Starting /dee2/code/volunteer_pipeline.sh SRR28716039 current disk space = 1543014510592 free memory = 1596793404 SRR28716039 SRAfilesize 280702eb182a1ee1d96353684c8e809b SRR28716039.sra SRR28716039.sra file validated SRR28716039 is single end SRR28716039 is conventional basespace SRR28716039 read1 length is 120 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28716039_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 120 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6385 38.0 38.0 38.0 32.0 38.0 2 36.708 38.0 38.0 38.0 32.0 38.0 3 36.94075 38.0 38.0 38.0 32.0 38.0 4 36.64075 38.0 38.0 38.0 32.0 38.0 5 36.7645 38.0 38.0 38.0 32.0 38.0 6 38.87825 40.0 38.0 40.0 38.0 40.0 7 38.78025 40.0 38.0 40.0 38.0 40.0 8 38.8265 40.0 38.0 40.0 38.0 40.0 9 38.87775 40.0 38.0 40.0 38.0 40.0 10-11 38.765 40.0 38.0 40.0 38.0 40.0 12-13 38.8275 40.0 38.0 40.0 38.0 40.0 14-15 38.62712500000001 40.0 38.0 40.0 38.0 40.0 16-17 38.631875 40.0 38.0 40.0 38.0 40.0 18-19 38.75087499999999 40.0 38.0 40.0 38.0 40.0 20-21 38.69225 40.0 38.0 40.0 38.0 40.0 22-23 38.68 40.0 38.0 40.0 38.0 40.0 24-25 38.524 40.0 38.0 40.0 38.0 40.0 26-27 38.545875 40.0 38.0 40.0 38.0 40.0 28-29 38.4925 40.0 38.0 40.0 38.0 40.0 30-31 38.46 40.0 38.0 40.0 38.0 40.0 32-33 38.513875 40.0 38.0 40.0 38.0 40.0 34-35 38.5235 40.0 38.0 40.0 38.0 40.0 36-37 38.542 40.0 38.0 40.0 38.0 40.0 38-39 38.477625 40.0 38.0 40.0 38.0 40.0 40-41 38.47325 40.0 38.0 40.0 38.0 40.0 42-43 38.391875 40.0 38.0 40.0 38.0 40.0 44-45 38.352375 40.0 38.0 40.0 38.0 40.0 46-47 38.346625 40.0 38.0 40.0 38.0 40.0 48-49 38.114000000000004 40.0 38.0 40.0 38.0 40.0 50-51 38.05775 40.0 38.0 40.0 38.0 40.0 52-53 38.066500000000005 40.0 38.0 40.0 38.0 40.0 54-55 38.158249999999995 40.0 38.0 40.0 38.0 40.0 56-57 38.198499999999996 40.0 38.0 40.0 38.0 40.0 58-59 38.140875 40.0 38.0 40.0 38.0 40.0 60-61 37.585499999999996 40.0 38.0 40.0 32.0 40.0 62-63 37.974875 40.0 38.0 40.0 35.0 40.0 64-65 37.98725 40.0 38.0 40.0 38.0 40.0 66-67 37.955875 40.0 38.0 40.0 38.0 40.0 68-69 38.039500000000004 40.0 38.0 40.0 38.0 40.0 70-71 37.83225 40.0 38.0 40.0 38.0 40.0 72-73 37.697500000000005 39.0 38.0 40.0 35.0 40.0 74-75 37.352125 39.0 38.0 40.0 32.0 40.0 76-77 36.813625 39.0 38.0 40.0 32.0 40.0 78-79 36.973125 38.0 38.0 40.0 32.0 40.0 80-81 37.179 38.0 38.0 40.0 32.0 40.0 82-83 37.17075 38.0 38.0 40.0 32.0 40.0 84-85 37.144 38.0 38.0 40.0 32.0 40.0 86-87 36.996 38.0 38.0 40.0 32.0 40.0 88-89 36.871125 38.0 38.0 40.0 32.0 40.0 90-91 36.975125000000006 38.0 38.0 40.0 32.0 40.0 92-93 36.89025 38.0 38.0 40.0 32.0 40.0 94-95 36.914875 38.0 38.0 40.0 32.0 40.0 96-97 36.678124999999994 38.0 38.0 40.0 32.0 40.0 98-99 36.541125 38.0 38.0 40.0 32.0 40.0 100-101 36.530375 38.0 38.0 40.0 32.0 40.0 102-103 35.140625 38.0 35.0 38.0 29.5 38.0 104-105 36.815 38.0 38.0 40.0 32.0 40.0 106-107 37.267125 39.0 38.0 40.0 32.0 40.0 108-109 37.217 40.0 38.0 40.0 32.0 40.0 110-111 37.293375 40.0 38.0 40.0 32.0 40.0 112-113 37.131375000000006 40.0 38.0 40.0 32.0 40.0 114-115 36.601875 38.0 38.0 40.0 32.0 40.0 116-117 36.93925 38.0 38.0 40.0 32.0 40.0 118-119 36.695 38.0 38.0 40.0 32.0 40.0 120 33.57575 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 2.