Starting /dee2/code/volunteer_pipeline.sh SRR28716041 current disk space = 1543062364160 free memory = 1603296108 SRR28716041 SRAfilesize f0092d7a5766e68888697482acf73dc2 SRR28716041.sra SRR28716041.sra file validated SRR28716041 is single end SRR28716041 is conventional basespace SRR28716041 read1 length is 120 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR28716041_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 120 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.61425 38.0 38.0 38.0 32.0 38.0 2 36.76675 38.0 38.0 38.0 32.0 38.0 3 36.88775 38.0 38.0 38.0 32.0 38.0 4 36.637 38.0 38.0 38.0 32.0 38.0 5 36.853 38.0 38.0 38.0 32.0 38.0 6 38.8975 40.0 38.0 40.0 38.0 40.0 7 38.8855 40.0 38.0 40.0 38.0 40.0 8 38.91175 40.0 38.0 40.0 38.0 40.0 9 38.93125 40.0 38.0 40.0 38.0 40.0 10-11 38.881625 40.0 38.0 40.0 38.0 40.0 12-13 38.88125 40.0 38.0 40.0 38.0 40.0 14-15 38.710499999999996 40.0 38.0 40.0 38.0 40.0 16-17 38.85 40.0 38.0 40.0 38.0 40.0 18-19 38.834125 40.0 38.0 40.0 38.0 40.0 20-21 38.801375 40.0 38.0 40.0 38.0 40.0 22-23 38.844625 40.0 38.0 40.0 38.0 40.0 24-25 38.625 40.0 38.0 40.0 38.0 40.0 26-27 38.749875 40.0 38.0 40.0 38.0 40.0 28-29 38.685625 40.0 38.0 40.0 38.0 40.0 30-31 38.675250000000005 40.0 38.0 40.0 38.0 40.0 32-33 38.614875 40.0 38.0 40.0 38.0 40.0 34-35 38.67725 40.0 38.0 40.0 38.0 40.0 36-37 38.678125 40.0 38.0 40.0 38.0 40.0 38-39 38.632374999999996 40.0 38.0 40.0 38.0 40.0 40-41 38.649625 40.0 38.0 40.0 38.0 40.0 42-43 38.602625 40.0 38.0 40.0 38.0 40.0 44-45 38.48 40.0 38.0 40.0 38.0 40.0 46-47 38.481375 40.0 38.0 40.0 38.0 40.0 48-49 38.218875 40.0 38.0 40.0 38.0 40.0 50-51 38.311125000000004 40.0 38.0 40.0 38.0 40.0 52-53 38.367875 40.0 38.0 40.0 38.0 40.0 54-55 38.348875 40.0 38.0 40.0 38.0 40.0 56-57 38.343 40.0 38.0 40.0 38.0 40.0 58-59 38.294125 40.0 38.0 40.0 38.0 40.0 60-61 37.471500000000006 39.0 38.0 40.0 35.0 40.0 62-63 38.098375 40.0 38.0 40.0 38.0 40.0 64-65 38.13575 40.0 38.0 40.0 38.0 40.0 66-67 38.129999999999995 40.0 38.0 40.0 38.0 40.0 68-69 38.251375 40.0 38.0 40.0 38.0 40.0 70-71 38.163375 40.0 38.0 40.0 38.0 40.0 72-73 38.058625 40.0 38.0 40.0 38.0 40.0 74-75 38.036249999999995 40.0 38.0 40.0 38.0 40.0 76-77 37.17575 39.0 38.0 40.0 35.0 40.0 78-79 37.510875 38.0 38.0 40.0 32.0 40.0 80-81 37.704375 38.0 38.0 40.0 32.0 40.0 82-83 37.825374999999994 38.0 38.0 40.0 35.0 40.0 84-85 37.7375 38.0 38.0 40.0 32.0 40.0 86-87 37.789625 38.0 38.0 40.0 35.0 40.0 88-89 37.72225 38.0 38.0 40.0 35.0 40.0 90-91 37.695750000000004 38.0 38.0 40.0 32.0 40.0 92-93 37.679249999999996 38.0 38.0 40.0 32.0 40.0 94-95 37.641875 38.0 38.0 40.0 32.0 40.0 96-97 37.373374999999996 38.0 38.0 40.0 32.0 40.0 98-99 37.439375 38.0 38.0 40.0 32.0 40.0 100-101 37.41175 38.0 38.0 40.0 32.0 40.0 102-103 35.85425 38.0 35.0 38.0 29.5 38.0 104-105 37.508125 38.0 38.0 40.0 35.0 40.0 106-107 37.97625 39.0 38.0 40.0 38.0 40.0 108-109 38.0935 40.0 38.0 40.0 38.0 40.0 110-111 38.09075 40.0 38.0 40.0 38.0 40.0 112-113 37.864999999999995 40.0 38.0 40.0 38.0 40.0 114-115 37.263625000000005 38.0 38.0 40.0 32.0 40.0 116-117 37.767875000000004 38.0 38.0 40.0 38.0 40.0 118-119 37.604625 39.0 38.0 40.0 38.0 40.0 120 34.34125 38.0 32.0 38.0 27.0 40.