.0 42-43 37.871875 40.0 36.5 41.0 33.0 41.0 44-45 37.688874999999996 40.0 35.0 41.0 33.0 41.0 46-47 37.506249999999994 39.0 35.0 41.0 33.0 41.0 48-49 37.349375 39.0 35.0 41.0 33.0 41.0 50-51 36.09625 38.0 34.0 40.0 30.0 40.5 52-53 36.14825 38.0 34.5 39.5 30.5 40.5 54-55 36.60325 38.0 35.0 40.5 31.0 41.0 56-57 36.573125 37.5 35.0 40.5 31.5 41.0 58-59 36.693375 37.0 35.0 41.0 33.0 41.0 60-61 36.492999999999995 37.0 35.0 41.0 32.5 41.0 62-63 36.193 36.0 35.0 40.0 32.5 41.0 64-65 35.920375 35.5 35.0 39.5 32.0 41.0 66-67 35.629125 35.0 35.0 39.0 31.5 41.0 68-69 35.285625 35.0 35.0 39.0 31.0 41.0 70-71 35.020624999999995 35.0 35.0 37.0 31.0 40.5 72-73 34.720875 35.0 35.0 37.0 31.0 39.0 74-75 34.377250000000004 35.0 34.0 36.5 30.5 39.0 76-77 34.1455 35.0 34.0 36.0 30.5 38.5 78-79 33.802125000000004 35.0 34.0 36.0 30.0 37.0 80-81 33.587 35.0 34.0 35.0 30.0 37.0 82-83 33.296375 35.0 34.0 35.0 29.0 36.5 84-85 33.14175 35.0 34.0 35.0 29.0 36.0 86-87 32.957499999999996 35.0 34.0 35.0 29.0 36.0 88-89 32.681749999999994 35.0 33.0 35.0 29.0 36.0 90-91 32.534625 35.0 33.5 35.0 27.0 35.0 92-93 32.412 35.0 33.0 35.0 27.0 35.0 94-95 32.272125 35.0 33.0 35.0 27.0 35.0 96-97 31.959249999999997 35.0 33.0 35.0 26.5 35.0 98-99 31.791375 35.0 33.0 35.0 25.5 35.0 100 31.6765 35.0 33.0 35.0 27.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.16543646908187526 1101 2 -0.14970751424770157 1101 3 -0.3193241445105599 1101 4 -0.15836910948758742 1101 5 -0.015164068188092017 1101 6 0.03321533478948879 1101 7 -0.008711807386205805 1101 8 -0.09178780346965709 1101 9 -0.20141347191885473 1101 10-11 -0.10705229595038901 1101 12-13 -0.16551178730134808 1101 14-15 -0.2540358012603221 1101 16-17 -0.23985714644371825 1101 18-19 -0.18748587783385062 1101 20-21 -0.31935552710200454 1101 22-23 -0.04551103411915136 1101 24-25 -0.1715246918229525 1101 26-27 -0.3193994627300327 1101 28-29 -0.17427380683387383 1101 30-31 -0.5199467751249074 1101 32-33 -0.3895646606914198 1101 34-35 -0.29191458913911106 1101 36-37 -0.44435238884286576 1101 38-39 -0.288650799628428 1101 40-41 -0.3042165649870725 1101 42-43 -0.3136250659034374 1101 44-45 -0.5678052270844347 1101 46-47 -0.6062802842007429 1101 48-49 -0.5005648866460817 1101 50-51 -0.5040922899249338 1101 52-53 -0.4182797318671376 1101 54-55 -0.6231578418819481 1101 56-57 -0.3584958951570343 1101 58-59 -0.2135459817729881 1101 60-61 -0.15934196982249915 1101 62-63 -0.2916698049258102 1101 64-65 -0.29217820290728014 1101 66-67 -0.3125455047576011 1101 68-69 -0.04497125354622966 1101 70-71 -0.39374482187241 1101 72-73 -0.19125806532600365 1101 74-75 -0.18726619969370262 1101 76-77 -0.2551216389244573 1101 78-79 -0.17977203685571652 1101 80-81 -0.52116441967312 1101 82-83 -0.42974693078255655 1101 84-85 -0.4856518791895752 1101 86-87 -0.2831776756797453 1101 88-89 -0.32191634656423673 1101 90-91 -0.4900517185107063 1101 92-93 -0.2770768999020845 1101 94-95 -0.31493685822600526 1101 96-97 -0.5135510029876187 1101 98-99 -0.7517762546760096 1101 100 -0.8613014988325638 1104 1 0.16543646908186815 1104 2 0.14970751424769446 1104 3 0.3193241445105528 1104 4 0.15836910948758742 1104 5 0.015164068188099122 1104 6 -0.03321533478948169 1104 7 0.008711807386205805 1104 8 0.09178780346965709 1104 9 0.20141347191885473 1104 10-11 0.10705229595038901 