Starting /dee2/code/volunteer_pipeline.sh SRR28716040 current disk space = 1542890590208 free memory = 1603200564 SRR28716040 SRAfilesize 971852bc4002c1f0e356d75ec5f2aa0c SRR28716040.sra SRR28716040.sra file validated SRR28716040 is single end SRR28716040 is conventional basespace SRR28716040 read1 length is 120 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28716040_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 120 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3825 38.0 38.0 38.0 32.0 38.0 2 36.78 38.0 38.0 38.0 32.0 38.0 3 36.78475 38.0 38.0 38.0 32.0 38.0 4 36.582 38.0 38.0 38.0 32.0 38.0 5 36.8105 38.0 38.0 38.0 32.0 38.0 6 38.90375 40.0 38.0 40.0 38.0 40.0 7 38.89725 40.0 38.0 40.0 38.0 40.0 8 38.92 40.0 38.0 40.0 38.0 40.0 9 38.9125 40.0 38.0 40.0 38.0 40.0 10-11 38.79 40.0 38.0 40.0 38.0 40.0 12-13 38.844375 40.0 38.0 40.0 38.0 40.0 14-15 38.617125 40.0 38.0 40.0 38.0 40.0 16-17 38.697874999999996 40.0 38.0 40.0 38.0 40.0 18-19 38.747875 40.0 38.0 40.0 38.0 40.0 20-21 38.735875 40.0 38.0 40.0 38.0 40.0 22-23 38.789249999999996 40.0 38.0 40.0 38.0 40.0 24-25 38.515375 40.0 38.0 40.0 38.0 40.0 26-27 38.567625 40.0 38.0 40.0 38.0 40.0 28-29 38.644499999999994 40.0 38.0 40.0 38.0 40.0 30-31 38.620625000000004 40.0 38.0 40.0 38.0 40.0 32-33 38.552125000000004 40.0 38.0 40.0 38.0 40.0 34-35 38.565124999999995 40.0 38.0 40.0 38.0 40.0 36-37 38.587374999999994 40.0 38.0 40.0 38.0 40.0 38-39 38.5375 40.0 38.0 40.0 38.0 40.0 40-41 38.54325 40.0 38.0 40.0 38.0 40.0 42-43 38.506125 40.0 38.0 40.0 38.0 40.0 44-45 38.326625 40.0 38.0 40.0 38.0 40.0 46-47 38.344750000000005 40.0 38.0 40.0 38.0 40.0 48-49 38.095375000000004 40.0 38.0 40.0 38.0 40.0 50-51 38.130624999999995 40.0 38.0 40.0 38.0 40.0 52-53 38.162625000000006 40.0 38.0 40.0 38.0 40.0 54-55 38.24575 40.0 38.0 40.0 38.0 40.0 56-57 38.166875000000005 40.0 38.0 40.0 38.0 40.0 58-59 38.215374999999995 40.0 38.0 40.0 38.0 40.0 60-61 37.467625 39.0 38.0 40.0 32.0 40.0 62-63 38.060625 40.0 38.0 40.0 38.0 40.0 64-65 38.068875000000006 40.0 38.0 40.0 38.0 40.0 66-67 38.121875 40.0 38.0 40.0 38.0 40.0 68-69 38.105999999999995 40.0 38.0 40.0 38.0 40.0 70-71 38.071 40.0 38.0 40.0 38.0 40.0 72-73 37.83775 40.0 38.0 40.0 35.0 40.0 74-75 37.814750000000004 38.0 38.0 40.0 35.0 40.0 76-77 36.93662500000001 38.0 38.0 40.0 32.5 40.0 78-79 37.371375 38.0 38.0 40.0 32.0 40.0 80-81 37.599125 38.0 38.0 40.0 32.0 40.0 82-83 37.816625 38.0 38.0 40.0 38.0 40.0 84-85 37.768 38.0 38.0 40.0 32.0 40.0 86-87 37.642250000000004 38.0 38.0 40.0 32.0 40.0 88-89 37.616625 38.0 38.0 40.0 32.0 40.0 90-91 37.571625 38.0 38.0 40.0 32.0 40.0 92-93 37.494625 38.0 38.0 40.0 32.0 40.0 94-95 37.430375 38.0 38.0 40.0 32.0 40.0 96-97 37.264625 38.0 38.0 40.0 32.0 40.0 98-99 37.130875 38.0 38.0 40.0 32.0 40.0 100-101 37.105125 38.0 38.0 40.0 32.0 40.0 102-103 35.538250000000005 38.0 35.0 38.0 29.5 38.0 104-105 37.376125 38.0 38.0 39.0 32.0 40.0 106-107 37.8935 38.0 38.0 40.0 38.0 40.0 108-109 37.923125 40.0 38.0 40.0 38.0 40.0 110-111 37.88975000000001 40.0 38.0 40.0 38.0 40.0 112-113 37.804125 39.0 38.0 40.0 38.0 40.0 114-115 37.256375 38.0 38.0 40.0 32.0 40.0 116-117 37.675625 38.0 38.0 40.0 35.0 40.0 118-119 37.315 38.0 38.0 40.0 32.0 40.0 120 33.845 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 1.0 22 1.0 23 5.0 24 4.0 25 4.0 26 7.0 27 14.0 28 15.0 29 28.0 30 49.0 31 47.0 32 79.0 33 92.0 34 99.0 35 155.0 36 202.0 37 305.0 38 834.0 39 2052.