Starting /dee2/code/volunteer_pipeline.sh SRR28040809 current disk space = 1550800314368 free memory = 1593537080 SRR28040809 SRAfilesize d84630498baccdc60b8245941e8d93b6 SRR28040809.sra SRR28040809.sra file validated SRR28040809 is paired end SRR28040809 is conventional basespace SRR28040809 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040809_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.24975 33.0 31.0 34.0 31.0 34.0 2 32.59475 34.0 31.0 34.0 31.0 34.0 3 32.727 34.0 31.0 34.0 31.0 34.0 4 36.2395 37.0 35.0 37.0 35.0 37.0 5 36.03175 37.0 35.0 37.0 35.0 37.0 6 35.9035 37.0 35.0 37.0 35.0 37.0 7 35.92175 37.0 35.0 37.0 35.0 37.0 8 35.90275 37.0 35.0 37.0 35.0 37.0 9 37.6015 39.0 37.0 39.0 35.0 39.0 10-11 37.68175 39.0 37.0 39.0 35.0 39.0 12-13 37.45075 39.0 37.0 39.0 34.5 39.0 14-15 38.790875 40.0 38.0 41.0 35.0 41.0 16-17 38.89075 40.0 38.0 41.0 35.5 41.0 18-19 38.767125 40.0 38.0 41.0 35.0 41.0 20-21 38.742375 40.0 38.0 41.0 35.0 41.0 22-23 38.5925 40.0 38.0 41.0 34.0 41.0 24-25 38.443875000000006 40.0 38.0 41.0 33.5 41.0 26-27 38.265375000000006 40.0 38.0 41.0 33.5 41.0 28-29 38.0145 40.0 37.5 41.0 33.0 41.0 30-31 37.890625 40.0 37.5 41.0 33.0 41.0 32-33 37.61225 39.5 36.5 41.0 32.5 41.0 34-35 37.32 39.0 36.0 41.0 31.0 41.0 36-37 37.077 39.0 35.5 40.0 31.0 41.0 38-39 37.463125 39.0 36.0 41.0 32.0 41.0 40-41 37.461625 39.0 35.5 41.0 32.0 41.0 42-43 37.23075 39.0 35.0 41.0 31.5 41.0 44-45 36.921875 39.0 35.0 40.0 31.0 41.0 46-47 36.607875 38.0 35.0 40.0 30.5 41.0 48-49 36.54775 38.0 35.0 40.0 30.5 41.0 50-51 36.247375 38.0 34.0 40.0 30.5 41.0 52-53 36.072874999999996 37.5 34.0 40.0 30.0 41.0 54-55 35.743375 37.0 34.0 40.0 29.0 41.0 56-57 35.365625 36.5 34.0 40.0 29.0 41.0 58-59 35.0405 36.0 33.0 39.5 28.5 41.0 60-61 34.886125 35.0 33.0 39.0 28.0 41.0 62-63 34.736125 35.0 33.0 39.0 27.5 41.0 64-65 34.350625 35.0 33.0 39.0 27.5 40.0 66-67 33.845375000000004 35.0 33.0 38.0 27.0 40.0 68-69 33.53525 35.0 33.0 37.0 26.0 39.5 70-71 33.296875 35.0 32.5 36.5 26.0 39.0 72-73 32.832 35.0 32.0 36.0 25.5 39.0 74-75 32.46725 35.0 32.0 35.5 25.0 38.0 76-77 31.45175 33.5 30.0 35.0 24.5 37.0 78-79 32.373625000000004 34.5 32.0 35.0 26.0 37.0 80-81 32.25025 35.0 32.0 35.0 26.0 36.5 82-83 31.960500000000003 35.0 32.0 35.0 25.0 36.0 84-85 31.737625 34.5 32.0 35.0 25.0 36.0 86-87 31.558374999999998 34.0 32.0 35.0 24.5 35.5 88-89 31.261125 34.0 32.0 35.0 24.0 35.0 90-91 31.144125000000003 34.0 31.0 35.0 24.0 35.0 92-93 30.659 34.0 31.0 35.0 22.5 35.0 94-95 30.471625 34.0 31.0 35.0 21.5 35.0 96-97 30.11275 34.0 30.5 35.0 18.0 35.0 98-99 29.62 34.0 30.0 35.0 7.5 35.0 100 29.153 34.0 30.