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 4.0 19 5.0 20 6.0 21 7.0 22 9.0 23 11.0 24 34.0 25 4.0 26 10.0 27 7.0 28 34.0 29 37.0 30 39.0 31 49.0 32 73.0 33 77.0 34 114.0 35 129.0 36 176.0 37 308.0 38 737.0 39 2122.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.047858942065496 14.86146095717884 6.120906801007556 35.96977329974811 2 23.1 16.975 33.95 25.974999999999998 3 19.025 17.9 25.45 37.625 4 23.35 24.325 22.975 29.349999999999998 5 24.2 29.599999999999998 23.474999999999998 22.725 6 22.325 32.175 25.174999999999997 20.325 7 15.0 30.625000000000004 38.725 15.65 8 16.150000000000002 28.975 31.5 23.375 9 17.075000000000003 26.650000000000002 33.6 22.675 10-11 19.625 35.3875 25.525 19.4625 12-13 19.7375 29.025000000000002 27.725 23.5125 14-15 19.55 29.512500000000003 27.3375 23.599999999999998 16-17 21.6 28.65 25.587500000000002 24.1625 18-19 19.4375 29.799999999999997 26.9625 23.799999999999997 20-21 20.4375 28.962500000000002 26.487500000000004 24.1125 22-23 20.5625 30.337500000000002 25.687500000000004 23.4125 24-25 20.349999999999998 28.6125 26.674999999999997 24.3625 26-27 20.3125 28.1125 25.887500000000003 25.687500000000004 28-29 21.0 30.7125 25.224999999999998 23.0625 30-31 20.0875 29.9 25.912499999999998 24.099999999999998 32-33 20.375 28.9875 25.6125 25.025 34-35 21.1875 29.037499999999998 25.25 24.525 36-37 20.2125 29.975 25.924999999999997 23.8875 38-39 20.8625 29.6875 25.424999999999997 24.025 40-41 19.6 29.95 26.8625 23.5875 42-43 20.2375 29.1875 25.674999999999997 24.9 44-45 21.1875 29.575000000000003 24.375 24.8625 46-47 19.662499999999998 29.862499999999997 25.324999999999996 25.15 48-49 20.925 29.1375 25.0375 24.9 50-51 20.025000000000002 29.225 25.0125 25.7375 52-53 21.325 29.037499999999998 25.662499999999998 23.974999999999998 54-55 20.8875 28.462500000000002 25.674999999999997 24.975 56-57 20.5625 28.3875 26.0625 24.9875 58-59 22.625 28.6875 26.025 22.662499999999998 60-61 20.45 29.349999999999998 25.324999999999996 24.875 62-63 21.3 28.449999999999996 25.362499999999997 24.887500000000003 64-65 19.625 29.812499999999996 25.8625 24.7 66-67 21.337500000000002 29.1375 24.9375 24.587500000000002 68-69 20.7125 29.825000000000003 24.5375 24.925 70-71 20.200000000000003 30.875000000000004 24.5125 24.4125 72-73 20.5 29.912499999999998 24.425 25.162499999999998 74-75 20.4875 28.925 25.2 25.387500000000003 76-77 21.05 27.925 25.9625 25.0625 78-79 21.9625 27.425 25.7625 24.85 80-81 21.9625 28.249999999999996 25.224999999999998 24.5625 82-83 22.037499999999998 27.737499999999997 25.912499999999998 24.3125 84-85 20.4375 28.349999999999998 25.4875 25.724999999999998 86-87 21.712500000000002 28.1 24.925 25.2625 88-89 21.8875 28.212500000000002 25.0 24.9 90-91 20.974999999999998 28.199999999999996 25.474999999999998 25.35 92-93 21.349999999999998 27.5875 25.75 25.3125 94-95 21.6875 27.3625 25.2625 25.687500000000004 96-97 21.375 28.575 24.7875 25.2625 98-99 21.7875 28.425 24.6125 25.174999999999997 100-101 22.5625 28.1375 24.925 24.375 102-103 22.7 27.6125 