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.679307711885976 10.002545176889793 6.515652837872232 43.802494273351996 2 22.025 11.55 34.925 31.5 3 20.525 14.05 23.95 41.475 4 27.1 21.075 20.925 30.9 5 26.424999999999997 26.55 22.7 24.325 6 21.425 28.999999999999996 25.374999999999996 24.2 7 18.3 20.025000000000002 37.75 23.925 8 20.4 19.650000000000002 31.2 28.749999999999996 9 19.475 20.275000000000002 32.625 27.625 10-11 23.7875 27.250000000000004 22.400000000000002 26.5625 12-13 22.475 21.637500000000003 27.125 28.762500000000003 14-15 22.162499999999998 22.1375 27.487499999999997 28.212500000000002 16-17 23.8625 22.225 25.662499999999998 28.249999999999996 18-19 23.1125 22.9375 24.9875 28.962500000000002 20-21 23.5375 23.5375 25.05 27.875 22-23 23.849999999999998 23.4875 23.9875 28.675 24-25 23.962500000000002 22.25 26.025 27.762500000000003 26-27 23.95 22.8875 24.762500000000003 28.4 28-29 24.087500000000002 21.712500000000002 24.975 29.225 30-31 23.5875 22.825 25.4 28.1875 32-33 23.3125 23.1875 25.4 28.1 34-35 23.5625 22.0625 26.2125 28.1625 36-37 24.587500000000002 22.375 24.65 28.3875 38-39 23.875 22.675 24.7375 28.712500000000002 40-41 25.374999999999996 21.6125 24.6125 28.4 42-43 24.65 22.5125 24.625 28.212500000000002 44-45 24.9 22.475 24.75 27.875 46-47 22.8875 23.25 25.3125 28.549999999999997 48-49 23.775 22.1375 24.95 29.1375 50-51 22.4375 22.4875 25.55 29.525000000000002 52-53 24.375 22.650000000000002 25.25 27.725 54-55 24.2875 23.1 24.55 28.0625 56-57 23.05 22.3125 25.525 29.1125 58-59 24.2 22.55 24.6125 28.6375 60-61 23.2875 22.8875 24.4375 29.3875 62-63 25.05 21.075 26.075 27.800000000000004 64-65 24.55 21.3875 25.412499999999998 28.65 66-67 24.1125 22.875 24.975 28.037499999999998 68-69 24.375 23.025000000000002 24.575 28.025 70-71 25.2375 22.1 24.525 28.1375 72-73 24.9375 22.6 24.0 28.462500000000002 74-75 24.5 22.8375 24.7875 27.875 76-77 24.587500000000002 22.0875 24.5 28.825 78-79 24.1375 22.7375 24.0125 29.1125 80-81 24.3625 22.9625 23.974999999999998 28.7 82-83 24.625 22.55 24.825 28.000000000000004 84-85 24.025 22.537499999999998 24.099999999999998 29.3375 86-87 23.8625 22.05 24.525 29.562500000000004 88-89 23.9875 22.425 24.3 29.2875 90-91 24.65 21.875 23.3875 30.0875 92-93 24.875 22.8125 24.8 27.5125 94-95 24.325 22.3 24.1875 29.1875 96-97 22.8 22.575 24.95 29.675 98-99 24.4125 22.525000000000002 24.275 28.787499999999998 100-101 24.7 21.6 24.637500000000003 29.062500000000004 102-103 24.8625 21.825 24.6 28.712500000000002 104-105 24.525 23.225 23.5875 28.6625 106-107 23.8125 22.825 24.1875 29.175 108-109 25.0375 22.3625 24.65 27.950000000000003 110-111 24.1625 22.400000000000002 25.474999999999998 27.962500000000002 112-113 25.7375 22.925 23.4125 27.925 114-115 25.0375 23.200000000000003 23.1 28.6625 116-117 24.875 23.45 23.9 27.775 118-119 24.474999999999998 22.412499999999998 24.05 29.062500000000004 120 24.525 24.15 22.975 28.349999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 3.0 29 3.5 30 4.0 31 6.0 32 7.0 33 8.5 34 12.5 35 17.5 36 31.0 37 39.5 38 37.5 39 44.5 40 50.5 41 66.5 42 77.0 43 86.5 44 121.5 45 122.0 46 111.5 47 136.5 48 148.5 49 154.0 50 174.5 51 164.5 52 148.5 53 176.0 54 199.5 55 237.0 56 248.5 57 200.0 58 171.0 59 156.0 60 142.0 61 110.5 62 83.0 63 74.5 64 57.5 65 50.5 66 50.0 67 42.5 68 46.5 69 43.5 70 30.5 71 26.5 72 20.0 73 17.0 74 11.0 75 7.5 76 9.5 77 5.5 78 2.