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 -0.21340852130325771 1101 2 -0.013283208020055781 1101 3 -0.050250626566416656 1101 4 0.0026315789473656537 1101 5 0.32318295739348457 1101 6 0.154135338345867 1101 7 -0.017042606516291414 1101 8 0.10501253132832034 1101 9 -0.044235588972426854 1101 10-11 0.010213032581454229 1101 12-13 -0.008771929824561653 1101 14-15 -0.43007518796991917 1101 16-17 -0.2750626566416017 1101 18-19 -0.3569548872180519 1101 20-21 -0.119360902255643 1101 22-23 -0.2727443609022515 1101 24-25 0.0298245614035082 1101 26-27 0.08991228070175339 1101 28-29 -0.35313283208019897 1101 30-31 -0.39010025062656695 1101 32-33 -0.20388471177944467 1101 34-35 -0.21196741854637224 1101 36-37 -0.45601503759398554 1101 38-39 -0.27644110275689115 1101 40-41 -0.12205513784461175 1101 42-43 -0.3581453634085179 1101 44-45 -0.2193609022556373 1101 46-47 -0.24241854636591853 1101 48-49 0.01647869674184932 1101 50-51 -0.02280701754386172 1101 52-53 -0.06848370927318115 1101 54-55 -0.20469924812029916 1101 56-57 -0.10419799498747295 1101 58-59 0.022869674185464817 1101 60-61 -0.08615288220551065 1101 62-63 -0.1192982456140328 1101 64-65 -0.2317042606516253 1101 66-67 -0.05319548872180491 1101 68-69 -0.16365914786967295 1101 70-71 -0.23596491228070704 1101 72-73 -0.0295739348370887 1101 74-75 -0.28790726817042867 1101 76-77 -0.03157894736841982 1101 78-79 0.006077694235589348 1101 80-81 0.12443609022556501 1101 82-83 0.03020050125313034 1101 84-85 -0.053884711779449646 1101 86-87 -0.21691729323308095 1101 88-89 -0.1246240601503743 1101 90-91 -0.2373433583959894 1101 92-93 -0.4632832080200515 1101 94-95 -0.6334586466165426 1101 96-97 -0.29166666666666785 1101 98-99 -0.5901629072681693 1101 100 -0.8471177944862163 1105 1 0.21340852130325771 1105 2 0.013283208020048676 1105 3 0.050250626566416656 1105 4 -0.002631578947372759 1105 5 -0.32318295739348457 1105 6 -0.1541353383458599 1105 7 0.017042606516291414 1105 8 -0.10501253132832034 1105 9 0.04423558897243396 1105 10-11 -0.010213032581454229 1105 12-13 0.008771929824554547 1105 14-15 0.4300751879699263 1105 16-17 0.2750626566416017 1105 18-19 0.3569548872180448 1105 20-21 0.119360902255643 1105 22-23 0.2727443609022586 1105 24-25 -0.0298245614035082 1105 26-27 -0.08991228070175339 1105 28-29 0.35313283208019897 1105 30-31 0.39010025062656695 1105 32-33 0.20388471177945178 1105 34-35 0.21196741854636514 1105 36-37 0.45601503759398554 1105 38-39 0.27644110275689115 1105 40-41 0.12205513784461175 1105 42-43 0.358145363408525 1105 44-45 0.21936090225564442 1105 46-47 0.24241854636591853 1105 48-49 -0.016478696741856425 1105 50-51 0.022807017543854613 1105 52-53 0.06848370927318115 1105 54-55 0.20469924812029916 1105 56-57 0.10419799498747295 1105 58-59 -0.022869674185464817 1105 60-61 0.08615288220551065 1105 62-63 0.1192982456140399 1105 64-65 0.2317042606516253 1105 66-67 0.05319548872180491 1105 68-69 0.16365914786968006 1105 70-71 0.23596491228070704 1105 72-73 0.029573934837095806 1105 74-75 0.28790726817042156 1105 76-77 0.03157894736841982 1105 78-79 -0.006077694235589348 1105 80-81 -0.12443609022556146 1105 82-83 -0.030200501253133893 1105 84-85 0.053884711779449646 1105 86-87 0.21691729323308095 1105 88-89 0.12462406015037786 1105 90-91 0.2373433583959894 1105 92-93 0.4632832080200515 1105 94-95 0.6334586466165426 1105 96-97 0.2916666666666643 1105 98-99 0.5901629072681693 1105 100 0.8471177944862163 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 8.0 17 6.0 18 10.0 19 11.0 20 10.0 21 18.0 22 16.0 23 24.0 24 24.0 25 32.0 26 39.0 27 64.0 28 69.0 29 85.0 30 110.0 31 123.0 32 165.0 33 232.0 34 316.0 35 480.0 36 667.0 37 840.0 38 579.0 39 70.