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-11 0.0 1101 12-13 0.0 1101 14-15 0.0 1101 16-17 0.0 1101 18-19 0.0 1101 20-21 0.0 1101 22-23 0.0 1101 24-25 0.0 1101 26-27 0.0 1101 28-29 0.0 1101 30-31 0.0 1101 32-33 0.0 1101 34-35 0.0 1101 36-37 0.0 1101 38-39 0.0 1101 40-41 0.0 1101 42-43 0.0 1101 44-45 0.0 1101 46-47 0.0 1101 48-49 0.0 1101 50-51 0.0 1101 52-53 0.0 1101 54-55 0.0 1101 56-57 0.0 1101 58-59 0.0 1101 60-61 0.0 1101 62-63 0.0 1101 64-65 0.0 1101 66-67 0.0 1101 68-69 0.0 1101 70-71 0.0 1101 72-73 0.0 1101 74-75 0.0 1101 76-77 0.0 1101 78-79 0.0 1101 80-81 0.0 1101 82-83 0.0 1101 84-85 0.0 1101 86-87 0.0 1101 88-89 0.0 1101 90-91 0.0 1101 92-93 0.0 1101 94-95 0.0 1101 96-97 0.0 1101 98-99 0.0 1101 100-101 0.0 1101 102-103 0.0 1101 104-105 0.0 1101 106-107 0.0 1101 108-109 0.0 1101 110-111 0.0 1101 112-113 0.0 1101 114-115 0.0 1101 116-117 0.0 1101 118-119 0.0 1101 120 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 1.0 24 9.0 25 8.0 26 11.0 27 18.0 28 21.0 29 25.0 30 18.0 31 47.0 32 73.0 33 57.0 34 86.0 35 142.0 36 189.0 37 339.0 38 815.0 39 2134.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.18204804045512 9.810366624525917 6.371681415929204 47.63590391908976 2 22.825 12.1 37.05 28.025 3 20.849999999999998 14.274999999999999 23.525 41.349999999999994 4 26.474999999999998 22.7 21.575 29.25 5 26.05 27.700000000000003 24.175 22.075 6 22.075 31.125000000000004 24.224999999999998 22.575 7 18.125 23.1 37.45 21.325 8 19.125 23.7 31.075000000000003 26.1 9 19.7 20.674999999999997 33.324999999999996 26.3 10-11 23.775 28.999999999999996 23.549999999999997 23.674999999999997 12-13 23.175 22.5625 25.887500000000003 28.375 14-15 22.275 24.1625 27.375 26.187500000000004 16-17 23.6875 24.4 25.3 26.6125 18-19 23.2625 24.0375 26.05 26.650000000000002 20-21 23.875 24.349999999999998 25.162499999999998 26.6125 22-23 23.2375 24.575 25.224999999999998 26.9625 24-25 22.675 25.337500000000002 24.8625 27.125 26-27 23.3 24.6125 25.2625 26.825 28-29 24.075 25.025 25.05 25.85 30-31 24.85 24.224999999999998 24.637500000000003 26.2875 32-33 22.412499999999998 25.4625 25.6 26.525 34-35 24.1375 24.375 24.637500000000003 26.85 36-37 24.224999999999998 25.337500000000002 24.4 26.0375 38-39 22.0 25.0125 25.387500000000003 27.6 40-41 24.5125 25.074999999999996 24.4875 25.924999999999997 42-43 23.6875 24.85 25.162499999999998 26.3 44-45 23.2875 24.337500000000002 24.8 27.575 46-47 22.95 25.074999999999996 25.337500000000002 26.637499999999996 48-49 23.7375 24.6125 24.325 27.325 50-51 22.625 24.7375 25.3 27.3375 52-53 23.1375 24.6625 25.137500000000003 27.0625 54-55 23.5625 24.6 24.575 27.2625 56-57 24.0625 25.2375 25.25 25.45 58-59 24.275 24.462500000000002 24.425 26.8375 60-61 23.599999999999998 24.0625 25.025 27.3125 62-63 24.275 23.775 25.324999999999996 26.625 64-65 23.5 23.8625 25.837500000000002 26.8 66-67 23.7875 24.462500000000002 24.637500000000003 27.1125 68-69 23.3125 24.2375 25.2375 27.212500000000002 70-71 23.225 24.775 25.25 26.75 72-73 22.925 25.0 24.1875 27.8875 74-75 23.5125 23.3375 26.2875 26.8625 76-77 24.425 25.412499999999998 24.474999999999998 25.687500000000004 78-79 24.025 24.0625 25.074999999999996 26.8375 80-81 23.95 25.45 25.1 25.5 82-83 23.400000000000002 