1104 12-13 0.16551178730134808 1104 14-15 0.2540358012603221 1104 16-17 0.23985714644372536 1104 18-19 0.18748587783384352 1104 20-21 0.31935552710200454 1104 22-23 0.04551103411915136 1104 24-25 0.1715246918229525 1104 26-27 0.31939946273003983 1104 28-29 0.17427380683387383 1104 30-31 0.5199467751249003 1104 32-33 0.3895646606914198 1104 34-35 0.29191458913911106 1104 36-37 0.44435238884286576 1104 38-39 0.2886507996284351 1104 40-41 0.3042165649870725 1104 42-43 0.3136250659034445 1104 44-45 0.5678052270844276 1104 46-47 0.60628028420075 1104 48-49 0.5005648866460746 1104 50-51 0.5040922899249338 1104 52-53 0.4182797318671376 1104 54-55 0.6231578418819552 1104 56-57 0.3584958951570343 1104 58-59 0.2135459817729881 1104 60-61 0.15934196982249915 1104 62-63 0.2916698049258102 1104 64-65 0.29217820290728724 1104 66-67 0.3125455047576011 1104 68-69 0.04497125354623677 1104 70-71 0.39374482187241 1104 72-73 0.19125806532599654 1104 74-75 0.18726619969370972 1104 76-77 0.2551216389244573 1104 78-79 0.17977203685571652 1104 80-81 0.52116441967312 1104 82-83 0.42974693078255655 1104 84-85 0.4856518791895752 1104 86-87 0.2831776756797453 1104 88-89 0.3219163465642296 1104 90-91 0.4900517185107063 1104 92-93 0.2770768999020845 1104 94-95 0.31493685822600526 1104 96-97 0.5135510029876258 1104 98-99 0.7517762546760025 1104 100 0.8613014988325673 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 4.0 19 7.0 20 12.0 21 14.0 22 12.0 23 13.0 24 26.0 25 15.0 26 24.0 27 29.0 28 37.0 29 49.0 30 48.0 31 63.0 32 93.0 33 102.0 34 186.0 35 405.0 36 677.0 37 909.0 38 1055.0 39 216.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.0 12.275 9.4 54.325 2 25.3 16.775000000000002 30.9 27.025 3 25.5 20.875 21.55 32.074999999999996 4 29.75 22.225 17.299999999999997 30.725 5 30.525000000000002 27.725 19.275000000000002 22.475 6 27.250000000000004 30.975 19.7 22.075 7 23.875 20.125 32.725 23.275000000000002 8 24.5 21.375 25.124999999999996 28.999999999999996 9 23.5 20.474999999999998 29.049999999999997 26.974999999999998 10-11 25.162499999999998 27.8875 19.8375 27.1125 12-13 24.9125 23.0625 24.474999999999998 27.55 14-15 26.437500000000004 23.3875 23.075000000000003 27.1 16-17 26.950000000000003 23.775 22.325 26.950000000000003 18-19 25.2625 24.337500000000002 22.95 27.450000000000003 20-21 26.625 23.925 22.875 26.575 22-23 25.924999999999997 24.175 23.125 26.775 24-25 25.8625 23.9 23.1875 27.05 26-27 25.7625 23.849999999999998 23.2625 27.125 28-29 25.724999999999998 23.3125 23.025000000000002 27.9375 30-31 26.05 24.462500000000002 23.25 26.237500000000004 32-33 24.95 24.337500000000002 23.6875 27.025 34-35 26.325 23.674999999999997 22.8 27.200000000000003 36-37 25.3125 23.3875 24.587500000000002 26.7125 38-39 26.950000000000003 22.6875 22.3625 28.000000000000004 40-41 26.125 22.575 23.625 27.675 42-43 26.2125 23.474999999999998 23.3625 26.950000000000003 44-45 26.025 23.9125 22.9875 27.075 46-47 25.837500000000002 23.4125 22.8375 27.9125 48-49 27.0875 22.7375 23.0375 27.1375 50-51 26.775 23.8375 22.925 26.4625 52-53 27.3875 23.05 23.05 26.5125 54-55 26.6125 23.4375 22.25 27.700000000000003 56-57 25.4 23.962500000000002 23.0875 27.55 58-59 26.450000000000003 23.325000000000003 22.662499999999998 27.5625 60-61 25.937500000000004 23.6375 23.5125 