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.832329317269078 11.947791164658634 11.847389558232932 49.372489959839356 2 25.1 15.9 29.375 29.625 3 26.424999999999997 17.974999999999998 21.925 33.675 4 31.075000000000003 21.25 16.775000000000002 30.9 5 32.975 24.5 20.349999999999998 22.175 6 27.875 28.725 18.475 24.925 7 23.974999999999998 18.525 34.575 22.925 8 23.724999999999998 22.025 26.35 27.900000000000002 9 23.78094523630908 20.505126281570394 29.75743935983996 25.95648912228057 10-11 27.325 26.55 21.05 25.074999999999996 12-13 25.45 21.8125 26.1 26.637499999999996 14-15 25.337500000000002 24.5625 23.875 26.224999999999998 16-17 26.424999999999997 23.1375 24.0 26.437500000000004 18-19 26.387500000000003 23.2625 23.925 26.424999999999997 20-21 24.725 24.1625 22.975 28.1375 22-23 25.837500000000002 23.0 23.35 27.8125 24-25 25.7125 23.325000000000003 24.275 26.687499999999996 26-27 26.424999999999997 23.0375 23.3875 27.150000000000002 28-29 26.450000000000003 22.875 23.35 27.325 30-31 25.6125 23.200000000000003 23.775 27.4125 32-33 26.200000000000003 23.3 23.45 27.05 34-35 27.1375 23.3125 23.025000000000002 26.525 36-37 26.387500000000003 23.200000000000003 23.8375 26.575 38-39 26.487500000000004 23.0875 23.25 27.175 40-41 26.8625 23.4125 22.9875 26.737499999999997 42-43 25.912499999999998 24.5375 22.912499999999998 26.637499999999996 44-45 26.775 22.9375 24.4375 25.85 46-47 25.8 23.45 23.5125 27.237499999999997 48-49 26.950000000000003 22.912499999999998 23.599999999999998 26.5375 50-51 26.400000000000002 24.2 22.9875 26.4125 52-53 27.3 22.5625 23.0375 27.1 54-55 26.0125 23.3375 23.375 27.275 56-57 26.375 23.5625 23.2875 26.775 58-59 27.5625 22.875 22.900000000000002 26.6625 60-61 26.3125 24.025 22.650000000000002 27.0125 62-63 27.375 23.3 22.7 26.625 64-65 27.762500000000003 23.4875 22.2625 26.487500000000004 66-67 26.5625 23.2875 22.6875 27.462500000000002 68-69 26.9125 22.4625 23.425 27.200000000000003 70-71 27.537499999999998 22.7625 22.112499999999997 27.5875 72-73 26.5625 23.3 22.9875 27.150000000000002 74-75 27.5125 23.1125 22.725 26.650000000000002 76-77 26.674999999999997 23.474999999999998 23.1375 26.7125 78-79 27.675 23.3 22.25 26.775 80-81 27.575 22.95 22.6875 26.787499999999998 82-83 27.3625 22.925 22.900000000000002 26.8125 84-85 26.700000000000003 22.225 23.7125 27.3625 86-87 26.775 22.787499999999998 23.6375 26.8 88-89 27.3 23.025000000000002 22.675 27.0 90-91 27.3625 23.4125 23.025000000000002 26.200000000000003 92-93 27.05 22.85 23.45 26.650000000000002 94-95 27.474999999999998 22.5125 22.537499999999998 27.474999999999998 96-97 27.650000000000002 23.1875 22.0125 27.150000000000002 98-99 27.375 23.7 22.037499999999998 26.887499999999996 100 27.500000000000004 22.650000000000002 22.725 27.