24.2875 25.15 27.1625 84-85 24.375 24.05 24.275 27.3 86-87 24.099999999999998 25.2125 23.75 26.937499999999996 88-89 23.7 24.525 24.95 26.825 90-91 24.224999999999998 24.4 24.4125 26.9625 92-93 23.9375 24.5125 25.324999999999996 26.224999999999998 94-95 23.575 24.0625 25.887500000000003 26.474999999999998 96-97 23.1625 24.725 24.887500000000003 27.224999999999998 98-99 23.0875 23.9875 25.724999999999998 27.200000000000003 100-101 24.1375 24.5125 25.2125 26.137500000000003 102-103 24.75 23.65 24.3125 27.287499999999998 104-105 23.8125 24.4125 25.5125 26.2625 106-107 24.1625 24.325 24.962500000000002 26.55 108-109 24.0 24.1875 25.1 26.7125 110-111 24.45 23.724999999999998 25.337500000000002 26.487500000000004 112-113 23.9 24.275 24.95 26.875 114-115 24.075 25.337500000000002 23.7625 26.825 116-117 24.1125 24.8625 25.1 25.924999999999997 118-119 24.3 25.0375 24.6625 26.0 120 25.45 24.45 22.925 27.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.0 28 2.0 29 2.0 30 3.0 31 6.0 32 7.5 33 8.0 34 18.0 35 25.0 36 34.0 37 47.5 38 63.5 39 80.5 40 100.5 41 125.0 42 151.0 43 173.5 44 184.5 45 191.0 46 195.5 47 184.5 48 182.5 49 194.5 50 166.5 51 150.0 52 145.0 53 126.0 54 125.0 55 120.5 56 125.0 57 120.0 58 95.0 59 81.5 60 78.5 61 76.0 62 75.5 63 78.5 64 72.5 65 65.5 66 58.5 67 56.0 68 44.0 69 33.5 70 33.0 71 22.5 72 14.5 73 15.0 74 14.0 75 11.0 76 8.0 77 3.5 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 120 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.2750000000000004 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108 2.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871684 spots for SRR28716041.sra Written 871684 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra Read 871666 spots for SRR28716041.sra Written 871666 spots for SRR28716041.sra SRR ids: ['SRR28716041.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mf7qw78j SRR28716041.sra spots: 17433338 blocks: [[1, 871666], [871667, 1743332], [1743333, 2614998], [2614999, 3486664], [3486665, 4358330], [4358331, 5229996], [5229997, 6101662], [6101663, 6973328], [6973329, 7844994], [7844995, 8716660], [8716661, 9588326], [9588327, 10459992], [10459993, 11331658], [11331659, 12203324], [12203325, 13074990], [13074991, 13946656], [13946657, 14818322], [14818323, 15689988], [15689989, 16561654], [16561655, 17433338]] SRR28716041 file size 5700566 SRR28716041 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR28716041 SRR28716041_1.fastq Input file: SRR28716041_1.fastq trimmed: SRR28716041-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Sat Dec 7 13:02:31 2024 >> started Sat Dec 7 13:02:46 2024 >> done (15.107s) 17433338 reads processed; of these: 949 ( 0.01%) short reads filtered out after trimming by size control 724 ( 0.00%) empty reads filtered out after trimming by size control 17431665 (99.99%) reads available; of these: 1844830 (10.58%) trimmed reads available after processing 15586835 (89.42%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 120 0.00% 19 136 0.00% 20 174 0.00% 21 184 0.00% 22 253 0.00% 23 359 0.00% 24 412 0.00% 25 489 0.00% 26 695 0.00% 27 503 0.00% 28 414 0.00% 29 472 0.00% 30 450 0.00% 31 499 0.00% 32 563 0.00% 33 492 0.00% 34 519 0.00% 35 598 0.00% 36 601 