26.9125 62-63 27.1375 23.375 23.125 26.3625 64-65 27.5875 22.325 23.6125 26.474999999999998 66-67 26.2625 23.400000000000002 23.525 26.8125 68-69 26.5125 23.400000000000002 23.4375 26.650000000000002 70-71 26.424999999999997 23.425 23.4625 26.687499999999996 72-73 26.724999999999998 22.75 23.225 27.3 74-75 26.825 23.1875 23.799999999999997 26.187500000000004 76-77 27.1 22.787499999999998 23.849999999999998 26.2625 78-79 25.937500000000004 22.825 23.7625 27.474999999999998 80-81 27.175 24.087500000000002 22.6875 26.05 82-83 27.1125 23.3625 23.075000000000003 26.450000000000003 84-85 26.5125 23.175 24.125 26.187500000000004 86-87 26.674999999999997 23.95 23.5 25.874999999999996 88-89 26.687499999999996 23.2125 23.2875 26.8125 90-91 26.6 23.7 23.05 26.650000000000002 92-93 26.937499999999996 23.400000000000002 22.425 27.237499999999997 94-95 27.6125 23.474999999999998 22.662499999999998 26.25 96-97 26.875 22.662499999999998 23.5625 26.900000000000002 98-99 28.125 23.5 22.8875 25.4875 100 26.875 24.25 22.650000000000002 26.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 2.5 26 2.5 27 2.5 28 2.5 29 3.0 30 7.0 31 8.0 32 11.0 33 19.0 34 19.5 35 29.5 36 38.0 37 38.0 38 64.0 39 77.5 40 92.5 41 125.0 42 144.5 43 141.0 44 128.5 45 134.0 46 147.0 47 142.5 48 133.5 49 119.0 50 128.5 51 136.5 52 106.5 53 94.5 54 91.5 55 97.0 56 97.5 57 97.0 58 95.5 59 91.0 60 93.5 61 96.0 62 98.0 63 86.0 64 76.5 65 83.0 66 88.0 67 82.0 68 83.5 69 75.0 70 70.0 71 73.0 72 62.0 73 53.0 74 46.5 75 40.0 76 29.5 77 24.5 78 18.0 79 15.0 80 13.0 81 7.5 82 6.5 83 5.0 84 2.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5789076264787314 1.15 3 0.0 0.0 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777135 spots for SRR28040808.sra Written 777135 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra Read 777123 spots for SRR28040808.sra Written 777123 spots for SRR28040808.sra SRR ids: ['SRR28040808.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vn4zxid8 SRR28040808.sra spots: 15542472 blocks: [[1, 777123], [777124, 1554246], [1554247, 2331369], [2331370, 3108492], [3108493, 3885615], [3885616, 4662738], [4662739, 5439861], [5439862, 6216984], [6216985, 6994107], [6994108, 7771230], [7771231, 8548353], [8548354, 9325476], [9325477, 10102599], [10102600, 10879722], [10879723, 11656845], [11656846, 12433968], [12433969, 13211091], [13211092, 13988214], [13988215, 14765337], [14765338, 15542472]] SRR28040808 file size 4049211 SRR28040808 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040808 SRR28040808_1.fastq SRR28040808_2.fastq Input file: SRR28040808_1.fastq Paired file: SRR28040808_2.fastq trimmed: SRR28040808-trimmed-pair1.fastq, SRR28040808-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:52:41 2024 >> started Fri Dec 6 13:52:56 2024 >> done (15.549s) 15542472 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 15542472 (100.00%) read pairs available; of these: 3132624 (20.16%) trimmed read pairs available after processing 12409848 (79.