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 1.5 29 2.0 30 3.5 31 6.0 32 8.0 33 10.0 34 15.0 35 21.5 36 28.5 37 37.5 38 42.5 39 54.0 40 79.0 41 90.0 42 109.5 43 137.0 44 146.0 45 152.0 46 152.5 47 152.5 48 152.0 49 148.5 50 140.0 51 140.0 52 136.0 53 110.0 54 109.0 55 111.0 56 103.5 57 112.5 58 103.5 59 89.5 60 85.5 61 84.0 62 84.5 63 88.5 64 92.0 65 92.0 66 95.0 67 91.5 68 89.0 69 85.0 70 81.0 71 69.5 72 52.5 73 53.0 74 46.5 75 34.5 76 24.0 77 12.0 78 10.5 79 7.0 80 3.0 81 4.0 82 4.5 83 3.5 84 1.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR28040809 read2 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28040809_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.96125 33.0 31.0 34.0 30.0 34.0 2 32.266 34.0 31.0 34.0 30.0 34.0 3 32.45725 34.0 31.0 34.0 31.0 34.0 4 35.9925 37.0 35.0 37.0 35.0 37.0 5 35.8725 37.0 35.0 37.0 35.0 37.0 6 35.88775 37.0 35.0 37.0 35.0 37.0 7 35.76675 37.0 35.0 37.0 35.0 37.0 8 35.88125 37.0 35.0 37.0 35.0 37.0 9 37.5885 39.0 37.0 39.0 35.0 39.0 10-11 37.636875 39.0 37.5 39.0 35.0 39.0 12-13 37.610375 39.0 37.0 39.0 35.0 39.0 14-15 38.996125000000006 40.0 38.0 41.0 36.0 41.0 16-17 38.978875 40.0 38.0 41.0 35.5 41.0 18-19 38.952875 40.0 38.0 41.0 35.0 41.0 20-21 38.68962500000001 40.0 38.0 41.0 34.5 41.0 22-23 38.517125 40.0 38.0 41.0 34.0 41.0 24-25 38.513374999999996 40.0 38.0 41.0 34.0 41.0 26-27 38.3155 40.0 38.0 41.0 33.0 41.0 28-29 38.054 40.0 37.5 41.0 33.0 41.0 30-31 37.91875 40.0 37.0 41.0 33.0 41.0 32-33 37.79775 40.0 37.0 41.0 33.0 41.0 34-35 37.567125000000004 39.5 36.5 41.0 32.0 41.0 36-37 37.283500000000004 39.0 36.0 40.5 31.0 41.0 38-39 37.03 39.0 35.0 40.0 31.0 41.0 40-41 36.741875 38.0 35.0 40.0 30.5 41.0 42-43 36.3555 38.0 35.0 40.0 30.0 41.0 44-45 36.38075 38.0 35.0 40.0 30.0 41.0 46-47 36.17975 38.0 34.5 40.0 30.0 41.0 48-49 36.020375 38.0 34.0 40.0 29.5 41.0 50-51 35.075874999999996 37.0 33.0 39.5 27.5 40.5 52-53 35.058625 37.0 33.0 39.5 27.5 40.0 54-55 35.474375 37.0 33.5 40.0 28.5 41.0 56-57 35.179625 36.0 33.0 40.0 28.5 41.0 58-59 34.81875 35.5 33.0 39.0 27.5 41.0 60-61 35.039375 36.0 33.5 39.0 27.5 41.0 62-63 35.066375 35.0 33.5 39.0 29.0 41.0 64-65 34.552625 35.0 33.0 39.0 28.0 41.0 66-67 34.26375 35.0 33.0 38.5 28.0 40.5 68-69 33.915499999999994 35.0 33.0 37.5 27.0 40.0 70-71 33.682 35.0 33.0 37.0 27.5 39.0 72-73 33.261875 35.0 33.0 36.5 26.0 39.0 74-75 32.9525 35.0 32.5 36.0 26.0 38.5 76-77 32.4785 35.0 32.0 35.0 26.0 37.0 78-79 32.206999999999994 35.0 32.0 35.0 25.5 37.0 80-81 31.779 34.0 31.0 35.0 24.5 36.5 82-83 31.479750000000003 34.0 31.0 35.0 24.0 36.0 84-85 31.043625 34.0 31.0 35.0 23.0 35.5 86-87 30.783875000000002 34.0 31.0 35.0 22.0 35.0 88-89 30.62375 34.0 31.0 35.0 20.0 35.0 90-91 30.289125 34.0 30.0 35.0 20.0 35.0 92-93 29.82975 34.0 30.0 35.0 18.0 35.0 94-95 29.396250000000002 34.0 29.0 35.0 12.5 35.0 96-97 28.939375 34.0 29.0 35.0 2.0 35.0 98-99 28.169874999999998 33.5 28.0 35.0 2.0 35.0 100 27.49075 33.0 27.0 35.0 2.0 35.