25.387500000000003 24.3 104-105 21.987499999999997 27.474999999999998 25.5125 25.025 106-107 23.0 28.5875 24.05 24.3625 108-109 22.287499999999998 28.5625 24.775 24.375 110-111 22.3625 28.075 24.6 24.962500000000002 112-113 22.325 28.275 24.212500000000002 25.1875 114-115 23.2125 27.200000000000003 24.725 24.8625 116-117 22.825 27.8125 23.775 25.587500000000002 118-119 22.9875 28.4 23.9125 24.7 120 24.224999999999998 27.800000000000004 23.875 24.099999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 3.0 27 2.5 28 4.5 29 9.0 30 10.5 31 13.5 32 28.0 33 44.0 34 47.0 35 64.0 36 97.5 37 118.0 38 140.5 39 177.5 40 203.0 41 214.5 42 219.5 43 215.5 44 214.0 45 217.5 46 212.5 47 200.0 48 173.5 49 153.5 50 167.5 51 150.0 52 108.5 53 96.0 54 81.0 55 81.0 56 85.0 57 67.5 58 55.0 59 50.5 60 48.0 61 36.0 62 26.5 63 25.5 64 24.0 65 24.5 66 20.0 67 12.5 68 9.5 69 8.5 70 7.0 71 5.5 72 4.0 73 2.5 74 1.5 75 2.5 76 2.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 120 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.94790864767769 96.39999999999999 2 0.8981267641775725 1.7500000000000002 3 0.10264305876315115 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025660764690787787 0.25 >50 0.025660764690787787 1.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 52 1.3 TruSeq Adapter, Index 2 (100% over 50bp) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 1.0875 0.0 0.0 0.0 0.0 92-93 1.35 0.0 0.0 0.0 0.0 94-95 1.6375000000000002 0.0 0.0 0.0 0.0 96-97 2.05 0.0 0.0 0.0 0.0 98-99 2.5375 0.0 0.0 0.0 0.0 100-101 3.1875 0.0 0.0 0.0 0.0 102-103 3.825 0.0 0.0 0.0 0.0 104-105 4.6625 0.0 0.0 0.0 0.0 106-107 5.525 0.0 0.0 0.0 0.0 108 6.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528761 spots for SRR28716039.sra Written 528761 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra Read 528756 spots for SRR28716039.sra Written 528756 spots for SRR28716039.sra SRR ids: ['SRR28716039.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7alf9641 SRR28716039.sra spots: 10575125 blocks: [[1, 528756], [528757, 1057512], [1057513, 1586268], [1586269, 2115024], [2115025, 2643780], [2643781, 3172536], [3172537, 3701292], [3701293, 4230048], [4230049, 4758804], [4758805, 5287560], [5287561, 5816316], [5816317, 6345072], [6345073, 6873828], [6873829, 7402584], [7402585, 7931340], [7931341, 8460096], [8460097, 8988852], [8988853, 9517608], [9517609, 10046364], [10046365, 10575125]] SRR28716039 file size 3453722 SRR28716039 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28716039 SRR28716039_1.fastq Input file: SRR28716039_1.fastq trimmed: SRR28716039-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:00:21 2024 >> started Sat Dec 7 13:00:27 2024 >> done (5.730s) 10575125 reads processed; of these: 681 ( 0.01%) short reads filtered out after trimming by size control 154050 ( 1.46%) empty reads filtered out after trimming by size control 10420394 (98.54%) reads available; of these: 1182432 (11.35%) trimmed reads available after processing 9237962 (88.65%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 103 0.00% 19 140 0.00% 20 132 0.00% 21 152 0.00% 22 194 0.00% 