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 46 1 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 1 0.00% 51 12 0.00% 52 48 0.00% 53 117 0.00% 54 227 0.00% 55 380 0.00% 56 579 0.00% 57 846 0.01% 58 1035 0.01% 59 1327 0.01% 60 1680 0.01% 61 1979 0.01% 62 2334 0.02% 63 2759 0.02% 64 3063 0.02% 65 3443 0.02% 66 3921 0.03% 67 4288 0.03% 68 4726 0.03% 69 5361 0.03% 70 6189 0.04% 71 6764 0.04% 72 7705 0.05% 73 8930 0.06% 74 10220 0.07% 75 15562 0.10% 76 25796 0.17% 77 31629 0.20% 78 34521 0.22% 79 37639 0.24% 80 40801 0.26% 81 43203 0.28% 82 45876 0.30% 83 48628 0.31% 84 51490 0.33% 85 54841 0.35% 86 57732 0.37% 87 61752 0.40% 88 51045 0.33% 89 62636 0.40% 90 71075 0.46% 91 149627 0.96% 92 168210 1.08% 93 186887 1.20% 94 209078 1.35% 95 231474 1.49% 96 260371 1.68% 97 309006 1.99% 98 378456 2.43% 99 427354 2.75% 100 12409848 79.84% 15542472 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=17 prefix-density=0.37 prefix-fanout=2.5 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCAT criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=191.54 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=22.6 sequence=GCCGCCGCCGCC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=20 prefix-density=0.39 prefix-fanout=2.6 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCAT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=196.93 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=21.7 sequence=CCGCCGCCGCCA SRR28040808 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:53:28 Started mapping on | Dec 06 13:53:28 Finished on | Dec 06 13:54:22 Mapping speed, Million of reads per hour | 1036.16 Number of input reads | 15542472 Average input read length | 197 UNIQUE READS: Uniquely mapped reads number | 15125296 Uniquely mapped reads % | 97.32% Average mapped length | 196.11 Number of splices: Total | 9586616 Number of splices: Annotated (sjdb) | 9061139 Number of splices: GT/AG | 9457059 Number of splices: GC/AG | 110723 Number of splices: AT/AC | 4128 Number of splices: Non-canonical | 14706 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190020 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 18263 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.77% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 227178 227178 227178 N_multimapping 190020 190020 190020 N_noFeature 418750 7561624 7684211 N_ambiguous 356496 30296 29556 UnstrandedReadsAssigned:14350050 PositiveStrandReadsAssigned:7533376 NegativeStrandReadsAssigned:7411529 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040808 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040808-trimmed-pair1.fastq SRR28040808-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,542,472 reads, 14,787,396 reads pseudoaligned [quant] estimated average fragment length: 169.678 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52973 SRR28040808.ke.tsv 35125 SRR28040808.se.tsv 88098 total ==> SRR28040808.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 767.501 21.5382 2.21962 PNS24247 1044 875.322 8.1183 0.733578 PNS24249 1928 1759.32 102.749 4.61938 PNS24246 1044 875.322 8.1183 0.733578 PNS24248 1044 875.322 8.1183 0.733578 PNS24244 1471 1302.32 12.3575 0.750515 PNS24243 293 138.398 4 2.28601 KQK14069 1603 1434.32 5885.99 324.58 KQK14071 474 308.079 665.323 170.812 ==> SRR28040808.se.tsv <== BRADI_1g14170v3 7020 BRADI_1g53295v3 5 BRADI_1g59795v3 605 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 871 BRADI_1g74790v3 324 BRADI_1g09890v3 8 BRADI_1g77505v3 538 BRADI_1g48960v3 0 SRR28040808 completed mapping pipeline successfully