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.09285714285714164 1101 2 0.021177944862152742 1101 3 0.04649122807017392 1101 4 -0.28759398496240607 1101 5 0.14686716791980103 1101 6 0.05125313283208044 1101 7 0.17030075187970084 1101 8 0.2557644110275703 1101 9 0.040100250626565526 1101 10-11 -0.09160401002506546 1101 12-13 0.18045112781954487 1101 14-15 0.08533834586466327 1101 16-17 0.15150375939849425 1101 18-19 -0.026190476190471657 1101 20-21 0.17694235588972163 1101 22-23 0.05607769423559006 1101 24-25 0.10614035087719031 1101 26-27 0.2021929824561397 1101 28-29 0.13220551378446288 1101 30-31 -0.11716791979949903 1101 32-33 0.03289473684210975 1101 34-35 0.13853383458646817 1101 36-37 -0.04718045112782221 1101 38-39 -0.041416040100251905 1101 40-41 -0.10332080200500826 1101 42-43 0.10952380952380736 1101 44-45 0.19260651629073067 1101 46-47 -0.011090225563911815 1101 48-49 0.28283208020049955 1101 50-51 -0.0714912280701725 1101 52-53 0.0895989974937379 1101 54-55 0.24047619047618696 1101 56-57 -0.3271929824561397 1101 58-59 -0.21892230576440852 1101 60-61 0.10426065162907605 1101 62-63 -0.04924812030075287 1101 64-65 -0.03195488721804196 1101 66-67 0.12055137844612318 1101 68-69 -0.09129072681704287 1101 70-71 0.014285714285719564 1101 72-73 0.21729323308270665 1101 74-75 -0.2447368421052616 1101 76-77 -0.46829573934837043 1101 78-79 -0.2583959899749395 1101 80-81 -0.38107769423558935 1101 82-83 -0.08421052631579329 1101 84-85 -0.28865914786967295 1101 86-87 -0.3510025062656652 1101 88-89 -0.3728070175438596 1101 90-91 -0.5480576441102762 1101 92-93 -0.9320175438596472 1101 94-95 -0.7660401002506241 1101 96-97 -0.6872807017543856 1101 98-99 -0.8222431077694239 1101 100 -0.5506265664160388 1105 1 -0.09285714285714164 1105 2 -0.021177944862159848 1105 3 -0.04649122807017392 1105 4 0.28759398496240607 1105 5 -0.14686716791979393 1105 6 -0.05125313283208044 1105 7 -0.17030075187970084 1105 8 -0.2557644110275703 1105 9 -0.040100250626565526 1105 10-11 0.09160401002505836 1105 12-13 -0.18045112781955197 1105 14-15 -0.08533834586465616 1105 16-17 -0.15150375939849425 1105 18-19 0.026190476190471657 1105 20-21 -0.17694235588972163 1105 22-23 -0.05607769423559006 1105 24-25 -0.10614035087719031 1105 26-27 -0.2021929824561397 1105 28-29 -0.13220551378445577 1105 30-31 0.11716791979949903 1105 32-33 -0.032894736842102645 1105 34-35 -0.13853383458646107 1105 36-37 0.04718045112782221 1105 38-39 0.041416040100251905 1105 40-41 0.10332080200501537 1105 42-43 -0.10952380952381446 1105 44-45 -0.19260651629072356 1105 46-47 0.01109022556390471 1105 48-49 -0.28283208020049955 1105 50-51 0.0714912280701796 1105 52-53 -0.0895989974937379 1105 54-55 -0.24047619047619406 1105 56-57 0.3271929824561397 1105 58-59 0.21892230576441563 1105 60-61 -0.10426065162907605 1105 62-63 0.04924812030075287 1105 64-65 0.03195488721804196 1105 66-67 -0.12055137844611608 1105 