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 120 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.6641574985524 77.425 2 7.064273306311524 12.2 3 1.9976838448176029 5.175 4 0.7527504342790967 2.6 5 0.37637521713954836 1.625 6 0.028951939779965255 0.15 7 0.0 0.0 8 0.08685581933989578 0.6 9 0.028951939779965255 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 9 0.22499999999999998 No Hit ATCGCTTCGAGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGC 8 0.2 No Hit GCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGC 8 0.2 No Hit GCGGTTATGAGTACGACCGGGCGTGAACGGTACTCGGTCCTCCGGATTTT 8 0.2 No Hit GTCAGTGTCGGCCCAGCAGAGTGCTTTCGCCGTTGGTGTTCTTTCCGATC 6 0.15 No Hit CACTCATCTTGGGGTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCT 5 0.125 No Hit CATCGTTTACGGCTAGGACTACTGGGGTCTCTAATCCCATTTGCTCCCCT 5 0.125 No Hit GTCGGTTCGGACCTCTGCTTAGTTTCATCCAAGCTTCATCCTGGTCATGG 5 0.125 No Hit CCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGAC 5 0.125 No Hit CCCCACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGT 5 0.125 No Hit CTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGC 5 0.125 No Hit ATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGG 5 0.125 No Hit CTTGTCCGTACCAGTTCTGAGTCGACTGTTCAGCGCTCGGGGAAAGCCCC 5 0.125 No Hit CCTAGAGTAACTTTTATCCGTTGAGCGACGGCCCTTCCACTCGGCACCGT 5 0.125 No Hit GCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGC 5 0.125 No Hit CCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGG 5 0.125 No Hit CTCAGTGTCAGTGTCGGCCCAGCAGAGTGCTTTCGCCGTTGGTGTTCTTT 5 0.125 No Hit GTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.3375000000000004 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.3 0.0 0.0 0.0 0.0 108 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227812 spots for SRR28716040.sra Written 1227812 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra Read 1227798 spots for SRR28716040.sra Written 1227798 spots for SRR28716040.sra SRR ids: ['SRR28716040.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ovcldcbw SRR28716040.sra spots: 24555974 blocks: [[1, 1227798], [1227799, 2455596], [2455597, 3683394], [3683395, 4911192], [4911193, 6138990], [6138991, 7366788], [7366789, 8594586], [8594587, 9822384], [9822385, 11050182], [11050183, 12277980], [12277981, 13505778], [13505779, 14733576], [14733577, 15961374], [15961375, 17189172], [17189173, 18416970], [18416971, 19644768], [19644769, 20872566], [20872567, 22100364], [22100365, 23328162], [23328163, 24555974]] SRR28716040 file size 8034039 SRR28716040 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28716040 SRR28716040_1.fastq Input file: SRR28716040_1.fastq trimmed: SRR28716040-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 12:58:40 2024 >> started Sat Dec 7 12:58:56 2024 >> done (15.801s) 24555974 reads processed; of these: 1411 ( 0.01%) short reads filtered out after trimming by size control 1571 ( 0.01%) empty