23 282 0.00% 24 333 0.00% 25 410 0.00% 26 544 0.01% 27 384 0.00% 28 350 0.00% 29 305 0.00% 30 345 0.00% 31 350 0.00% 32 387 0.00% 33 377 0.00% 34 369 0.00% 35 436 0.00% 36 421 0.00% 37 529 0.01% 38 460 0.00% 39 494 0.00% 40 469 0.00% 41 506 0.00% 42 495 0.00% 43 509 0.00% 44 521 0.00% 45 467 0.00% 46 517 0.00% 47 580 0.01% 48 565 0.01% 49 682 0.01% 50 622 0.01% 51 726 0.01% 52 687 0.01% 53 717 0.01% 54 721 0.01% 55 787 0.01% 56 770 0.01% 57 969 0.01% 58 862 0.01% 59 969 0.01% 60 1071 0.01% 61 1182 0.01% 62 1201 0.01% 63 1351 0.01% 64 1404 0.01% 65 1555 0.01% 66 1504 0.01% 67 1814 0.02% 68 1934 0.02% 69 2270 0.02% 70 2605 0.02% 71 2861 0.03% 72 3554 0.03% 73 4217 0.04% 74 4061 0.04% 75 3866 0.04% 76 4157 0.04% 77 4337 0.04% 78 4976 0.05% 79 5417 0.05% 80 6101 0.06% 81 6640 0.06% 82 7538 0.07% 83 8300 0.08% 84 9245 0.09% 85 10475 0.10% 86 11784 0.11% 87 12260 0.12% 88 13377 0.13% 89 1427 0.01% 90 1504 0.01% 91 1481 0.01% 92 1596 0.02% 93 1812 0.02% 94 1777 0.02% 95 1856 0.02% 96 2025 0.02% 97 2117 0.02% 98 2209 0.02% 99 2382 0.02% 100 2671 0.03% 101 3102 0.03% 102 1148 0.01% 103 1761 0.02% 104 2323 0.02% 105 2956 0.03% 106 3758 0.04% 107 4633 0.04% 108 5530 0.05% 109 6628 0.06% 110 7988 0.08% 111 9896 0.09% 112 12499 0.12% 113 15750 0.15% 114 20899 0.20% 115 28374 0.27% 116 41766 0.40% 117 62943 0.60% 118 136080 1.31% 119 629846 6.04% 120 9237962 88.65% 10420394 reads passed initial QC criterion=sequence-density sequence-density=5.68 sequence-density-rank=1 fanout-score=55.05 fanout-score-rank=1 prefix-density=7.39 prefix-fanout=42.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG criterion=fanout-score sequence-density=5.68 sequence-density-rank=1 fanout-score=55.05 fanout-score-rank=1 prefix-density=7.39 prefix-fanout=42.3 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -o SRR28716039 - Input file: STDIN trimmed: SRR28716039-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 13:00:56 2024 >> started Sat Dec 7 13:01:04 2024 >> done (8.307s) 6946929 reads processed; of these: 16 ( 0.00%) short reads filtered out after trimming by size control 2841 ( 0.04%) empty reads filtered out after trimming by size control 6944072 (99.96%) reads available; of these: 1031121 (14.85%) trimmed reads available after processing 5912951 (85.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 65 0.00% 19 100 0.00% 20 83 0.00% 21 100 0.00% 22 123 0.00% 23 190 0.00% 24 236 0.00% 25 259 0.00% 26 371 0.01% 27 266 0.00% 28 241 0.00% 29 199 0.00% 30 240 0.00% 31 220 0.00% 32 249 0.00% 33 250 0.00% 34 256 0.00% 35 286 0.00% 36 280 0.00% 37 340 0.00% 38 284 0.00% 39 320 0.00% 40 312 0.00% 41 314 0.00% 42 326 0.00% 43 339 0.00% 44 328 0.00% 45 318 0.00% 46 346 0.00% 47 386 0.01% 48 376 0.01% 49 473 0.01% 50 438 0.01% 51 489 0.01% 52 442 0.01% 53 464 0.01% 54 472 0.01% 55 540 0.01% 56 536 0.01% 57 641 0.01% 58 566 0.01% 59 617 0.01% 60 733 0.01% 61 764 0.01% 62 810 0.01% 63 892 0.01% 64 928 0.01% 65 1031 0.01% 66 998 0.01% 67 1223 0.02% 68 1254 0.02% 69 1481 0.02% 70 1617 0.02% 71 1679 0.02% 72 1803 0.03% 73 1942 0.03% 74 2156 0.03% 75 2563 0.04% 76 2765 0.04% 77 2868 0.04% 78 