0.00% 37 736 0.00% 38 696 0.00% 39 652 0.00% 40 649 0.00% 41 640 0.00% 42 682 0.00% 43 689 0.00% 44 665 0.00% 45 630 0.00% 46 662 0.00% 47 691 0.00% 48 762 0.00% 49 798 0.00% 50 804 0.00% 51 785 0.00% 52 825 0.00% 53 886 0.01% 54 889 0.01% 55 915 0.01% 56 956 0.01% 57 981 0.01% 58 980 0.01% 59 1062 0.01% 60 1140 0.01% 61 1269 0.01% 62 1261 0.01% 63 1364 0.01% 64 1530 0.01% 65 1511 0.01% 66 1574 0.01% 67 1769 0.01% 68 1865 0.01% 69 2003 0.01% 70 2010 0.01% 71 2304 0.01% 72 2405 0.01% 73 2748 0.02% 74 2879 0.02% 75 3149 0.02% 76 3428 0.02% 77 3676 0.02% 78 3908 0.02% 79 4594 0.03% 80 4724 0.03% 81 5076 0.03% 82 5697 0.03% 83 6238 0.04% 84 6960 0.04% 85 7636 0.04% 86 8162 0.05% 87 9045 0.05% 88 9722 0.06% 89 2195 0.01% 90 2319 0.01% 91 2457 0.01% 92 2592 0.01% 93 2793 0.02% 94 2784 0.02% 95 2976 0.02% 96 3103 0.02% 97 3315 0.02% 98 3465 0.02% 99 3688 0.02% 100 4461 0.03% 101 4937 0.03% 102 1882 0.01% 103 2845 0.02% 104 3665 0.02% 105 4681 0.03% 106 5976 0.03% 107 7538 0.04% 108 8940 0.05% 109 10754 0.06% 110 12987 0.07% 111 16148 0.09% 112 20393 0.12% 113 25929 0.15% 114 34423 0.20% 115 46738 0.27% 116 69128 0.40% 117 103686 0.59% 118 227348 1.30% 119 1065069 6.11% 120 15586835 89.42% 17431665 reads passed initial QC criterion=sequence-density sequence-density=2.33 sequence-density-rank=1 fanout-score=57.91 fanout-score-rank=2 prefix-density=3.14 prefix-fanout=43.0 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=87.54 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=15.2 sequence=TTCTTCTTCTTCCTCTTGATCACCTCGCCATTGTCATCGATCACCTC Potential 3prime adapter identified. Now checking if in reference sequence Warning: gzbuffer added in zlib v1.2.3.5. Unable to change buffer size from default of 8192. 1 reads; of these: 1 (100.00%) were unpaired; of these: 1 (100.00%) aligned 0 times 0 (0.00%) aligned exactly 1 time 0 (0.00%) aligned >1 times 0.00% overall alignment rate Adapter seq not found in reference. Now shuffling file before clipping skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -t 20 -x AGATCGGAAGAGCACACGTCTGAACTCCAGT -o SRR28716041 - Input file: STDIN trimmed: SRR28716041-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGT -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): 3 -- number of concurrent threads (-t): 20 Sat Dec 7 13:03:40 2024 >> started Sat Dec 7 13:03:50 2024 >> done (9.291s) 5810555 reads processed; of these: 4 ( 0.00%) short reads filtered out after trimming by size control 0 ( 0.00%) empty reads filtered out after trimming by size control 5810551 (100.00%) reads available; of these: 465061 ( 8.00%) trimmed reads available after processing 5345490 (92.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 40 0.00% 19 40 0.00% 20 53 0.00% 21 49 0.00% 22 72 0.00% 23 118 0.00% 24 132 0.00% 25 171 0.00% 26 230 0.00% 27 155 0.00% 28 162 0.00% 29 161 0.00% 30 166 0.00% 31 158 0.00% 32 176 0.00% 33 169 0.00% 34 195 0.00% 35 201 0.00% 36 197 0.00% 37 247 0.00% 38 247 0.00% 39 239 0.00% 40 239 0.00% 41 209 0.00% 42 230 0.00% 43 241 0.00% 44 238 0.00% 45 228 0.00% 46 228 0.00% 47 257 0.00% 48 255 0.00% 49 254 0.00% 50 272 0.00% 51 268 0.00% 52 251 0.00% 53 309 0.01% 54 309 0.01% 55 310 0.01% 56 317 0.01% 57 325 0.01% 58 335 0.01% 59 