68-69 0.09129072681704287 1105 70-71 -0.014285714285712459 1105 72-73 -0.21729323308270665 1105 74-75 0.2447368421052687 1105 76-77 0.46829573934837043 1105 78-79 0.25839598997493596 1105 80-81 0.38107769423558935 1105 82-83 0.08421052631578974 1105 84-85 0.28865914786967295 1105 86-87 0.35100250626566165 1105 88-89 0.3728070175438596 1105 90-91 0.5480576441102762 1105 92-93 0.9320175438596472 1105 94-95 0.7660401002506241 1105 96-97 0.6872807017543856 1105 98-99 0.8222431077694239 1105 100 0.5506265664160388 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 4.0 17 7.0 18 12.0 19 13.0 20 16.0 21 24.0 22 33.0 23 28.0 24 38.0 25 31.0 26 51.0 27 50.0 28 69.0 29 79.0 30 106.0 31 124.0 32 204.0 33 219.0 34 350.0 35 472.0 36 676.0 37 746.0 38 586.0 39 59.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.404809619238478 11.022044088176353 12.900801603206414 48.672344689378754 2 23.575 15.950000000000001 28.425 32.05 3 25.85646411602901 17.254313578394598 22.655663915978995 34.2335583895974 4 30.425 20.150000000000002 18.325 31.1 5 32.5 23.875 20.375 23.25 6 26.463231615807903 28.61430715357679 20.185092546273136 24.73736868434217 7 23.525 18.775 34.825 22.875 8 24.6 21.3 26.025 28.075 9 23.775 19.35 29.25 27.625 10-11 27.3375 27.212500000000002 21.175 24.275 12-13 24.5 22.25 25.575 27.675 14-15 25.6125 24.3875 22.8125 27.187499999999996 16-17 27.250000000000004 22.662499999999998 23.6375 26.450000000000003 18-19 26.087500000000002 23.9875 23.4125 26.5125 20-21 26.75 23.7 22.95 26.6 22-23 26.625 23.3875 23.0375 26.950000000000003 24-25 26.5 22.8 23.425 27.275 26-27 26.6 22.675 23.400000000000002 27.325 28-29 26.400000000000002 22.725 23.225 27.650000000000002 30-31 25.825 23.200000000000003 23.35 27.625 32-33 25.9625 22.8625 23.724999999999998 27.450000000000003 34-35 25.6 23.5125 23.6875 27.200000000000003 36-37 27.6 22.525000000000002 23.7 26.174999999999997 38-39 26.5875 22.975 23.0375 27.400000000000002 40-41 26.9125 22.95 22.8625 27.275 42-43 26.637499999999996 22.6875 23.65 27.025 44-45 26.174999999999997 23.625 23.05 27.150000000000002 46-47 26.437500000000004 23.3625 22.125 28.075 48-49 25.95 23.175 23.150000000000002 27.725 50-51 27.2625 22.5125 23.0625 27.1625 52-53 26.5625 23.599999999999998 22.650000000000002 27.187499999999996 54-55 26.987499999999997 22.6875 23.849999999999998 26.474999999999998 56-57 26.25 23.1875 23.1 27.462500000000002 58-59 26.974999999999998 22.475 23.1625 27.3875 60-61 26.950000000000003 23.7375 22.650000000000002 26.6625 62-63 26.9125 23.1375 22.3625 27.5875 64-65 26.950000000000003 22.9625 23.05 27.037499999999998 66-67 27.8625 22.0875 23.5 26.55 68-69 26.2875 23.4125 23.5875 26.7125 70-71 26.724999999999998 23.2375 22.625 27.4125 72-73 26.987499999999997 22.6125 23.075000000000003 27.325 74-75 26.775 23.5375 23.0625 26.625 76-77 26.7125 21.7375 23.775 27.775 78-79 27.237499999999997 23.4375 22.3875 26.937499999999996 80-81 26.825 23.4375 22.675 27.0625 82-83 27.3125 23.5625 21.525 27.6 84-85 