reads filtered out after trimming by size control 24552992 (99.99%) reads available; of these: 2724627 (11.10%) trimmed reads available after processing 21828365 (88.90%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 189 0.00% 19 238 0.00% 20 297 0.00% 21 303 0.00% 22 360 0.00% 23 546 0.00% 24 656 0.00% 25 782 0.00% 26 1005 0.00% 27 764 0.00% 28 588 0.00% 29 732 0.00% 30 612 0.00% 31 758 0.00% 32 776 0.00% 33 749 0.00% 34 805 0.00% 35 836 0.00% 36 921 0.00% 37 1064 0.00% 38 1007 0.00% 39 957 0.00% 40 879 0.00% 41 1009 0.00% 42 925 0.00% 43 1021 0.00% 44 1050 0.00% 45 972 0.00% 46 956 0.00% 47 1005 0.00% 48 1130 0.00% 49 1204 0.00% 50 1220 0.00% 51 1229 0.01% 52 1250 0.01% 53 1245 0.01% 54 1386 0.01% 55 1506 0.01% 56 1489 0.01% 57 1477 0.01% 58 1605 0.01% 59 1645 0.01% 60 1769 0.01% 61 1984 0.01% 62 2029 0.01% 63 2176 0.01% 64 2335 0.01% 65 2484 0.01% 66 2671 0.01% 67 2865 0.01% 68 2952 0.01% 69 3092 0.01% 70 3495 0.01% 71 3844 0.02% 72 4226 0.02% 73 4506 0.02% 74 4865 0.02% 75 5352 0.02% 76 5807 0.02% 77 6079 0.02% 78 6581 0.03% 79 7678 0.03% 80 8172 0.03% 81 9001 0.04% 82 9640 0.04% 83 10829 0.04% 84 11885 0.05% 85 13144 0.05% 86 14208 0.06% 87 15613 0.06% 88 16787 0.07% 89 3046 0.01% 90 3325 0.01% 91 3401 0.01% 92 3711 0.02% 93 3807 0.02% 94 3900 0.02% 95 4184 0.02% 96 4534 0.02% 97 4583 0.02% 98 4889 0.02% 99 5420 0.02% 100 6272 0.03% 101 7146 0.03% 102 2707 0.01% 103 4094 0.02% 104 5293 0.02% 105 6825 0.03% 106 8599 0.04% 107 10898 0.04% 108 13209 0.05% 109 15542 0.06% 110 18816 0.08% 111 23863 0.10% 112 29443 0.12% 113 37435 0.15% 114 50185 0.20% 115 68709 0.28% 116 100680 0.41% 117 151461 0.62% 118 334274 1.36% 119 1559159 6.35% 120 21828365 88.90% 24552992 reads passed initial QC criterion=sequence-density sequence-density=2.91 sequence-density-rank=1 fanout-score=60.04 fanout-score-rank=1 prefix-density=3.89 prefix-fanout=44.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=2.91 sequence-density-rank=1 fanout-score=60.04 fanout-score-rank=1 prefix-density=3.89 prefix-fanout=44.9 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR28716040 - Input file: STDIN trimmed: SRR28716040-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 12:59:56 2024 >> started Sat Dec 7 13:00:09 2024 >> done (13.823s) 8184331 reads processed; of these: 5 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 8184326 (100.00%) reads available; of these: 710875 ( 8.69%) trimmed reads available after processing 7473451 (91.31%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 75 0.00% 19 68 0.00% 20 105 0.00% 21 98 0.00% 22 138 0.00% 23 194 0.00% 24 246 0.00% 25 244 0.00% 26 365 0.00% 27 243 0.00% 28 201 0.00% 29 262 0.00% 30 223 0.00% 31 274 0.00% 32 280 0.00% 33 273 0.00% 34 245 0.00% 35 295 0.00% 36 293 0.00% 37 369 0.00% 38 328 0.00% 39 320 0.00% 40 280 0.00% 41 309 0.00% 42 307 0.00% 43 329 0.00% 44 309 0.00% 45 302 0.00% 46 305 0.00% 47 352 0.00% 48 369 0.00% 49 413 0.01% 50 419 0.01% 51 403 0.00% 52 409 0.00% 53 411 0.01% 54 469 0.01% 55 509 0.01% 56 507 0.01% 57 499 0.01% 58 552 0.01% 59 574 0.01% 60 588 0.01% 61 711 0.01% 62 683 0.01% 63 726 0.01% 64 769 0.01% 65 837 0.01% 66 932 0.01% 67 986 0.01% 68 983 0.01% 69 1026 0.01% 70 1181 0.01% 71 1292 0.02% 72 1408 0.02% 73 