358 0.01% 60 383 0.01% 61 423 0.01% 62 422 0.01% 63 453 0.01% 64 512 0.01% 65 527 0.01% 66 512 0.01% 67 611 0.01% 68 604 0.01% 69 650 0.01% 70 650 0.01% 71 737 0.01% 72 799 0.01% 73 932 0.02% 74 951 0.02% 75 1037 0.02% 76 1156 0.02% 77 1246 0.02% 78 1312 0.02% 79 1497 0.03% 80 1573 0.03% 81 1693 0.03% 82 1842 0.03% 83 2142 0.04% 84 2371 0.04% 85 2540 0.04% 86 2755 0.05% 87 3040 0.05% 88 3201 0.06% 89 3476 0.06% 90 3913 0.07% 91 4290 0.07% 92 4754 0.08% 93 5245 0.09% 94 5792 0.10% 95 6317 0.11% 96 6931 0.12% 97 7526 0.13% 98 8125 0.14% 99 8843 0.15% 100 10068 0.17% 101 10402 0.18% 102 10246 0.18% 103 11647 0.20% 104 12586 0.22% 105 13819 0.24% 106 15307 0.26% 107 16834 0.29% 108 18132 0.31% 109 20031 0.34% 110 21576 0.37% 111 23372 0.40% 112 26197 0.45% 113 29158 0.50% 114 34365 0.59% 115 46233 0.80% 116 69335 1.19% 117 141261 2.43% 118 69633 1.20% 119 327912 5.64% 120 4771843 82.12% criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=27 prefix-density=0.32 prefix-fanout=2.8 sequence=TTTCCTCTGGCT criterion=fanout-score sequence-density=0.14 sequence-density-rank=16 fanout-score=83.23 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=14.8 sequence=TTCTTCTTCTTCCTCTTGATCACCTCGCCATTGTCATCGATCACCTC Started job on | Dec 07 13:04:27 Started mapping on | Dec 07 13:04:28 Finished on | Dec 07 13:05:06 Mapping speed, Million of reads per hour | 1651.42 Number of input reads | 17431661 Average input read length | 119 UNIQUE READS: Uniquely mapped reads number | 15848868 Uniquely mapped reads % | 90.92% Average mapped length | 118.37 Number of splices: Total | 6428493 Number of splices: Annotated (sjdb) | 6094576 Number of splices: GT/AG | 6332950 Number of splices: GC/AG | 76829 Number of splices: AT/AC | 4067 Number of splices: Non-canonical | 14647 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 904044 % of reads mapped to multiple loci | 5.19% Number of reads mapped to too many loci | 522317 % of reads mapped to too many loci | 3.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 678749 678749 678749 N_multimapping 904044 904044 904044 N_noFeature 582361 15462466 686028 N_ambiguous 312997 2286 30746 UnstrandedReadsAssigned:14953510 PositiveStrandReadsAssigned:384116 NegativeStrandReadsAssigned:15132094 Dataset is classified negative stranded MeadianReadLen=120 20thPercentileLength=120 echo kmer=115 SRR28716041 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR28716041-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,431,661 reads, 15,320,756 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR28716041.ke.tsv 35125 SRR28716041.se.tsv 88098 total ==> SRR28716041.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 78.2613 9.43222 PNS24247 1044 945 26.292 2.80663 PNS24249 1928 1829 42.4209 2.33969 PNS24246 1044 945 26.292 2.80663 PNS24248 1044 945 26.292 2.80663 PNS24244 1471 1372 79.4417 5.84099 PNS24243 293 194 0 0 KQK14069 1603 1504 417.483 28.0016 KQK14071 474 375 18.2359 4.90556 ==> SRR28716041.se.tsv <== BRADI_1g14170v3 452 BRADI_1g53295v3 219 BRADI_1g59795v3 35 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 863 BRADI_1g74790v3 126 BRADI_1g09890v3 0 BRADI_1g77505v3 139 BRADI_1g48960v3 0 SRR28716041 completed mapping pipeline successfully