26.400000000000002 23.525 22.412499999999998 27.6625 86-87 27.075 23.2125 22.5875 27.125 88-89 26.825 23.125 23.2625 26.787499999999998 90-91 26.974999999999998 22.5875 23.200000000000003 27.237499999999997 92-93 27.3125 24.05 22.275 26.3625 94-95 27.575 23.3 22.912499999999998 26.2125 96-97 26.924999999999997 23.325000000000003 22.95 26.8 98-99 27.064564564564563 23.636136136136134 22.94794794794795 26.351351351351347 100 28.482120530132534 23.15578894723681 22.50562640660165 25.85646411602901 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 1.5 30 3.5 31 4.5 32 8.0 33 8.5 34 10.5 35 19.5 36 27.0 37 34.0 38 43.0 39 65.0 40 88.0 41 100.5 42 107.0 43 122.5 44 138.5 45 151.0 46 153.5 47 147.5 48 146.0 49 150.0 50 153.5 51 135.5 52 127.0 53 125.5 54 119.0 55 114.5 56 97.5 57 80.0 58 90.5 59 100.0 60 97.0 61 93.0 62 89.5 63 77.5 64 81.0 65 94.0 66 97.0 67 100.0 68 95.0 69 83.5 70 76.0 71 63.0 72 51.0 73 51.5 74 39.5 75 34.5 76 31.5 77 19.5 78 12.0 79 10.5 80 10.0 81 7.0 82 3.0 83 4.0 84 3.5 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.025 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.1 100 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669946 spots for SRR28040809.sra Written 669946 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra Read 669935 spots for SRR28040809.sra Written 669935 spots for SRR28040809.sra SRR ids: ['SRR28040809.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mmeklj6z SRR28040809.sra spots: 13398711 blocks: [[1, 669935], [669936, 1339870], [1339871, 2009805], [2009806, 2679740], [2679741, 3349675], [3349676, 4019610], [4019611, 4689545], [4689546, 5359480], [5359481, 6029415], [6029416, 6699350], [6699351, 7369285], [7369286, 8039220], [8039221, 8709155], [8709156, 9379090], [9379091, 10049025], [10049026, 10718960], [10718961, 11388895], [11388896, 12058830], [12058831, 12728765], [12728766, 13398711]] SRR28040809 file size 3489289 SRR28040809 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28040809 SRR28040809_1.fastq SRR28040809_2.fastq Input file: SRR28040809_1.fastq Paired file: SRR28040809_2.fastq trimmed: SRR28040809-trimmed-pair1.fastq, SRR28040809-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:51:41 2024 >> started Fri Dec 6 13:51:59 2024 >> done (18.614s) 13398711 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 13398711 (100.00%) read pairs available; of these: 2859466 (21.34%) trimmed read pairs available after processing 10539245 (78.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 51 11 0.00% 52 25 0.00% 53 74 0.00% 54 160 0.00% 55 326 0.00% 56 471 0.00% 57 634 0.00% 58 931 0.01% 59 1114 0.01% 60 1433 0.01% 61 1707 0.01% 62 2168 0.02% 63 2485 0.02% 64 2906 0.02% 65 3279 0.02% 66 3665 0.03% 67 4211 0.03% 68 4750 0.04% 69 5245 0.04% 70 6181 0.05% 71 6810 0.05% 72 7694 0.06% 73 8842 0.07% 74 10448 0.08% 75 14828 0.11% 76 22533 0.17% 77 27449 0.20% 78 31084 0.23% 79 33101 0.25% 80 35291 0.26% 81 38723 0.29% 82 41938 0.31% 83 45147 0.34% 84 47644 0.36% 