1494 0.02% 74 1602 0.02% 75 1787 0.02% 76 1943 0.02% 77 2029 0.02% 78 2190 0.03% 79 2568 0.03% 80 2769 0.03% 81 2915 0.04% 82 3264 0.04% 83 3679 0.04% 84 3994 0.05% 85 4446 0.05% 86 4657 0.06% 87 5187 0.06% 88 5724 0.07% 89 5994 0.07% 90 6635 0.08% 91 7377 0.09% 92 8297 0.10% 93 9015 0.11% 94 9928 0.12% 95 10959 0.13% 96 12027 0.15% 97 13383 0.16% 98 14493 0.18% 99 15416 0.19% 100 17052 0.21% 101 18281 0.22% 102 18008 0.22% 103 19320 0.24% 104 21134 0.26% 105 22498 0.27% 106 25015 0.31% 107 27794 0.34% 108 29732 0.36% 109 33476 0.41% 110 35501 0.43% 111 38157 0.47% 112 42773 0.52% 113 45627 0.56% 114 55496 0.68% 115 70372 0.86% 116 97227 1.19% 117 169581 2.07% 118 102450 1.25% 119 474414 5.80% 120 6631358 81.03% criterion=sequence-density sequence-density=2.49 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=2.47 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.24 sequence-density-rank=21 fanout-score=5.47 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=2.0 sequence=CATGCACCACCACCCATAGAATCAAGAAAGAGCTCTCAGTCTGTCAATCCTTGCTATGTCTGGACCTGGTAAGTTTCCCCGTGTTG Started job on | Dec 07 13:00:38 Started mapping on | Dec 07 13:00:39 Finished on | Dec 07 13:01:25 Mapping speed, Million of reads per hour | 1921.54 Number of input reads | 24552987 Average input read length | 118 UNIQUE READS: Uniquely mapped reads number | 12450308 Uniquely mapped reads % | 50.71% Average mapped length | 118.14 Number of splices: Total | 2993509 Number of splices: Annotated (sjdb) | 2742218 Number of splices: GT/AG | 2938058 Number of splices: GC/AG | 37949 Number of splices: AT/AC | 1171 Number of splices: Non-canonical | 16331 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.42 Insertion rate per base | 0.03% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 5955972 % of reads mapped to multiple loci | 24.26% Number of reads mapped to too many loci | 5503543 % of reads mapped to too many loci | 22.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 1.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6146707 6146707 6146707 N_multimapping 5955972 5955972 5955972 N_noFeature 1352428 12022663 1450218 N_ambiguous 360552 1628 32492 UnstrandedReadsAssigned:10737328 PositiveStrandReadsAssigned:426017 NegativeStrandReadsAssigned:10967598 Dataset is classified negative stranded MeadianReadLen=120 20thPercentileLength=120 echo kmer=115 SRR28716040 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR28716040-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,552,987 reads, 11,523,305 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR28716040.ke.tsv 35125 SRR28716040.se.tsv 88098 total ==> SRR28716040.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 12.429 1.73539 PNS24247 1044 945 14.5833 1.80348 PNS24249 1928 1829 11.2213 0.716995 PNS24246 1044 945 14.5833 1.80348 PNS24248 1044 945 14.5833 1.80348 PNS24244 1471 1372 171.6 14.6167 PNS24243 293 194 0 0 KQK14069 1603 1504 5297.36 411.622 KQK14071 474 375 115.787 36.084 ==> SRR28716040.se.tsv <== BRADI_1g14170v3 5602 BRADI_1g53295v3 369 BRADI_1g59795v3 31 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 115 BRADI_1g74790v3 83 BRADI_1g09890v3 0 BRADI_1g77505v3 158 BRADI_1g48960v3 0 SRR28716040 completed mapping pipeline successfully