3291 0.05% 79 3637 0.05% 80 4153 0.06% 81 4506 0.06% 82 5033 0.07% 83 5521 0.08% 84 6188 0.09% 85 6912 0.10% 86 7757 0.11% 87 8129 0.12% 88 9132 0.13% 89 10168 0.15% 90 11209 0.16% 91 12152 0.17% 92 13440 0.19% 93 15108 0.22% 94 16349 0.24% 95 18422 0.27% 96 19897 0.29% 97 21029 0.30% 98 22476 0.32% 99 24472 0.35% 100 26135 0.38% 101 28078 0.40% 102 28512 0.41% 103 30558 0.44% 104 33151 0.48% 105 35701 0.51% 106 37604 0.54% 107 40983 0.59% 108 42264 0.61% 109 44463 0.64% 110 47472 0.68% 111 51285 0.74% 112 54240 0.78% 113 58485 0.84% 114 64914 0.93% 115 78393 1.13% 116 106191 1.53% 117 188959 2.72% 118 78386 1.13% 119 358471 5.16% 120 5219658 75.17% criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=46.20 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.4 sequence=CAATTATTTGTTTATGTCATTATACAATGTGGCACAATGTATAAAAAGTACAACATATTAGGTTTTAACCACACGATGCTAGCTTGGTCAATTGATTTCACTTTTATGGACTTTGCTATTACATGGGAGCATGAGGACCATATTATATATCCTAGCGCATCCAACATCACCACATATTGCCAGCTTATTTAACACATATACGCATATTTAGGTGCTTCCTTAGTTTCAACCACCATGCTGACCTCTTCCACCATATCCACCTCCAGGATAACCACCGCCATTACCACCGGATCCT Started job on | Dec 07 13:01:26 Started mapping on | Dec 07 13:01:27 Finished on | Dec 07 13:01:48 Mapping speed, Million of reads per hour | 1785.86 Number of input reads | 10417537 Average input read length | 117 UNIQUE READS: Uniquely mapped reads number | 9365052 Uniquely mapped reads % | 89.90% Average mapped length | 116.88 Number of splices: Total | 1534642 Number of splices: Annotated (sjdb) | 1362729 Number of splices: GT/AG | 1496034 Number of splices: GC/AG | 21114 Number of splices: AT/AC | 857 Number of splices: Non-canonical | 16637 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.06% Deletion average length | 2.48 Insertion rate per base | 0.04% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380534 % of reads mapped to multiple loci | 3.65% Number of reads mapped to too many loci | 297031 % of reads mapped to too many loci | 2.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671951 671951 671951 N_multimapping 380534 380534 380534 N_noFeature 413263 8955718 493767 N_ambiguous 349411 2143 21342 UnstrandedReadsAssigned:8602378 PositiveStrandReadsAssigned:407191 NegativeStrandReadsAssigned:8849943 Dataset is classified negative stranded MeadianReadLen=120 20thPercentileLength=119 echo kmer=115 SRR28716039 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR28716039-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,417,537 reads, 8,950,915 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR28716039.ke.tsv 35125 SRR28716039.se.tsv 88098 total ==> SRR28716039.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 0 0 PNS24249 1928 1829 0 0 PNS24246 1044 945 0 0 PNS24248 1044 945 0 0 PNS24244 1471 1372 350 44.7901 PNS24243 293 194 5 4.52519 KQK14069 1603 1504 3707.84 432.854 KQK14071 474 375 2.90509 1.36018 ==> SRR28716039.se.tsv <== BRADI_1g14170v3 3867 BRADI_1g53295v3 425 BRADI_1g59795v3 57 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 144 BRADI_1g74790v3 74 BRADI_1g09890v3 0 BRADI_1g77505v3 230 BRADI_1g48960v3 0 SRR28716039 completed mapping pipeline successfully