85 51858 0.39% 86 55507 0.41% 87 59016 0.44% 88 56809 0.42% 89 67261 0.50% 90 75601 0.56% 91 106987 0.80% 92 120456 0.90% 93 138164 1.03% 94 159488 1.19% 95 188849 1.41% 96 227922 1.70% 97 288849 2.16% 98 385437 2.88% 99 463954 3.46% 100 10539245 78.66% 13398711 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=35 prefix-density=0.25 prefix-fanout=2.0 sequence=GGCTCAAACTGCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=302.19 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=19.7 sequence=CGCCGCCGCCACC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.0 sequence=GGCTCAAACTGCAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=326.13 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=22.4 sequence=CCGCCGCCGCCTCC SRR28040809 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:52:47 Started mapping on | Dec 06 13:52:49 Finished on | Dec 06 13:53:49 Mapping speed, Million of reads per hour | 803.92 Number of input reads | 13398711 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 12703107 Uniquely mapped reads % | 94.81% Average mapped length | 195.88 Number of splices: Total | 7972587 Number of splices: Annotated (sjdb) | 7575916 Number of splices: GT/AG | 7844361 Number of splices: GC/AG | 112836 Number of splices: AT/AC | 5966 Number of splices: Non-canonical | 9424 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.49 Insertion rate per base | 0.01% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 166308 % of reads mapped to multiple loci | 1.24% Number of reads mapped to too many loci | 23962 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 1.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 529335 529335 529335 N_multimapping 166308 166308 166308 N_noFeature 287064 6325016 6466608 N_ambiguous 219965 11950 11582 UnstrandedReadsAssigned:12196078 PositiveStrandReadsAssigned:6366141 NegativeStrandReadsAssigned:6224917 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR28040809 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR28040809-trimmed-pair1.fastq SRR28040809-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,398,711 reads, 12,634,055 reads pseudoaligned [quant] estimated average fragment length: 177.039 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,043 rounds 52973 SRR28040809.ke.tsv 35125 SRR28040809.se.tsv 88098 total ==> SRR28040809.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.146 89.2846 13.0628 PNS24247 1044 867.961 30.7378 3.93849 PNS24249 1928 1751.96 185.278 11.7614 PNS24246 1044 867.961 30.7378 3.93849 PNS24248 1044 867.961 30.7378 3.93849 PNS24244 1471 1294.96 28.2238 2.42391 PNS24243 293 127.984 8 6.95174 KQK14069 1603 1426.96 6239.48 486.289 KQK14071 474 300.103 1669.3 618.619 ==> SRR28040809.se.tsv <== BRADI_1g14170v3 8357 BRADI_1g53295v3 28 BRADI_1g59795v3 191 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 737 BRADI_1g74790v3 61 BRADI_1g09890v3 0 BRADI_1g77505v3 128 BRADI_1g48960v3 0 SRR28040809 completed mapping pipeline successfully